ID: 905008472

View in Genome Browser
Species Human (GRCh38)
Location 1:34730193-34730215
Sequence CTGTGTATGCACATCTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905008472_905008476 8 Left 905008472 1:34730193-34730215 CCCAAATAGATGTGCATACACAG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 905008476 1:34730224-34730246 CACACACTCATGCCTCATGTAGG 0: 1
1: 0
2: 0
3: 12
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905008472 Original CRISPR CTGTGTATGCACATCTATTT GGG (reversed) Intronic
902070608 1:13732185-13732207 CTGTGGATGAACAGCTATTTTGG + Intronic
902102594 1:14004380-14004402 GTATTTATGCACATGTATTTTGG - Intergenic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
903337696 1:22635854-22635876 CTGTGTAGTCCCAGCTATTTGGG - Intergenic
903649191 1:24912783-24912805 CTGTGAAAACACATCTATTGTGG + Intronic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905246111 1:36615117-36615139 CTTTGTACACACATCTATGTCGG - Intergenic
906216022 1:44040070-44040092 ATGTATGTACACATCTATTTTGG + Intergenic
907543373 1:55237301-55237323 CCCTGTAAGCCCATCTATTTCGG - Intergenic
908603624 1:65768713-65768735 TGGTGTATGTCCATCTATTTAGG - Intergenic
909256831 1:73434864-73434886 ATGTGTATACACATTTACTTTGG - Intergenic
909821700 1:80071434-80071456 GTGTGTATGTACTACTATTTGGG - Intergenic
910031271 1:82726845-82726867 CTGAATATGCACATATATTTAGG + Intergenic
911381826 1:97124745-97124767 GTGTGGATGCACAAATATTTGGG - Intronic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912902350 1:113665590-113665612 GTGTGTATGTATATATATTTTGG + Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913693291 1:121300129-121300151 ATTTGTATGCACATGTATCTAGG - Intronic
914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG + Intronic
917309087 1:173658959-173658981 ATGTGTATATACATCTATATGGG - Intronic
917732332 1:177887589-177887611 CTGTGGATGCACACATTTTTGGG + Intergenic
918000832 1:180493624-180493646 TTGTGTAAGCTGATCTATTTAGG - Intronic
918385146 1:183998703-183998725 CTATGTCTCCACATTTATTTTGG + Intronic
920172380 1:204080126-204080148 CTGGGTATCCAAAGCTATTTGGG - Intronic
920480613 1:206318498-206318520 ATTTGTATGCACATGTATCTAGG - Intronic
921715602 1:218414214-218414236 GTGTGTGTGCACATGTGTTTAGG - Intronic
922357828 1:224793534-224793556 CTGTGAATTTCCATCTATTTAGG + Intergenic
923928679 1:238666795-238666817 CAATGTATGCAAATCTTTTTTGG + Intergenic
1063891419 10:10632839-10632861 GTGTGTGTGCACAGTTATTTTGG - Intergenic
1067087831 10:43252209-43252231 CTGTGTATGCACACCCATGTGGG - Intronic
1069109052 10:64421935-64421957 CTGAGAATGCACATTTGTTTGGG - Intergenic
1069592241 10:69649438-69649460 CAGTGTATGCACATTCCTTTGGG - Intergenic
1069746876 10:70720829-70720851 CTGTGTGCACACATCTAATTTGG - Intronic
1071853555 10:89600213-89600235 CTGTGTAAGCACCTCTTTCTTGG - Intronic
1072394968 10:95029828-95029850 TTTTGGATGCATATCTATTTAGG + Intergenic
1072431010 10:95370365-95370387 CTCTGTATTCCCAGCTATTTGGG - Intronic
1073724282 10:106211592-106211614 CTGTGTTTGCACTTCTATCCAGG - Intergenic
1074390250 10:113051181-113051203 GTGTGTATGCACATGTATGAAGG - Intronic
1074963330 10:118467359-118467381 TTGTGTTTGCACATCATTTTCGG - Intergenic
1075034292 10:119050263-119050285 CTGTGTATTAACATTTATTGAGG - Intronic
1076083224 10:127602465-127602487 CTGTCCAAGCACATCTATATAGG - Intergenic
1076099436 10:127763779-127763801 GTCTGTTTACACATCTATTTAGG + Intergenic
1076745970 10:132514681-132514703 GTGTGTATGCACATATGTATTGG + Intergenic
1078478111 11:11651542-11651564 GTGTGTGTGCACATTTCTTTGGG - Intergenic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079550002 11:21683710-21683732 CTGTTTTTCCACATGTATTTGGG + Intergenic
1079714474 11:23728133-23728155 GTGAGTATTCACATCTTTTTTGG + Intergenic
1079917475 11:26387710-26387732 CTTTTTATGCACATGTATTTTGG + Intronic
1089834588 11:121358771-121358793 CTGAGTATTAATATCTATTTTGG + Intergenic
1090401333 11:126450139-126450161 ATGTGTATACACATGTATGTGGG + Intronic
1091105477 11:132915237-132915259 ACGTGTATACACATCTATCTGGG + Intronic
1091895071 12:4095854-4095876 CTGTATATGTATATCAATTTAGG - Intergenic
1093586415 12:20842458-20842480 ATGTTTATGTAAATCTATTTGGG + Intronic
1094150627 12:27278999-27279021 CTGTATTTTGACATCTATTTGGG - Intronic
1098373603 12:69787078-69787100 GTGTGTTTGCATATCTTTTTAGG + Intronic
1099045565 12:77713160-77713182 GTGCGTTTGCACATTTATTTAGG + Intergenic
1099178384 12:79449950-79449972 GTGTGTGTGCACATTTGTTTGGG + Exonic
1099435948 12:82645214-82645236 CTTGGTGTGCACATTTATTTTGG - Intergenic
1101012766 12:100468018-100468040 CTATGGATGCAAATCTTTTTTGG + Intergenic
1101015810 12:100498894-100498916 CTGTGTATGCCCATTTTCTTAGG + Intronic
1101036582 12:100713651-100713673 CTATATATACACACCTATTTTGG - Intergenic
1101473602 12:105022321-105022343 GTGTGTGTGCACATGAATTTTGG + Exonic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1106513242 13:30429701-30429723 TTGTGTTTGCACATGTTTTTTGG + Intergenic
1106787686 13:33123324-33123346 CTGTTTATGCTAATCTTTTTCGG + Intronic
1108253727 13:48591135-48591157 GTGTGTGTGCACACCTGTTTAGG + Intergenic
1108930265 13:55808699-55808721 GAGTGTATGCGCAGCTATTTGGG - Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1110856752 13:80304890-80304912 CTGTGAAGGCACATTTATTGAGG + Intergenic
1111316309 13:86565268-86565290 CTGTTTATATACATATATTTGGG + Intergenic
1111333271 13:86789413-86789435 CTGTTTATGCAGGTATATTTGGG - Intergenic
1112306249 13:98276906-98276928 CTGTATATGAACAGCTATTGTGG - Intronic
1115097846 14:29660213-29660235 CTGTGTATGCACATAGTTTCCGG + Intronic
1117278978 14:54219370-54219392 CTTTGTAAGCAAATCTCTTTGGG - Intergenic
1117563958 14:56974759-56974781 CAGTGTGTTCACATTTATTTAGG + Intergenic
1118826378 14:69386535-69386557 CTGTGTAAGTACGTATATTTTGG - Intronic
1119110187 14:71965325-71965347 CTCTACTTGCACATCTATTTTGG - Intronic
1126124095 15:45279675-45279697 ATGTGTATGGACATCTTTCTAGG + Intergenic
1126432011 15:48596313-48596335 AAGTGCATGCACATCGATTTGGG + Exonic
1128160888 15:65422339-65422361 TTGTGTCTGCACCTCCATTTGGG - Intronic
1130157946 15:81369577-81369599 CATTTTATGCACACCTATTTTGG + Intronic
1131027495 15:89156846-89156868 CTGTATATGCACAAATATTTGGG + Intronic
1132068685 15:98755222-98755244 CGGTGTATGGATATCAATTTAGG + Intronic
1132305721 15:100810740-100810762 CTGTGTATGCCCAACTTTATGGG + Intergenic
1134794102 16:17018828-17018850 CTGTGTCTGTACATCTACGTGGG + Intergenic
1138358833 16:56408844-56408866 CTGTAGATGCACATTTATCTGGG + Intronic
1140294006 16:73690251-73690273 CTGAGTCTGCAAATCTAGTTTGG - Intergenic
1140425051 16:74854014-74854036 CTGTTGATGAACATTTATTTAGG + Intergenic
1141075498 16:81003097-81003119 CTGTGTATGCACCAACATTTAGG - Intronic
1141300353 16:82809973-82809995 CTCTGTATGCCCATCTATTAAGG + Intronic
1141327604 16:83076727-83076749 ATATGCATGCAGATCTATTTAGG - Intronic
1144187940 17:12814117-12814139 ATGTGTATGCTCTTCTCTTTGGG + Intronic
1144757640 17:17689620-17689642 GTGGGTATGCATATGTATTTTGG + Intronic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1146408961 17:32565584-32565606 CTGTGAATGCCCATCTACTCAGG + Intronic
1146710419 17:35036209-35036231 CCATGTATGTATATCTATTTAGG - Intronic
1149005343 17:51799392-51799414 CTTTGTTTGCTCATCTATCTGGG + Intronic
1149249468 17:54751577-54751599 CAGTGTATACTCTTCTATTTTGG - Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155596609 18:27495290-27495312 CTCTGAATGCACATCTCTTTGGG - Intergenic
1155633040 18:27918037-27918059 GTGTGTGTGCACATGTTTTTTGG + Intergenic
1156018368 18:32571418-32571440 CTGCGTATGTATTTCTATTTTGG + Intergenic
1156222721 18:35069623-35069645 CTATGTATTAACTTCTATTTTGG - Intronic
1156260923 18:35444482-35444504 CTGTGTCTGCACATCAACCTTGG - Intronic
1168572006 19:57478326-57478348 TTGTGTATAGACATCTAGTTTGG - Intergenic
926293306 2:11548245-11548267 ATGTGTGTGCACATATGTTTGGG - Intronic
927473996 2:23398137-23398159 TAGTGTATGAACATCTGTTTGGG - Intronic
928585794 2:32756740-32756762 CTGGATATGTACATCCATTTTGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929317824 2:40501684-40501706 GTGTGGATGGACATCTATTTTGG + Intronic
932096220 2:68851176-68851198 GTGTGTGTGTACATCTACTTAGG - Intergenic
932294670 2:70614478-70614500 GTGTGCATGCAAAACTATTTAGG - Intronic
935365177 2:102281708-102281730 TTTTTTATGCACATATATTTGGG + Intergenic
935916932 2:107964177-107964199 CTGTATATCTACACCTATTTAGG + Intergenic
936074740 2:109394653-109394675 ATGTGTGTGCACATCTATGTAGG + Intronic
937668274 2:124511971-124511993 GTGTGTGCGCACATCTATGTTGG + Intronic
938578923 2:132628569-132628591 CTATCTATGCACATCTTTCTGGG + Intronic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
941469420 2:165865874-165865896 CTGTATATGCATATGTATGTAGG + Intronic
942626357 2:177904906-177904928 ATGTGTATCCACTTCCATTTGGG + Intronic
944285861 2:197949106-197949128 CTGTGTATGATAATCTAGTTGGG + Intronic
944606703 2:201358365-201358387 CTGTGTAGTCCCATCTACTTGGG - Intergenic
945208681 2:207359291-207359313 CTGAGGATGCACGACTATTTTGG + Intergenic
945580072 2:211582058-211582080 CTGTGTTTGCACATATCTTCTGG + Intronic
945940258 2:215942207-215942229 CTGTGTATGCAGGTTGATTTGGG - Intergenic
946919452 2:224563442-224563464 CTGTGTGTGCACTTCTTTTCTGG + Intronic
948811634 2:240481364-240481386 CAGTGAATGCACATCCATTCAGG + Intronic
1170576408 20:17665092-17665114 CTGTGTATACATATATATGTGGG + Intronic
1174944075 20:54965545-54965567 CTATGTATGCACATCTATACAGG + Intergenic
1175963832 20:62650244-62650266 CTGTGTGTGCACGTCTGTGTAGG - Intronic
1176663457 21:9662055-9662077 GTGTGTGTGCCCATCTATTTTGG + Intergenic
1177021663 21:15867860-15867882 ATATGTATGCCCATTTATTTAGG - Intronic
1178289096 21:31351397-31351419 CAGTGTATGCACATATAATTTGG + Intronic
1178440753 21:32596374-32596396 ATTTATATGCACATGTATTTTGG + Intronic
1179013740 21:37576306-37576328 CTTTGTATGCAGGTGTATTTAGG + Intergenic
949461342 3:4298138-4298160 CTGTTTATGGAAATCTATTAGGG + Intronic
949646625 3:6102538-6102560 CTGTGGCTGCACATGTATGTAGG - Intergenic
949695334 3:6688217-6688239 CTGTCTATGCACATAGATGTGGG - Intergenic
950255811 3:11504626-11504648 ATGTGTCTGAACATATATTTAGG + Intronic
950957345 3:17068582-17068604 ATCTCTATGCATATCTATTTTGG + Intronic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
953752806 3:45622246-45622268 GTCTCTGTGCACATCTATTTTGG + Intronic
954260064 3:49432288-49432310 CTGTGTAGTCCCAGCTATTTGGG + Intergenic
956378160 3:68637538-68637560 GATTGTATGCACATTTATTTTGG + Intergenic
959489662 3:106973190-106973212 CTGTGATTCCACATCTGTTTGGG - Intergenic
963998745 3:151742017-151742039 CAGTGTATTCACATATGTTTGGG - Intronic
964032217 3:152151899-152151921 ATGTTTATGCCCATATATTTGGG + Intergenic
965519633 3:169659710-169659732 CTCTGTATGCCCACCTACTTGGG - Intronic
966470713 3:180285780-180285802 TCGTGGATGCACAGCTATTTTGG - Intergenic
967264740 3:187680491-187680513 CTGTGAATGCAACTTTATTTAGG + Intergenic
969939746 4:10719517-10719539 GTGTGTATGCACACACATTTAGG - Intergenic
970842110 4:20485907-20485929 TTGTGCATGCATGTCTATTTAGG - Intronic
972114594 4:35615068-35615090 TTGTGTATACACATATATGTAGG + Intergenic
972721703 4:41706021-41706043 CAGAGTATACACATATATTTAGG + Intergenic
973110982 4:46397546-46397568 TTGTGTATGCACTTGTCTTTTGG + Intronic
974881093 4:67757994-67758016 ATGTGTATGAAAATGTATTTGGG + Intergenic
974976155 4:68894745-68894767 ATGTGTATACACATCCTTTTAGG + Intergenic
976359158 4:84157352-84157374 CTGATTATTCACATCTATTCTGG + Intergenic
976561009 4:86500836-86500858 ATGTGTATCCATAACTATTTTGG - Intronic
978348402 4:107796328-107796350 CTGTCTATGCTCATCTTTATTGG - Intergenic
978695662 4:111575064-111575086 CTGTGTAATCCCAGCTATTTGGG - Intergenic
980591334 4:134893294-134893316 CTATGTATACACATGCATTTGGG - Intergenic
980752532 4:137110308-137110330 CTGTACATGAACATCTATTCTGG - Intergenic
981824115 4:148919970-148919992 ATGTATATGAACATCTATTGTGG + Intergenic
983837818 4:172414353-172414375 CTGTGTATACACATATAAGTTGG - Intronic
985411845 4:189693858-189693880 GTGTGTGTGCCCATCTATTTTGG - Intergenic
986883616 5:12206611-12206633 CTGTGTATTCTGTTCTATTTGGG + Intergenic
987280217 5:16406269-16406291 CTCTCTATGCACATCAAATTGGG - Intergenic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
988175705 5:27721992-27722014 CTGTGTAAGAACAACTATTTGGG - Intergenic
990800189 5:59593391-59593413 CAGTGAAAGCAAATCTATTTTGG - Intronic
990800653 5:59598977-59598999 CCTTGAATGCACATCTCTTTTGG + Intronic
992166167 5:74054120-74054142 CTGTGTTTGCACATCTGTGGTGG + Intergenic
993009262 5:82460948-82460970 CTTTGGATGCATATATATTTAGG - Intergenic
993645660 5:90457329-90457351 TTGTTTATGCAGATTTATTTTGG - Intergenic
997018012 5:129960670-129960692 CTTTGTATCAACATCTTTTTAGG + Intronic
997643963 5:135468071-135468093 CTCTGCATGCACATCTAATGAGG - Intergenic
998655001 5:144168975-144168997 TTATATATGCACATTTATTTGGG + Intronic
999535931 5:152517600-152517622 TTCTGTATGCAAATATATTTTGG + Intergenic
999922148 5:156332953-156332975 ATATGTATGTACATCTATTGAGG - Intronic
999966356 5:156813977-156813999 CTGTGTTTTCACATGTATTTAGG - Intergenic
1000081922 5:157856554-157856576 CTATGGATGCACGTCTATTATGG + Intronic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1001798467 5:174522577-174522599 GTGTATATACACATCTATGTAGG + Intergenic
1003030142 6:2594473-2594495 CTGGGTATTAACATCAATTTGGG - Intergenic
1003372929 6:5546144-5546166 GTGTTTATGGACCTCTATTTAGG - Intronic
1005800103 6:29412230-29412252 CTGTGGGTGCATATATATTTAGG - Intronic
1010062023 6:71634771-71634793 CTCTGTATGCTCATCCTTTTTGG + Intergenic
1010178110 6:73053202-73053224 TTTTGGATGCATATCTATTTAGG - Intronic
1010812232 6:80314218-80314240 ATGTATATGCTCTTCTATTTGGG + Intronic
1010986740 6:82433651-82433673 CTGTGTATCCCCATCTCTTTTGG + Intergenic
1011234023 6:85195490-85195512 CCATGCATGCACATCTCTTTTGG + Intergenic
1011636720 6:89381400-89381422 CTGTGTATTTATCTCTATTTAGG + Intronic
1012020422 6:93911074-93911096 CTATGTATTCACATGTGTTTTGG + Intergenic
1012069252 6:94591430-94591452 GTCTGTTTACACATCTATTTAGG - Intergenic
1012752719 6:103183998-103184020 GAGTGTATGCACACCTGTTTGGG - Intergenic
1013970906 6:116017276-116017298 GTCTGTTTGCACATCCATTTAGG - Intronic
1014602827 6:123436571-123436593 CTATGTATGCTCTTCTTTTTAGG + Intronic
1014811971 6:125896940-125896962 TTGTGTTTGCACACGTATTTAGG + Intronic
1015027186 6:128549214-128549236 TTGTGTTTGAACATCTGTTTGGG - Intergenic
1016362525 6:143283707-143283729 CTGTGTGTGCAATTCTGTTTTGG - Intronic
1018655249 6:166027789-166027811 TTGAGTATCCACATCTATCTGGG - Intergenic
1020215772 7:6189036-6189058 CTGTGAAGCCACATTTATTTTGG + Intronic
1020849257 7:13329758-13329780 TTAGTTATGCACATCTATTTAGG - Intergenic
1021736741 7:23646826-23646848 CTGAGGATGAACACCTATTTTGG - Intergenic
1022062147 7:26808212-26808234 CTGTTCATGGACATTTATTTGGG - Intronic
1026508071 7:71003549-71003571 CGGTCACTGCACATCTATTTGGG + Intergenic
1030167173 7:106566930-106566952 CTGTGTGTGTACATCTGTATGGG - Intergenic
1032344234 7:131105366-131105388 TTGTGAAATCACATCTATTTAGG - Intergenic
1033308212 7:140240104-140240126 CTTAATATGCACATATATTTGGG + Intergenic
1035067497 7:156118496-156118518 CTGTCTCTGCAAATCTGTTTTGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041191245 8:55357261-55357283 GTTTATATGCACATATATTTTGG + Intronic
1042375786 8:68050718-68050740 CTGTGCATACAAATCTCTTTTGG - Intronic
1043286649 8:78540355-78540377 ATATATATCCACATCTATTTTGG + Intronic
1043389263 8:79776369-79776391 GTGTGTATGCACATGTGTGTGGG - Intergenic
1043500777 8:80852931-80852953 CTGTATTTTTACATCTATTTTGG + Intronic
1043633400 8:82364756-82364778 CTGTGTATACACAGCAACTTCGG - Intergenic
1044147936 8:88740891-88740913 TTTTGTATGCAAAGCTATTTAGG + Intergenic
1044371460 8:91416646-91416668 ATGTGAATGAACATCTATTGGGG + Intergenic
1045704523 8:104905932-104905954 ATGTGAATGCACATTTAATTTGG - Intronic
1047014340 8:120707261-120707283 TTGTGTGTGCACATATGTTTGGG - Intronic
1047123053 8:121927910-121927932 CTGTGTAGTCACATGTCTTTGGG - Intergenic
1048158255 8:131984151-131984173 CTGTATCGGCACATATATTTGGG + Exonic
1050232601 9:3543233-3543255 CTATGTATGCGGTTCTATTTTGG + Intergenic
1051495719 9:17720587-17720609 GTCTGTTTGCACATCTAGTTAGG + Intronic
1056019096 9:82423066-82423088 CTGAGTTTGCAAATCTATCTTGG + Intergenic
1057868007 9:98696577-98696599 CTTTGAAAGCACAGCTATTTTGG + Intronic
1058040801 9:100299438-100299460 CTGTTTCTCCACATGTATTTGGG + Intronic
1059017903 9:110541695-110541717 ATGTGTATGCAAAACTAGTTGGG - Intronic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1061835965 9:133330175-133330197 CTGTAGATGCACATACATTTAGG + Intergenic
1203662641 Un_KI270753v1:59710-59732 GTGTGTGTGCCCATCTATTTTGG - Intergenic
1203670751 Un_KI270755v1:9123-9145 GTGTGTGTGCCCATCTATTTTGG + Intergenic
1187400355 X:18954156-18954178 CTGTGTGTGCAGAACTGTTTGGG - Intronic
1193394132 X:80963894-80963916 CTTGGTCTACACATCTATTTTGG + Intergenic
1193958653 X:87895752-87895774 GTGTGTTTACAAATCTATTTAGG + Intergenic
1194353129 X:92846633-92846655 CTGTTTATCCACATCTTTTTTGG - Intergenic
1194697783 X:97076674-97076696 CTGTGGAAGCTCTTCTATTTTGG + Intronic
1195462945 X:105147740-105147762 CTGTTTATGGACATCTACATTGG + Intronic
1196424511 X:115556208-115556230 GTGTGTTTACACATCTGTTTAGG - Intergenic
1197666634 X:129231256-129231278 TTGTTTTTGCAAATCTATTTTGG - Intergenic
1198318354 X:135493220-135493242 CTGAATATGCAGATCAATTTGGG - Intergenic
1199370201 X:147038538-147038560 CTGTGTAAGCAAAGATATTTGGG - Intergenic
1199682611 X:150237556-150237578 ATGTGTATGTACGTATATTTGGG - Intergenic
1200661485 Y:5963722-5963744 CTGTTTATCCACATCTTTTTTGG - Intergenic