ID: 905008868

View in Genome Browser
Species Human (GRCh38)
Location 1:34733241-34733263
Sequence GAGGATAAACAACTTGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1595
Summary {0: 1, 1: 1, 2: 32, 3: 247, 4: 1314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905008868_905008871 3 Left 905008868 1:34733241-34733263 CCTTGAACAAGTTGTTTATCCTC 0: 1
1: 1
2: 32
3: 247
4: 1314
Right 905008871 1:34733267-34733289 GTGCCTTTGTCTGTGAAGCAGGG 0: 1
1: 0
2: 3
3: 15
4: 226
905008868_905008870 2 Left 905008868 1:34733241-34733263 CCTTGAACAAGTTGTTTATCCTC 0: 1
1: 1
2: 32
3: 247
4: 1314
Right 905008870 1:34733266-34733288 TGTGCCTTTGTCTGTGAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 329
905008868_905008873 28 Left 905008868 1:34733241-34733263 CCTTGAACAAGTTGTTTATCCTC 0: 1
1: 1
2: 32
3: 247
4: 1314
Right 905008873 1:34733292-34733314 AATGATAATACCTACTTCAATGG 0: 1
1: 4
2: 51
3: 348
4: 1437
905008868_905008874 29 Left 905008868 1:34733241-34733263 CCTTGAACAAGTTGTTTATCCTC 0: 1
1: 1
2: 32
3: 247
4: 1314
Right 905008874 1:34733293-34733315 ATGATAATACCTACTTCAATGGG 0: 1
1: 1
2: 10
3: 114
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905008868 Original CRISPR GAGGATAAACAACTTGTTCA AGG (reversed) Intronic
900009460 1:92611-92633 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900025570 1:269187-269209 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900035333 1:402960-402982 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900056954 1:638713-638735 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900350613 1:2232759-2232781 GAGGTTAAGCAACTCGTCCAAGG - Intronic
901582138 1:10253252-10253274 GAGGTTAAATAAGTTATTCATGG - Intronic
901705845 1:11072480-11072502 GAGAGTAAATAACTTGTCCAAGG + Intronic
901707000 1:11081552-11081574 GAGGTTAAGGAACTTGTCCAAGG - Intronic
901759381 1:11460768-11460790 GTGGTTAAGCAACTTGTTCAAGG + Intergenic
901791841 1:11657928-11657950 GAGGAAAAGCAACTGGTCCAAGG + Intronic
901882317 1:12201495-12201517 GAGGTTAAGTAACTTGTCCAAGG + Intronic
901882562 1:12202790-12202812 GAGGTTAAACAGCTTCTTCAAGG + Intronic
901896219 1:12314892-12314914 GGGGCTAAACAACTTGTCTAAGG - Intronic
901937585 1:12637130-12637152 GAGGAAAAACAAGGTGTTCTGGG - Intergenic
902187837 1:14738819-14738841 GAGGTTAAGCAACTTGCTGAAGG + Intronic
902203361 1:14850498-14850520 GAGGTTAAGCAACTTGCCCACGG + Intronic
902384582 1:16069091-16069113 GAGGATAAATCACTTATGCAAGG + Intronic
902449191 1:16485795-16485817 GAGGAGCCACAACTTGTTTAAGG - Intergenic
902468583 1:16632501-16632523 GAGGAGCCACAACTTGTTTAAGG - Intergenic
902556802 1:17251611-17251633 GAGGTTAAACAACTTGTCCAAGG + Intronic
902649648 1:17828352-17828374 GAGGTTAAATAACTTGCCCAAGG - Intergenic
902668479 1:17955530-17955552 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
902741446 1:18441337-18441359 GAGGTTAAACAACTGGCCCAGGG - Intergenic
902835203 1:19042958-19042980 GAGGTTAAATAACTTGCCCAAGG + Intergenic
902844311 1:19097629-19097651 AAGGTTACACAGCTTGTTCAAGG + Intronic
902936173 1:19766460-19766482 GAGGTTAAGCGACTTGATCAAGG + Intronic
903186119 1:21630118-21630140 GAGGTTAAGTAACTTGTCCAAGG + Intronic
903188735 1:21644410-21644432 GAGGTTAAGTAACCTGTTCAAGG - Intronic
903228595 1:21907887-21907909 GAGGAGAAATGACTTGCTCATGG - Intronic
903275802 1:22220854-22220876 GAGGCTGAGCCACTTGTTCAAGG + Intergenic
903469205 1:23573777-23573799 GAGGCTAAGCATGTTGTTCAAGG + Intergenic
903561734 1:24233183-24233205 GAGGCTAAAGGACTTGTCCAAGG - Intergenic
903605121 1:24569903-24569925 GAGGTTAAGTAACTTGTCCAAGG - Intronic
903814550 1:26055231-26055253 GAGGGTAAGCCACTTGTTCAAGG - Intronic
903865754 1:26396508-26396530 GAGATTAAACAATTTGCTCATGG - Intergenic
903893631 1:26587475-26587497 GAGGTTAAATAACTTACTCAAGG + Intergenic
903955229 1:27021008-27021030 GAGGCTAAGTAATTTGTTCAGGG + Intergenic
903992128 1:27280056-27280078 GAGGTTAAAGAACTTGCTCAAGG + Intronic
904373319 1:30064640-30064662 GAGGATAAGCGACTTGTCCAAGG - Intergenic
904497912 1:30897753-30897775 GAGGTTAAATAATTTGTGCAAGG - Intronic
904900105 1:33850367-33850389 GAGGTAAAGAAACTTGTTCATGG + Intronic
904917359 1:33979844-33979866 GAGGTTAAAGAACTTGCCCAAGG - Intronic
904960126 1:34326148-34326170 GAGGTTAAGTAACTTATTCAAGG + Intergenic
904990395 1:34588119-34588141 AAGGGTAAGTAACTTGTTCAAGG + Intergenic
905008868 1:34733241-34733263 GAGGATAAACAACTTGTTCAAGG - Intronic
905023568 1:34834853-34834875 GAGTTCAAACAACTTGCTCAAGG + Intronic
905233250 1:36528821-36528843 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
905234612 1:36537369-36537391 GAAGTTAAGCAACTTGCTCAAGG + Intergenic
905234913 1:36539545-36539567 GAAGTTAAGCAACTTGCTCAAGG + Intergenic
905312749 1:37061647-37061669 GAGGTTAAGTTACTTGTTCATGG - Intergenic
905314720 1:37074888-37074910 GAGGTTAAGCGACTTGTCCAGGG - Intergenic
905471507 1:38195688-38195710 GAAGCTAAACAACTTATTCAGGG - Intergenic
905486366 1:38299779-38299801 GGGTTTAAACAACTTGCTCAAGG + Intergenic
905514091 1:38548802-38548824 GAGGTTAAATAGCTTGCTCAAGG - Intergenic
905542751 1:38773293-38773315 GAAGTTTAGCAACTTGTTCAAGG - Intergenic
905709605 1:40090015-40090037 GAGGTTAAATACCTTGTCCAAGG + Intronic
905813885 1:40932811-40932833 GAGGTCAAGTAACTTGTTCAGGG - Intergenic
905835916 1:41120773-41120795 GAGGCTAAGAAACTTGTTCATGG + Intronic
905911336 1:41657004-41657026 GAGGAAATACAACTTGCACATGG + Intronic
906364202 1:45191671-45191693 GAGGTTAAGTAACTTGTCCAAGG + Intronic
906460405 1:46031842-46031864 GAAGTTAAGCAACTTGCTCAAGG - Intronic
906705394 1:47891064-47891086 GAGATTAAGCAACTTGTCCAAGG - Intronic
906707624 1:47906356-47906378 GAGGTTAAAGAACTTGCTAAAGG + Intronic
906730250 1:48074711-48074733 GAGGTTAAACAACTTGTCCATGG - Intergenic
906789383 1:48645317-48645339 GAGGCTAAGTAACTTGCTCAAGG - Intronic
906791669 1:48663863-48663885 GAGGTTATATAACTTGTTCAAGG + Intronic
906917670 1:50028786-50028808 GAAGATATACACCATGTTCATGG + Intergenic
906944323 1:50282924-50282946 AAGGTTAAATAACTTGTCCAAGG + Intergenic
907136763 1:52146492-52146514 GAGGGTAACAAACTTGTCCAAGG - Intronic
907188450 1:52629859-52629881 GAGGTTAAGTAACTTGCTCAGGG - Intergenic
907235118 1:53039308-53039330 AAAGTTAAATAACTTGTTCAAGG - Intronic
907377775 1:54058034-54058056 GAGGCTAAATAACTTGACCAAGG - Intronic
907435328 1:54442231-54442253 GAGGGGAAACATTTTGTTCAAGG - Intergenic
907485722 1:54776695-54776717 GAGGGAAAGTAACTTGTTCAAGG + Intergenic
907545903 1:55259786-55259808 GATGATAAGAAACTTGTTTAAGG + Intergenic
907725521 1:57016926-57016948 AAGGAAAAGCAACTTGCTCAGGG + Intronic
907796366 1:57721932-57721954 GAAGATACATAACTTGTCCAAGG + Intronic
907824027 1:57998240-57998262 GGTGTTAAATAACTTGTTCAAGG - Intronic
907841440 1:58161718-58161740 GAGGTTCACTAACTTGTTCAAGG + Intronic
907866454 1:58404094-58404116 TAGTATAAAGAACTTTTTCAGGG + Intronic
908031264 1:60002282-60002304 GAGGACAAGTAACTTGCTCAAGG - Intronic
908285644 1:62596259-62596281 GAGGTTAAGTAACTTGTCCAAGG + Intronic
908324724 1:63012597-63012619 GAGGTTACATAACTTGTCCAAGG - Intergenic
908408643 1:63841211-63841233 GAGGTTAAGTAACTTGCTCAAGG + Intronic
908411930 1:63875124-63875146 GAGGTTAAACAACTTGCCTAGGG - Intronic
908465741 1:64392218-64392240 GAGGTTAAATAACCTGTCCAAGG + Intergenic
908510168 1:64844867-64844889 GAGGATAAAGACCTGGTCCATGG - Exonic
908720844 1:67124092-67124114 GAGGTTAAACAATTTGCACAAGG - Intronic
908804567 1:67916786-67916808 GAGGTTAAACAACTTGCCCAAGG - Intergenic
908902635 1:68973715-68973737 GACGCTAAGCAATTTGTTCAAGG - Intergenic
908915851 1:69125600-69125622 GAGGTTGAATAACTTGTCCAAGG + Intergenic
908953809 1:69596262-69596284 GAGGTTAGATAACTTGATCAAGG + Intronic
909475012 1:76072869-76072891 GAGGTTAAGAAACTTGATCAAGG + Intergenic
909486955 1:76185101-76185123 GAGGAAAACCAACTTGCTCAAGG + Intronic
909562122 1:77018658-77018680 GAGGTTAAATTACTTTTTCAAGG - Intronic
909590917 1:77348174-77348196 GATGATTAAAAAATTGTTCATGG - Intronic
909654689 1:78018652-78018674 GAAGATAAACATCTTCTTTATGG - Intronic
909981898 1:82113076-82113098 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
909997058 1:82293358-82293380 GAGGATAAATGATTTATTCATGG - Intergenic
910041254 1:82854155-82854177 GAGATTAAACAACTTGCTCAAGG + Intergenic
910175435 1:84425374-84425396 GAGGTTAAGTAATTTGTTCAAGG - Intergenic
910529878 1:88223741-88223763 GAGGTTTAATGACTTGTTCAAGG - Intergenic
910937062 1:92493031-92493053 GAGGTTAAGGAACTTGTTTAAGG - Intergenic
911073585 1:93851449-93851471 GAGGTTAAGTAACTTGTGCAAGG + Intergenic
911114130 1:94226427-94226449 GAAGATAAATAACTTGCCCAGGG + Intronic
911329381 1:96509768-96509790 GAGATTAAATAACTTGTCCAAGG + Intergenic
911534933 1:99089123-99089145 GAGGATTAACATCTGGTTCCTGG - Intergenic
911693422 1:100861199-100861221 GAGGTTAAATAATTTGTTCAAGG - Intergenic
912122865 1:106494250-106494272 GAGGTTAAACAAGTTGTTCGAGG - Intergenic
912134434 1:106642746-106642768 CAGGTTAAACAACTTGCCCAAGG - Intergenic
912146477 1:106799984-106800006 GAGGTTATGTAACTTGTTCAAGG + Intergenic
912383344 1:109259376-109259398 AAGGTTAAGTAACTTGTTCAAGG - Intronic
912489837 1:110056378-110056400 AAGGATAAAGAACTTGCCCAAGG + Intronic
912505685 1:110154254-110154276 GAGGTTAAATAATTTGTTCAAGG + Intronic
912569908 1:110613747-110613769 GAGCTTAAGCATCTTGTTCAGGG + Intronic
912680160 1:111724018-111724040 GAAGTTAAGCAACTTGTCCAAGG - Exonic
912954799 1:114147707-114147729 CAGGTTAAATAACTTGCTCAAGG - Intronic
913017230 1:114751465-114751487 GAGATTAAATAACTTGTTCATGG - Intronic
913050332 1:115112104-115112126 GAGGTTAAGCGACTTATTCAAGG + Intergenic
913271519 1:117098404-117098426 GAGGTTAAATAACTTGCCCAAGG + Intronic
913435527 1:118843416-118843438 GAGGCTAAGTAACTTGTCCAAGG - Intergenic
913494624 1:119417114-119417136 GAGGTTAATCAACTTGTCGAAGG + Intronic
913497363 1:119440705-119440727 GAGGTTAATTAACTTGTTCAAGG + Intergenic
913508415 1:119540484-119540506 GAGGTTAATCAACTTGTCCAAGG + Intergenic
913559917 1:120007260-120007282 GAAGATAAGTAACTTGTCCAAGG - Intronic
913677445 1:121154644-121154666 GAGGCTGAATAACTTGTACAAGG + Intergenic
913678226 1:121162988-121163010 GAGGTTAAAGAACTTGTTCGTGG - Intergenic
913708018 1:121447772-121447794 GAGGTTAAATAATTTGTGCAAGG + Intergenic
914030066 1:143950628-143950650 GAGGTTAAAGAACTTGTTCGTGG - Intronic
914159383 1:145117323-145117345 GAGGTTAAAGAACTTGTTCGTGG + Intergenic
914160170 1:145125677-145125699 GAGGCTGAATAACTTGTACAAGG - Intergenic
914280502 1:146166679-146166701 GAAGATAAGTAACTTGTCCAAGG - Intronic
914457189 1:147847105-147847127 GAGATTAAACAGCTTGTTCCTGG - Intergenic
914541545 1:148617619-148617641 GAAGATAAGTAACTTGTCCAAGG - Intronic
914625094 1:149453628-149453650 GAAGATAAGTAACTTGTCCAAGG + Intergenic
914955966 1:152162777-152162799 AAGGATAAATAACTTGCTCAAGG + Intergenic
915042049 1:152976759-152976781 GAGGTTAAGGAACTTGTTCTAGG - Intergenic
915231155 1:154446248-154446270 GAGGGAAAGCGACTTGTTCAAGG - Intronic
915315868 1:155028906-155028928 GAGGTTAAGCAACTTGCTGAAGG + Intronic
915472936 1:156136616-156136638 GAGGTTAAATAACCTGCTCAAGG - Intronic
915894998 1:159805030-159805052 GAACTTAGACAACTTGTTCAAGG + Intronic
916490602 1:165299046-165299068 GAGGCTAAATAACTTGTCCAAGG + Intronic
916813834 1:168331224-168331246 GAGGTTAAGAAACTTGTTTAAGG + Intergenic
916834653 1:168531465-168531487 GAGGAGAAGCAACTTTTCCAGGG + Intergenic
916857207 1:168762187-168762209 GAAGTTAAGCAACTTGTCCAAGG - Intergenic
916933340 1:169602478-169602500 GAGGTTAAATAACTCGTCCAGGG - Intronic
917143028 1:171856736-171856758 GCTGATAAACAACTTCATCAAGG - Intronic
917164890 1:172100770-172100792 AAGGAAAAAAAACTAGTTCATGG - Intronic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917546040 1:175968819-175968841 AAGGATAATCAAGTTGTTTAGGG - Intronic
917759306 1:178138533-178138555 GAGGTTATACAGCTCGTTCAAGG - Intronic
917818950 1:178741304-178741326 GAGGCTAACCAACTTGCCCAAGG + Intronic
917952526 1:180055025-180055047 GAAGTTAAGTAACTTGTTCAAGG - Intronic
917987971 1:180340488-180340510 GAGTATAAAGAACTCTTTCATGG + Intronic
918553252 1:185768876-185768898 GAGGTTAAATATTTTGTTCAAGG - Intronic
918645291 1:186897112-186897134 AAGGGTAAACAAATTCTTCAAGG + Intronic
918806539 1:189054028-189054050 GTAGATTAACAAGTTGTTCAAGG + Intergenic
919101041 1:193098145-193098167 GAAGATCAACAATTTGTTCATGG + Intronic
919131614 1:193458041-193458063 GAGGCTATACACCTGGTTCAGGG - Intergenic
919415815 1:197307872-197307894 GAGTTTAAGTAACTTGTTCAAGG - Intronic
919668445 1:200316183-200316205 GAATATAAACTACTTGATCAAGG + Intergenic
919688704 1:200508838-200508860 GAGGTTAAGCAACGTGTTCAAGG - Intergenic
919710197 1:200719058-200719080 TAGGATAATCAACTTGTTGAAGG - Intergenic
919878509 1:201887814-201887836 GAGGTTAAAGAACTTGTTCAAGG - Intergenic
919982247 1:202649543-202649565 GAGGTAAAATAACTTGTCCAAGG + Intronic
920259950 1:204682515-204682537 GAGGAGAAACCACTTGCTCCGGG - Intronic
920289078 1:204904035-204904057 GATGTTAAATAACTTGTCCAAGG - Intronic
920339797 1:205268683-205268705 AAGGTCAAACAAGTTGTTCAGGG - Intronic
920464748 1:206173158-206173180 GAGGCTGAATAACTTGTACAAGG + Intergenic
920465533 1:206181512-206181534 GAGGTTAAAGAACTTGTTCGTGG - Intergenic
920573225 1:207033889-207033911 GAGGTTAAAAATCTTTTTCAAGG + Intronic
920582745 1:207127502-207127524 GAGGTTAAAAGACTTGCTCAAGG + Intronic
920628702 1:207629850-207629872 GAGGATAAGTATCTTGCTCAGGG - Intronic
920702701 1:208229987-208230009 AAGGTTAAATAACATGTTCAAGG - Intronic
920870239 1:209788103-209788125 GAGGTTAAAGGACTTGTTCAAGG + Exonic
920958736 1:210645129-210645151 GAGGTTACACAACTTGTTCAAGG + Intronic
921027248 1:211297367-211297389 GAGGTTAACCAACTTGTTCAAGG + Intronic
921058705 1:211564400-211564422 GAGGAAAACCAACTTGCCCATGG + Intergenic
921123931 1:212160291-212160313 GAGGATAAATAGCTTGCCCAAGG + Intergenic
921189639 1:212698886-212698908 GAGGTTAAACAAATTGCTCAAGG + Intronic
921506793 1:215981558-215981580 GAGGCTTAACAGCTAGTTCAGGG + Intronic
921548137 1:216498496-216498518 GAAGTTAAATAACTTGCTCAAGG - Intergenic
921587014 1:216959215-216959237 GAGCATTAAAAACTTGTTCTAGG - Intronic
921807875 1:219476723-219476745 GAGGCTGAACAACTTGCCCAAGG + Intergenic
922246583 1:223804768-223804790 GAGGTTATGCAATTTGTTCAGGG - Intronic
922257865 1:223908520-223908542 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
922574182 1:226651349-226651371 AAGGACTAAGAACTTGTTCAAGG - Intronic
922984168 1:229852960-229852982 GAGGGTAAAAGACTTGTTCAAGG + Intergenic
923459230 1:234194228-234194250 GTGGATAAACACATTGTTTATGG + Intronic
923538818 1:234873565-234873587 GAGGTTAAACGACTTGTCCAAGG - Intergenic
923554363 1:234989276-234989298 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
923703126 1:236318796-236318818 GAGGATAAAACAGATGTTCAGGG - Intergenic
923784442 1:237054071-237054093 GAGGTGAAATGACTTGTTCAAGG + Intronic
923928460 1:238663663-238663685 GAAGTTAAAGAATTTGTTCAAGG - Intergenic
924111589 1:240704868-240704890 GGGGATAAAGAACTTTCTCAAGG - Intergenic
924697210 1:246413004-246413026 GAGGTTAAACAGTTTGCTCAAGG + Intronic
924944010 1:248832908-248832930 GAGATTAAATAACTTGTCCAAGG + Intergenic
1063235311 10:4108619-4108641 GAGTTTAAGCAATTTGTTCAAGG - Intergenic
1063724965 10:8626814-8626836 GAGGTTAAATAACTTTTTCAAGG - Intergenic
1064327128 10:14361924-14361946 GAAGTTAAACAACATGTCCAGGG + Intronic
1064512204 10:16107744-16107766 GTGGCTAAGCAACTTGTCCAAGG - Intergenic
1065075311 10:22072791-22072813 GAAGATAAACAACCTGGGCAAGG + Intergenic
1065139568 10:22707274-22707296 GAGGCAAAATAACTTGTTCAAGG + Intronic
1065202026 10:23322104-23322126 AAGGCTAATTAACTTGTTCAAGG - Intronic
1065249610 10:23797377-23797399 GAGAATAAACAACTTGCTCAAGG + Intronic
1065353819 10:24819856-24819878 GAGGTTAAACCACTTGTCCATGG + Intergenic
1065432854 10:25676865-25676887 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1065798514 10:29329515-29329537 GAGGAGACACAACGTCTTCAGGG - Intergenic
1065984370 10:30935193-30935215 GGTGTTAAATAACTTGTTCAAGG + Intronic
1066958991 10:42202609-42202631 GCAGATATACAACTGGTTCATGG + Intergenic
1067320868 10:45219618-45219640 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1067546511 10:47196138-47196160 GAGGTTAAGCAACTTGCTCAAGG + Intergenic
1067930230 10:50553308-50553330 GAGGCTAAACACCTTGACCAAGG - Intronic
1067991531 10:51218957-51218979 GAGGTTAAATAACTTGCCCAAGG - Intronic
1068528781 10:58161815-58161837 GAGGGTAAATGACTTGCTCAAGG + Intergenic
1068874414 10:61981070-61981092 GAGATTAAGCAACCTGTTCAAGG - Intronic
1069127246 10:64651561-64651583 GAGGTTACAAAACTTGTCCAAGG - Intergenic
1069242864 10:66163779-66163801 GAGGCTAAATAACTTGAACATGG - Intronic
1069250382 10:66259219-66259241 GATCATGAAAAACTTGTTCATGG - Intronic
1069580420 10:69562392-69562414 GAGGTTCAGCAACATGTTCAAGG - Intergenic
1069628994 10:69886343-69886365 GAGGTTAGACAACTTGCTGAGGG + Intronic
1069814521 10:71185243-71185265 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1069830161 10:71278074-71278096 GAGGTTAAGCAACTTGTCCAAGG - Intronic
1069854980 10:71435173-71435195 GAGGCTAAACAACTTGCTCAAGG - Intronic
1069899457 10:71698914-71698936 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1069914426 10:71778610-71778632 GAGGTTAAGCAACTTGCTCAGGG - Intronic
1069944294 10:71975290-71975312 GAGGTTAGGCAACTTGTCCAAGG + Intronic
1070115506 10:73524789-73524811 GAGGATAAATAATTTGCCCAAGG + Intronic
1070392423 10:75982972-75982994 GAGGGTAAATATCTTGCTCAAGG + Intronic
1070530826 10:77335789-77335811 GAGGTTAAGCAACTTTTCCAGGG + Intronic
1070718910 10:78743092-78743114 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1070764304 10:79047757-79047779 GAGGCTAAGTAACTTGTTCAAGG + Intergenic
1070909966 10:80109400-80109422 GAGGTGAAATAATTTGTTCAAGG - Intergenic
1071057376 10:81527536-81527558 TTGGAGAAACAACTTTTTCAAGG - Intergenic
1071167927 10:82828431-82828453 GAGGTTAAACGACTTGTCCCAGG + Intronic
1071388344 10:85144396-85144418 AAAGAGAAAGAACTTGTTCAGGG - Intergenic
1071462640 10:85913351-85913373 GAGGTTAAATCACTTGTTCAAGG - Intronic
1071574836 10:86717492-86717514 GAGTTTGAACAACTTGTTTAAGG - Intronic
1071711370 10:88053159-88053181 GAGATTAAACAACTTTTGCAGGG - Intergenic
1071711594 10:88055142-88055164 GAGGTTAAGCAATTTGTTCAAGG + Intergenic
1071777318 10:88803810-88803832 GAGGTTAAACAAGTTGAACAAGG + Intronic
1072097647 10:92198143-92198165 GAGAATAAATAACTGGCTCAAGG + Intronic
1072618972 10:97067516-97067538 GAAGCTAAGCAACTTCTTCAAGG + Intronic
1072720684 10:97779064-97779086 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1072767011 10:98103347-98103369 GAGGTTAAAAGACTTGTTCAAGG - Intergenic
1073028233 10:100504140-100504162 GAGGTTAAATGAATTGTTCAAGG + Intronic
1073066854 10:100766079-100766101 GAAGTTAAATAACTTGCTCAAGG + Intronic
1073246033 10:102090854-102090876 GAGGTTAAATAACTTGCTCAGGG + Intergenic
1073560489 10:104492265-104492287 GAAGTTAAATAACTTGTTCAAGG + Intergenic
1073811442 10:107156327-107156349 AAGCTTAAACAACTTGCTCAAGG - Intronic
1074213327 10:111359271-111359293 AAGGATAAGTAACTTGTTCAAGG + Intergenic
1074520838 10:114222332-114222354 GTGGATCAACTACTTGATCAAGG - Intronic
1074816487 10:117145371-117145393 AAGGCTAAGCAACTTGTCCATGG + Intergenic
1074840909 10:117350163-117350185 GAGGTTAAGTAACTTGCTCAGGG + Intronic
1074863360 10:117530191-117530213 GAGGAAAAAAAGCTTCTTCATGG + Intergenic
1074876204 10:117615334-117615356 GAAGTTAAACAACTTGCCCAGGG - Intergenic
1075275926 10:121092384-121092406 GAGGTTATATAACTTGCTCAAGG + Intergenic
1075387125 10:122062959-122062981 GAGGTTAAGGAACTTGTTCTAGG + Intronic
1075668686 10:124248378-124248400 GAGGCTGAGCAGCTTGTTCAAGG + Intergenic
1076677046 10:132152520-132152542 GAGGAGAGACCACATGTTCATGG - Intronic
1077497493 11:2893208-2893230 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1077633848 11:3828474-3828496 GAGGTTAAGCAATTTTTTCAGGG - Intronic
1077975964 11:7249494-7249516 GTGGTTAAACAATTTGTTCAAGG - Intronic
1078409099 11:11096867-11096889 GTGGTTAAACAACTTGCCCAAGG - Intergenic
1078594042 11:12671665-12671687 GAGGCTATATAACTTGTCCATGG - Intergenic
1078671263 11:13367790-13367812 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1078688040 11:13551032-13551054 GAGGCTAAGAAAGTTGTTCAAGG - Intergenic
1078912048 11:15741769-15741791 GAGGAGAAAGAATTTCTTCAGGG + Intergenic
1078952907 11:16155313-16155335 GAGGTTAAATAATTTGTCCAAGG - Intronic
1078952923 11:16155518-16155540 GAGGTTAAACAACTTGCCCAAGG - Intronic
1078985643 11:16593797-16593819 GAGGATAAATAAATTGTAAATGG + Intronic
1079094162 11:17500348-17500370 GAGGTTAAAGTATTTGTTCAAGG - Intronic
1079257635 11:18846307-18846329 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1079327260 11:19504943-19504965 GAGGTTAAATGACTTGTCCATGG + Intronic
1079381536 11:19942483-19942505 GAGGATAAGTGACTTGTCCAGGG + Intronic
1079391264 11:20023980-20024002 GAGGTTAAATAACTTGATTAAGG + Intronic
1079485545 11:20932688-20932710 GAGGAGAAGTAACTTGTCCAAGG + Intronic
1079497432 11:21061519-21061541 GAGGTTAAATACCTTGTCCAAGG - Intronic
1080103728 11:28489714-28489736 GAGGTGAAATAACATGTTCAAGG - Intergenic
1080148501 11:29019952-29019974 GAAGTTAAGTAACTTGTTCAAGG + Intergenic
1080197410 11:29628699-29628721 GAGGCTAAAAAACTAGTTAATGG + Intergenic
1080217523 11:29862189-29862211 GAGGTCAAATAACTTGCTCAAGG + Intergenic
1080335443 11:31190296-31190318 GCAGATAAATAATTTGTTCAAGG + Intronic
1080495488 11:32814002-32814024 GAAGAGAAATAACATGTTCAAGG - Intergenic
1080495872 11:32818336-32818358 GATGTTAAACAACTTGCTCAAGG - Intergenic
1080544846 11:33306603-33306625 AAGGTCAAACAACTTGCTCAGGG - Intronic
1080558177 11:33436675-33436697 ATGGTTTAACAACTTGTTCAAGG + Intergenic
1080607794 11:33878037-33878059 GAGGTTAAGCAACTTGTGGATGG - Intronic
1080686135 11:34516439-34516461 GAGGTTAAGTAACTTGTTCACGG + Intergenic
1080823475 11:35828521-35828543 GAGGTTAAAATACTTGTTAAAGG - Intergenic
1080892402 11:36420422-36420444 GAGGTAAAGCAACTTGCTCAAGG - Intronic
1081192215 11:40117783-40117805 AAGGATAAGTAACTTGCTCAAGG - Intronic
1081250652 11:40828700-40828722 GAGGGTAAACAGCTTGATCTAGG - Intronic
1081659803 11:44881101-44881123 GAGGTTAAGTTACTTGTTCAAGG - Intronic
1081744141 11:45461301-45461323 GGGGTTAAATAACTTGCTCAAGG + Intergenic
1081755843 11:45543897-45543919 GAGGACAAGTGACTTGTTCAAGG - Intergenic
1081847423 11:46251066-46251088 GAGGTAAAATCACTTGTTCAAGG + Intergenic
1081889000 11:46524576-46524598 GAGGATAATGAACTTGCCCAAGG - Intronic
1082230339 11:49757725-49757747 GAGATTAAACAACTTACTCAAGG - Intergenic
1082801869 11:57420806-57420828 GAGGTTAAAAAGCTTGTTGAAGG - Intronic
1082873103 11:57961765-57961787 GAGGTTAAATAACTTGCTCAGGG - Intergenic
1083328165 11:61884162-61884184 GAGGTTAAGCTACTTCTTCAAGG + Intronic
1083627695 11:64079981-64080003 GAGGGAAAGCAACTTGTTCAAGG - Intronic
1083735865 11:64680561-64680583 AAGGTTAAAGAACTTGCTCAAGG - Intronic
1083931573 11:65849205-65849227 GAGGAGAAGTAACTTGTCCAAGG - Intronic
1083941465 11:65898534-65898556 GAGGTTAAATAACTTGCCCATGG - Intronic
1084077725 11:66794449-66794471 AAGGTTAAACAGCTTGTCCAAGG - Intronic
1084345303 11:68543178-68543200 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1084531581 11:69730844-69730866 GAGGTTAAGCCACTTGTCCAAGG + Intergenic
1084598326 11:70130463-70130485 GAGGGGAAGTAACTTGTTCAGGG - Intronic
1084601488 11:70148417-70148439 GAGGCTAAATAACTTGCCCAAGG + Intronic
1085076051 11:73593435-73593457 GAGGTTAAATGACTTGTTTAAGG - Intronic
1085128699 11:74019359-74019381 GAAGATAAGCAACTTGGCCACGG - Intronic
1085187303 11:74586825-74586847 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085198333 11:74685520-74685542 GAGGTTAAGGAACTTTTTCAAGG - Intergenic
1085308732 11:75503443-75503465 GAGGCTAAGCAACTTGTTCAAGG + Intronic
1085498253 11:76992813-76992835 GAGGTTAACTAACTTGTCCAGGG - Intronic
1085587720 11:77726871-77726893 GAGGATATACAACTTGTCCAGGG - Intronic
1085740395 11:79073682-79073704 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085803761 11:79615709-79615731 GAGGTTTAAGAACTTGCTCAGGG - Intergenic
1085836305 11:79960709-79960731 GAGAATAAACACCTTGCCCAGGG - Intergenic
1085943273 11:81232434-81232456 GATGTTAAACAACATGCTCAAGG + Intergenic
1086087095 11:82966508-82966530 GAGGCAAAATAACTTGTTCAAGG + Intronic
1086176114 11:83893084-83893106 GAAGTAAAACAACTTGTTAATGG - Intronic
1086189163 11:84057833-84057855 GAGGTTAAGCAATTTGCTCAAGG + Intronic
1086288641 11:85278869-85278891 GAAGATAAGCAACTTGTCCAGGG - Intronic
1086299114 11:85405668-85405690 GAGGTTAAATATTTTGTTCAAGG + Intronic
1086370707 11:86152784-86152806 GAGGCTAAGTAACTTGTCCAAGG - Intergenic
1086376874 11:86209999-86210021 GAGAATGAGTAACTTGTTCAAGG - Intergenic
1086619712 11:88871237-88871259 GAGATTAAACAACTTACTCAAGG + Intronic
1086719763 11:90105524-90105546 GCAGATATACAACTAGTTCATGG - Intergenic
1087070884 11:94079247-94079269 GAGGATAAATCACTTGCTCCAGG + Intronic
1087748297 11:101975526-101975548 GAGGATAAGTAACTTGCCCAAGG - Intronic
1087925822 11:103917682-103917704 GAGGATAAGTACCTTGTCCAGGG + Intronic
1088053109 11:105542650-105542672 GAAGTTAAACAGCCTGTTCATGG - Intergenic
1088192760 11:107243903-107243925 GGGGATAAATAACTTGCCCAAGG + Intergenic
1088354036 11:108922834-108922856 GAGGATAAATAAACTATTCATGG - Intronic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1088534887 11:110849958-110849980 AAGGATAAATGACTTGTCCAAGG + Intergenic
1088702005 11:112421830-112421852 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1088822449 11:113468196-113468218 GAGGTTAATTAACTTGCTCATGG + Intronic
1088902949 11:114132526-114132548 GAGGGTAAGCAACTTGTCTAAGG - Intronic
1088922291 11:114269082-114269104 GAGACTAAATAACTTGTCCATGG + Intronic
1089409782 11:118231053-118231075 GGGCATAAACAACTCTTTCAAGG - Intronic
1090203469 11:124872122-124872144 CAGGTTAAACAGCTTGTTCAGGG + Intronic
1090298962 11:125617338-125617360 GAGGTTAAATAACTTGCCCAAGG + Intronic
1090411863 11:126514704-126514726 GTGGTTAAATAACTTGCTCACGG + Intronic
1090453139 11:126824065-126824087 AAGGGAAAACAATTTGTTCAGGG - Intronic
1090588022 11:128235201-128235223 GAGGTGAAATAACTTGTTCTAGG - Intergenic
1090642892 11:128744525-128744547 GAGATTAAAGAACTTGTCCAAGG + Intronic
1090848390 11:130549043-130549065 GAAGTGAAACAACTTGTTCAAGG + Intergenic
1090901283 11:131033914-131033936 TAGGATAAGAAACTTGTTCAAGG + Intergenic
1091388926 12:113360-113382 GAAGATAAGCAACTTGTTGAAGG + Intronic
1091433549 12:456180-456202 GATGTTAAATAACTTGCTCAAGG - Intergenic
1091612259 12:2021242-2021264 GAGCTTAAATAACTTGCTCAGGG + Intronic
1091639667 12:2226363-2226385 GAGGTTAAATAACTTGGCCAAGG + Intronic
1091747403 12:3001123-3001145 GAGGTTAAATAACTTGCCCAAGG - Intronic
1091946356 12:4547845-4547867 TAGGATAAGCAACTTGCCCATGG + Intronic
1092199263 12:6569836-6569858 AAAGTTAAACAACTTGCTCAAGG + Intergenic
1092412459 12:8264337-8264359 GAGGGTAAGTAACTTGGTCAAGG + Intergenic
1092593786 12:9976901-9976923 GAGAAGAAAGAACTTGTGCAGGG - Intronic
1092763721 12:11833377-11833399 GAGGTTAAGTAACTTGTACAAGG + Intronic
1092779055 12:11968509-11968531 AAGGTTAAGCACCTTGTTCAAGG + Intergenic
1092844327 12:12569981-12570003 GAGGTTAAACGACTTGCCCAAGG + Intergenic
1092972333 12:13708717-13708739 GAGGTTAATCAACTTATCCAAGG + Intronic
1092993080 12:13921958-13921980 GAGGCAAAATAACTTGGTCAAGG - Intronic
1093051331 12:14508240-14508262 GGGGATAAGCAATTTGTTCAAGG - Intronic
1093324000 12:17750330-17750352 GAGGTTAAATAACTTGTCAAAGG + Intergenic
1093423979 12:19007121-19007143 GAGTTTAAATAACTTGTTCAAGG - Intergenic
1093630714 12:21405873-21405895 GAGGTTAATTAACTTGTCCAAGG - Intronic
1093745857 12:22740338-22740360 CAGGATAAGTAACTTGTTCGAGG - Intergenic
1093799338 12:23353137-23353159 GAAGTTAATCAACTGGTTCAAGG - Intergenic
1094004184 12:25729891-25729913 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1094179324 12:27574782-27574804 GGGGTTAAATAACTTGTCCAAGG - Intronic
1094489663 12:30951684-30951706 GAGGTTAAATAACTTGCCCAAGG + Intronic
1094749545 12:33389949-33389971 GAGGTTAAGTAGCTTGTTCAAGG - Intronic
1095454593 12:42369651-42369673 GAGATTAAATAACTTGGTCAAGG + Intronic
1095539490 12:43292200-43292222 GAGCATTAACAACTTGTCGAAGG + Intergenic
1095598252 12:43983781-43983803 GAAGGTAAATAACTTGTCCAAGG + Intronic
1095833236 12:46609827-46609849 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1096073098 12:48786856-48786878 GAGGTTAAATAACTTGCCCAAGG - Intronic
1096189259 12:49604610-49604632 GAGGCTAAGCGACTTGTCCAAGG - Intronic
1096571238 12:52524510-52524532 GAGGTTAGGCAACTTGCTCAGGG - Intergenic
1097287779 12:57890839-57890861 GAGATTAAATAACTTGTTCAAGG + Intergenic
1097289043 12:57898408-57898430 CAGAATAAACAACTTGGCCAAGG - Intergenic
1097319729 12:58211704-58211726 GTGGATAACCAACTTGTCCAAGG + Intergenic
1097329223 12:58315060-58315082 GAGGTTAAGCAACTTACTCAAGG + Intergenic
1097404277 12:59170249-59170271 GAGGTTAAGCAACTTGACCAAGG - Intergenic
1097509570 12:60520676-60520698 AAGGATAAGCAACTTGACCAAGG - Intergenic
1097941059 12:65306053-65306075 GAGGGTAAGCAAGTTGTCCAAGG + Intronic
1097979209 12:65719835-65719857 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1098131654 12:67357599-67357621 GAGGTTAAGCAATTTGCTCACGG - Intergenic
1098179522 12:67831363-67831385 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1098357149 12:69622603-69622625 GAAGTTAAACTACTTGCTCAAGG - Intergenic
1098472125 12:70857457-70857479 GAGGATAGACTACTCTTTCAAGG + Intronic
1098580106 12:72089501-72089523 GAGCATAAATGATTTGTTCAAGG - Intronic
1098597211 12:72287994-72288016 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1098602635 12:72350478-72350500 TAGGTTAAACAGCTTGTCCAAGG + Intronic
1098625788 12:72665350-72665372 GTAGATAAACCAGTTGTTCAAGG - Exonic
1098840900 12:75476713-75476735 GAGGATAAATAACTGGACCAGGG - Intergenic
1098868974 12:75795220-75795242 GATGTTAAATAACTTGCTCAAGG - Intergenic
1099249281 12:80233148-80233170 GGGTACAAACAACTTGGTCAGGG - Intronic
1099419903 12:82444002-82444024 GAGGATAGAGAGCTTATTCAAGG + Intronic
1099482579 12:83187692-83187714 GAAGATGAACAAGTTCTTCATGG + Intergenic
1099915710 12:88890518-88890540 GAAGAAAAAAAACTGGTTCAAGG + Intergenic
1100358176 12:93851408-93851430 GAGGGTAAGTAACTTGTCCAAGG - Intronic
1100533401 12:95481714-95481736 GAGGCTAAATAACTTGCCCAAGG + Intronic
1100665798 12:96751753-96751775 GAAGTTAAATGACTTGTTCAAGG - Intronic
1100679659 12:96905809-96905831 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1100739181 12:97572184-97572206 GAGGTTAAATAACTTCTCCAAGG - Intergenic
1100860213 12:98797359-98797381 GAGGTTGAATAACTTGCTCAAGG - Intronic
1100891207 12:99128027-99128049 GAAGTTAAACAACTTGCCCAAGG - Intronic
1100970305 12:100063031-100063053 GAAGAAAAATTACTTGTTCAGGG + Intronic
1101019172 12:100534697-100534719 GAGGTTAAACTACTTGTTCAAGG + Intronic
1101091270 12:101288379-101288401 AAGCATAAGCAACTTGCTCAAGG - Intronic
1101289722 12:103355609-103355631 GAGGTTAAACAGTTTGTACAAGG + Intronic
1101364431 12:104058602-104058624 GAGGATAAATAATTTGACCAAGG + Intronic
1101515217 12:105428685-105428707 GAGGCTAACTAACTTGTCCAAGG - Intergenic
1101631187 12:106496503-106496525 AAGGATAAGCAACTTGTCCAAGG - Intronic
1101811407 12:108111218-108111240 GATGTTAAATAACTTGTCCAAGG - Intergenic
1101819395 12:108172188-108172210 GAGGTTAGGTAACTTGTTCAAGG + Intronic
1101864779 12:108512644-108512666 GAGGATAAGTGACTTGTTCAAGG + Intergenic
1101991336 12:109487814-109487836 GAGGGGAAGCAGCTTGTTCAAGG - Intronic
1101993628 12:109508303-109508325 GAGGTTAAGAAACTTGCTCAGGG - Intronic
1102624750 12:114226069-114226091 AAGGTTAAGTAACTTGTTCAAGG - Intergenic
1102708164 12:114900788-114900810 AAGGCTAAACAACTTGCCCAAGG - Intergenic
1102776068 12:115520133-115520155 GAGGTTAATCAACTTGTCCAAGG - Intergenic
1102796405 12:115692455-115692477 GAGGGTAAATGACTTGTTAAGGG - Intergenic
1102837145 12:116075253-116075275 GGGGATAAATAACTTGACCAAGG - Intronic
1103125735 12:118420849-118420871 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1103152570 12:118653945-118653967 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1103190401 12:118996719-118996741 GAGTCTAAGCAACTTGGTCAAGG + Intronic
1103224887 12:119278308-119278330 GAGGTTGAACAACTTGCTCAAGG - Intergenic
1103225190 12:119281345-119281367 GAGGTTAAGCAACTTGTCTAAGG - Intergenic
1103238421 12:119394218-119394240 GAAGATAAAGGACTTGTCCAAGG + Intronic
1103363083 12:120365283-120365305 GAGGGGAAATAACTTGTCCATGG - Intronic
1103372127 12:120427502-120427524 GAGGATAAGCAATTAGTTAATGG - Intergenic
1103605762 12:122084982-122085004 GAGGTTACACAACTTGTCCACGG + Intronic
1104082327 12:125441054-125441076 GATTTTAAATAACTTGTTCAAGG - Intronic
1104680391 12:130747172-130747194 GAGGTGAAACAACTTTTCCAAGG - Intergenic
1105865124 13:24452186-24452208 GAGGTTAAGGAACTTGCTCAAGG + Intronic
1106141851 13:27018461-27018483 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1106224201 13:27772937-27772959 GAAGATAAACGACTTGCTCAAGG + Intergenic
1106496098 13:30277379-30277401 GAGGTTAAATAGCTTGCTCAAGG + Intronic
1106719312 13:32422389-32422411 GAAGCTAAACATCTTGATCAGGG - Intronic
1106742655 13:32662720-32662742 GAGAATAAACAAATTATACAAGG + Intronic
1106752538 13:32790017-32790039 GAGGTTATACAACTTGCTCAAGG - Intergenic
1107039709 13:35935809-35935831 GATGATAAATAATTTGTTCAAGG - Intronic
1107242914 13:38259233-38259255 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1107370966 13:39747081-39747103 GAGGTTAAATTACTTGTTCAAGG + Intronic
1107552734 13:41492491-41492513 GAGGTTAAAGAGCTTGCTCAAGG - Intergenic
1107578250 13:41750972-41750994 GAGGTTAAACAATTTGGCCAAGG - Intronic
1107591833 13:41916061-41916083 GAGGTTAAATAACTTGATTAAGG - Intronic
1107600287 13:42005921-42005943 AAGGATAGAAAACTTGTTTATGG - Intergenic
1107698986 13:43028256-43028278 GAGGAGAATCAGCATGTTCAGGG - Intronic
1108044278 13:46368278-46368300 AAGCATAATCAACTTTTTCATGG + Intronic
1108110543 13:47066873-47066895 GAGGCTAAAAAACTTGTTCAAGG + Intergenic
1108375135 13:49807245-49807267 GAGGTTAAACAATTTGCCCAGGG + Intergenic
1108430161 13:50345376-50345398 GAGGCTAAGTAACTTTTTCAAGG - Intronic
1108548341 13:51518860-51518882 GAGGATAAATGACTTGCCCACGG + Intergenic
1108706000 13:52987957-52987979 GTGGATAGACACCATGTTCATGG - Intergenic
1108801748 13:54105091-54105113 GAGGATAAATAAATTATCCAAGG + Intergenic
1109785292 13:67166415-67166437 GAGGTTAAGTGACTTGTTCAAGG - Intronic
1110255848 13:73433142-73433164 GTGGTGAAACAACTTGCTCAAGG - Intergenic
1110307607 13:74007863-74007885 GAGAACAAACAACTGGTACATGG + Intronic
1110373455 13:74765675-74765697 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1112310845 13:98316427-98316449 GAGGTTAAAGAACTTGTTCCAGG + Intronic
1112362985 13:98733754-98733776 GAGGGTAAGCACCTTGATCAAGG - Intronic
1112632161 13:101173448-101173470 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1113092313 13:106628637-106628659 GAGATTAAACAACTTGTAGAAGG - Intergenic
1113374057 13:109747538-109747560 AAGGTTAAACACCTTGCTCAGGG - Intergenic
1114368332 14:22054960-22054982 GAAATTAAACAACTTGCTCATGG + Intergenic
1114391299 14:22311318-22311340 GAGGATAAACAAATTGCTCCAGG - Intergenic
1114412847 14:22517045-22517067 GAGATTAAGTAACTTGTTCAAGG - Intergenic
1114455351 14:22850103-22850125 AAAGATAAATAACTTGGTCAAGG + Intergenic
1114710885 14:24777120-24777142 GAGGTTAAATAACTTATTGAAGG - Intergenic
1114740984 14:25096774-25096796 GAAATTAAACAACTTGCTCAAGG - Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1115284138 14:31699490-31699512 GAGGTTAAATAACTTGGGCAGGG + Intronic
1115778825 14:36746800-36746822 TAGGATAAACACCTTTTTCTAGG + Intronic
1115783877 14:36802541-36802563 GAGGTTAAATAATTTGTCCAAGG + Intronic
1116511058 14:45747304-45747326 GAGGTTAAATAACATGTCCAAGG + Intergenic
1116777721 14:49201024-49201046 CTGGCTAAACAACTTGTCCAAGG - Intergenic
1116799001 14:49423213-49423235 GAGAATAAATAACTTACTCAAGG - Intergenic
1117150637 14:52884253-52884275 AAGGTTAAATAACTTGTCCAAGG + Intronic
1117191146 14:53293133-53293155 GAGGCTAAAAAGCCTGTTCAAGG - Intergenic
1117581410 14:57155243-57155265 GAGGACAAATAACTTAGTCAAGG - Intergenic
1117628545 14:57665474-57665496 GATGATAAATAACTTGTTCAAGG + Intronic
1117884648 14:60347720-60347742 GAGGTTAATTAACTTATTCAAGG - Intergenic
1117950344 14:61076483-61076505 AAGGTTAAATGACTTGTTCAAGG + Intronic
1117991473 14:61438125-61438147 GATGTTAAACAACTTGCCCAGGG + Intronic
1118152789 14:63207748-63207770 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1118347227 14:64949102-64949124 GAGAATGTACAACTTGTCCAAGG - Intronic
1118377466 14:65189736-65189758 GAGGTTACATAACTTGCTCAGGG + Intergenic
1118432643 14:65736102-65736124 TAGGCTAAGCAATTTGTTCAAGG - Intronic
1118513330 14:66500490-66500512 GAGGTTAAATGACTAGTTCAAGG - Intergenic
1118565986 14:67141600-67141622 GAAGTTAAGCAACTTGTGCATGG + Intronic
1118588340 14:67378464-67378486 GAGATTAAATAATTTGTTCAAGG + Intronic
1118914946 14:70095007-70095029 GAGGGTAAGCAGCTAGTTCAAGG - Intronic
1119006251 14:70932313-70932335 GAGGAAAAACATCTAGTACAAGG + Intronic
1119058456 14:71448416-71448438 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1119196511 14:72720756-72720778 GGGGTTAAGCAATTTGTTCAAGG - Intronic
1119277827 14:73375375-73375397 GAGATTAAGTAACTTGTTCAAGG + Intronic
1119583026 14:75804735-75804757 GAGGTTAAACAACTTGTCCAAGG - Intronic
1119688046 14:76648626-76648648 GAGGTTAAACAACTTGCTGGAGG - Intergenic
1119769458 14:77211320-77211342 GAGGTTAAACAACTGGCTCAAGG - Intronic
1119895871 14:78219547-78219569 GAGTCTAAGTAACTTGTTCAAGG - Intergenic
1119919890 14:78437006-78437028 AAGGATAAGCAACTTGCTGAAGG - Intronic
1119959074 14:78834273-78834295 GAGGTTGAATAATTTGTTCAAGG + Intronic
1119980367 14:79073883-79073905 GAGGTTAAATAACGTGTCCAAGG - Intronic
1120385286 14:83838190-83838212 GAGGTTGAACACCTTGTTCAAGG - Intergenic
1120475921 14:84986930-84986952 GGGGCTAAGCAATTTGTTCAAGG + Intergenic
1120509665 14:85398055-85398077 GAAGCTAAACAATTTGCTCAAGG + Intergenic
1120510770 14:85411569-85411591 CAGGTTAAGCAACTTGTCCAAGG + Intergenic
1120762339 14:88296294-88296316 GAGGGTAAAAAACTTGTCCAAGG - Intronic
1120945887 14:89996656-89996678 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1121101813 14:91254610-91254632 GAGGGCAAACAACTTGCCCAAGG + Intergenic
1121101987 14:91255600-91255622 GAGGTTAAAAGACTTGTCCAGGG - Intergenic
1121228507 14:92339506-92339528 GAGGTTCAATAACTTGCTCAAGG + Intronic
1121495161 14:94387231-94387253 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1122453663 14:101833156-101833178 GAGAGTAAACAACTTGATCAAGG - Intronic
1202933921 14_KI270725v1_random:66096-66118 GCAGATATACAACTAGTTCATGG - Intergenic
1123763657 15:23453050-23453072 GAGGCTAAATAACTTGCTGAAGG - Intergenic
1123876924 15:24632824-24632846 GAGCATCTCCAACTTGTTCATGG + Intergenic
1125147925 15:36494213-36494235 TAGGTTAAATAATTTGTTCAAGG + Intergenic
1125377964 15:39053623-39053645 GAGGCTGAATAACTTGCTCATGG - Intergenic
1125697119 15:41648294-41648316 GAGGTTAAGTAATTTGTTCAAGG - Intronic
1125750969 15:42028233-42028255 GAGGATAAGAACCTTGCTCAAGG + Intronic
1126069299 15:44851792-44851814 GAAGTTAAATAACTTGGTCAAGG + Intergenic
1126089512 15:45039004-45039026 GAAGTTAAATAACTTGGTCAAGG - Intronic
1126444403 15:48726406-48726428 GAAGATAAGTAATTTGTTCATGG - Intronic
1126459666 15:48901768-48901790 GAGCTTTAAAAACTTGTTCAGGG - Intronic
1126697147 15:51335972-51335994 GAGGAGGAACAACACGTTCAAGG - Intronic
1127185285 15:56473025-56473047 GAGGTTAAATGACTTGTTCAAGG - Intergenic
1127202252 15:56667772-56667794 GAGGATAAGTTCCTTGTTCAAGG - Intronic
1127273646 15:57423475-57423497 GAGGAAAAATAACTCTTTCAAGG - Intronic
1127327246 15:57907536-57907558 GAGGTTGAAAAACTTGTCCAAGG - Intergenic
1127639964 15:60907196-60907218 GAGGTGAAGCAGCTTGTTCAGGG + Intronic
1127654320 15:61041952-61041974 GAGGTTAAATAACTTGCCCAAGG + Intronic
1127689385 15:61379899-61379921 GAGGTTAAATTACTTGTCCAAGG + Intergenic
1128155844 15:65391433-65391455 GAGGAAAAGGAACTTGTCCAAGG - Intronic
1128183698 15:65626239-65626261 GAAGTTAAACCACATGTTCAAGG + Intronic
1128198495 15:65782555-65782577 GATGTTAAACAACTTGTCCGAGG - Intronic
1128462815 15:67884193-67884215 AAGGTTAAACAACTTGCCCAAGG - Intergenic
1128499667 15:68219136-68219158 GAGGCTCAATAACTTGCTCAAGG + Intronic
1128615771 15:69108207-69108229 CAAGTTAAATAACTTGTTCAAGG + Intergenic
1128634830 15:69296526-69296548 GAAGAGAGACAACTTGCTCAAGG + Intergenic
1128753808 15:70167352-70167374 GAAGTTAAGCAACTTGTCCAAGG + Intergenic
1128803193 15:70510197-70510219 AGGGATAAGGAACTTGTTCAAGG - Intergenic
1128923819 15:71636088-71636110 GAAGGTAAACAATTTGTTGAAGG - Intronic
1129257321 15:74341090-74341112 GAGGTTAAATAACTTGGTCGAGG - Intronic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1130821870 15:87504518-87504540 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1131082410 15:89547663-89547685 GAGGTCACATAACTTGTTCAAGG - Intergenic
1131249937 15:90823657-90823679 GAAGTTAAATAACTTGCTCAAGG - Intergenic
1131961867 15:97797998-97798020 GAGGTTAAGTAATTTGTTCAAGG + Intergenic
1132160536 15:99537483-99537505 GAGGGTAAGTAACTTGCTCAGGG + Intergenic
1132521226 16:390384-390406 GAGGATCAACAACAGCTTCATGG + Intergenic
1133353724 16:5120577-5120599 GAGGGTAAGTAACTTGGTCAAGG + Intergenic
1133368506 16:5229882-5229904 GAAGTTCAACAACTTGTCCAAGG - Intergenic
1133703417 16:8330893-8330915 GAGGTTAAATAACTTTCTCAAGG + Intergenic
1133708168 16:8375505-8375527 GAGGAGAAAATAATTGTTCAAGG + Intergenic
1133852493 16:9518577-9518599 GAGGTTAAGCAACTTGACCAAGG + Intergenic
1134067214 16:11236542-11236564 GAGGTGAAACAACTTGCTCAAGG - Intergenic
1134071753 16:11264592-11264614 GAGGTGAAACAACTTGGTCAAGG - Intronic
1134199767 16:12188314-12188336 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1134577080 16:15341573-15341595 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1134693712 16:16207691-16207713 GAGGTTAAGCAACGTGTCCAAGG + Intronic
1134725360 16:16414920-16414942 GAGGTTAAATAACTTGCTCAAGG + Intergenic
1134863972 16:17588233-17588255 GAGAATAAACAGTTTGTTTAGGG - Intergenic
1134942072 16:18296938-18296960 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1134978131 16:18586952-18586974 GAGGTTAAGCAACGTGTCCAGGG - Intergenic
1135065772 16:19308575-19308597 GAAGTTCAGCAACTTGTTCAAGG + Intronic
1135167397 16:20151647-20151669 GAGGTGAAAGAACTTGCTCAAGG + Intergenic
1135467133 16:22696638-22696660 GAGAATAAATAACTTGCCCAAGG + Intergenic
1135486831 16:22872984-22873006 AAGGTTAAGAAACTTGTTCATGG - Intronic
1135544812 16:23358428-23358450 AAGGCTAAGAAACTTGTTCAAGG - Intronic
1135545593 16:23363864-23363886 GAAGATAATCAACTGGTTGAAGG + Intronic
1135581230 16:23628331-23628353 GAGGTTACACAATTTGTCCAAGG + Intronic
1135909898 16:26550403-26550425 AAGGCTAAGCAACTTGCTCACGG - Intergenic
1136237362 16:28922965-28922987 GAGGTTAAATAACTTGCCCAAGG - Intronic
1136555927 16:31007913-31007935 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1136686320 16:31996796-31996818 GAGGCAAAGCAACTTGCTCATGG + Intergenic
1136786933 16:32940325-32940347 GAGGCAAAGCAACTTGCTCATGG + Intergenic
1136882840 16:33913464-33913486 GAGGCAAAGCAACTTGCTCATGG - Intergenic
1137506617 16:49059420-49059442 GAAGTTAAGTAACTTGTTCAAGG - Intergenic
1137883786 16:52080165-52080187 CAGGCTTAACATCTTGTTCAAGG + Intergenic
1138038849 16:53639657-53639679 GAGGTTAAGTAACTTGTTCATGG - Intronic
1138052222 16:53791287-53791309 GAGGTTAAGTAACTTGCTCAAGG + Intronic
1138522518 16:57578890-57578912 GATGAGAAAGAACCTGTTCAGGG - Intronic
1138624076 16:58235373-58235395 GAAGTTAAGCAACTTGTCCAAGG - Intronic
1138835196 16:60426143-60426165 GAGGTTAAGCAACTTGCTCAAGG - Intergenic
1139331438 16:66195279-66195301 CAGGTTAAGTAACTTGTTCAAGG - Intergenic
1139519755 16:67474304-67474326 GAGGATAAATGACTTGTCCAAGG + Intronic
1139672169 16:68499343-68499365 GAGGTTAAGCAACTTGCCCAGGG - Intergenic
1140116272 16:72044099-72044121 GAGGATAAGGAACTTGTTCAAGG - Intergenic
1140873490 16:79128491-79128513 GAGGTTAAATAACTTGGCCAAGG + Intronic
1140941372 16:79724212-79724234 GAGGTTAAAAATCTTGTCCAAGG - Intergenic
1141283152 16:82647117-82647139 GAGGTTAAGCAACTTGCCCATGG - Intronic
1141343020 16:83221028-83221050 GCTGTTAAACAACTTTTTCAAGG + Intronic
1141474020 16:84259879-84259901 GAGGTCAAGCAACTTGTCCAAGG + Intergenic
1141496995 16:84417092-84417114 GAGGTTAACTAACTTGCTCAAGG - Intronic
1141561174 16:84868631-84868653 GAGGGGAAGCAAATTGTTCAAGG + Intronic
1141564962 16:84895195-84895217 GAGGTTAAACGACTTGCCCAAGG + Intronic
1141609998 16:85175873-85175895 GAGGTTAAGCAACTTGTCCAAGG + Intronic
1141825626 16:86477690-86477712 GAGGTTAAGTAACTTGTGCAAGG - Intergenic
1141916550 16:87101185-87101207 GAGGATAGATAACTTGTCTAAGG - Intronic
1141929834 16:87194990-87195012 GAGGTTAAGGAACTTGTCCACGG + Intronic
1203089169 16_KI270728v1_random:1201995-1202017 GAGGCAAAGCAACTTGCTCATGG + Intergenic
1142870050 17:2814221-2814243 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1142952342 17:3493733-3493755 GAAGTTAAGCATCTTGTTCAAGG + Intronic
1143281380 17:5757161-5757183 GAGGGTGGACAACTTGTCCAAGG - Intergenic
1143505128 17:7359807-7359829 GAGGTTAAATAACTTGCCCACGG - Intergenic
1143589255 17:7871238-7871260 GAGGTTAAATATCTTGCTCAAGG - Intronic
1144105940 17:11985393-11985415 AAGGTTAAATAACTTGCTCAAGG - Intronic
1144175685 17:12704700-12704722 GAGGTTAAGCAACTTGCTTAGGG + Intronic
1144458541 17:15438642-15438664 AAGGTTAAGAAACTTGTTCAAGG - Intronic
1145038546 17:19559189-19559211 GAGGGTAAGTAACTTGCTCAGGG + Intronic
1145350958 17:22082971-22082993 GAGTATAAACATCCTGTTGAGGG - Intergenic
1145840861 17:27993244-27993266 GAACTTAAACAACTTGTTCAAGG + Intergenic
1145900528 17:28488021-28488043 GAGGGTAAACAGCTTGCTCAGGG - Intronic
1146465710 17:33084542-33084564 GTGGTTGAATAACTTGTTCAAGG - Intronic
1146496373 17:33326047-33326069 GAGGTTAAGAAACTTGGTCAAGG + Intronic
1146602118 17:34226757-34226779 GAGATTAAATAACTTGCTCAAGG - Intergenic
1146650772 17:34604918-34604940 AAGGTTAAACAACTTTCTCAAGG + Intronic
1146667703 17:34715908-34715930 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1146807825 17:35879254-35879276 GAGGTTAAGTAACTTGTCCATGG - Intronic
1146820671 17:35981739-35981761 GAGGCTAAATAAATTGTCCAAGG + Intergenic
1146846750 17:36186673-36186695 GAGTTAAAACAACTTGTCCATGG - Intronic
1146889765 17:36498953-36498975 GAGGCTAAACAACCTGCCCAAGG + Intronic
1146912244 17:36656369-36656391 GAGGTCATGCAACTTGTTCAAGG + Intergenic
1147008661 17:37425483-37425505 GAGGTTAAGTAACTTGTTCAGGG + Intronic
1147147279 17:38492464-38492486 GAGGCAAAGCAACTTGCTCATGG + Intronic
1147215123 17:38894450-38894472 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1147267820 17:39245394-39245416 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1147568938 17:41555314-41555336 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1147657089 17:42097211-42097233 GAGGTTAAGAAACTTGTTCAAGG + Intergenic
1147774006 17:42887682-42887704 GAAGTTAAATAACTTGTTCAAGG - Intergenic
1147794875 17:43035093-43035115 GAGGTTAAGTAACTTGTGCAAGG - Intergenic
1147853040 17:43457161-43457183 GAGGGTAAGTAACTTGTCCAAGG - Intergenic
1148062240 17:44844854-44844876 GAGGATACACAGCTAGTACATGG - Intergenic
1148207209 17:45786524-45786546 GAGGCTAAGTAACTGGTTCAAGG + Intronic
1148440597 17:47709754-47709776 GAGGATAAGTAACTTGCACAAGG - Intronic
1148535863 17:48438162-48438184 GAAGATAAGTAACTTGTCCAAGG - Intergenic
1148680187 17:49469347-49469369 GAGGATAAGAGACTTGTCCAAGG - Intronic
1148759479 17:49992089-49992111 GAGGTTAAACAACTTGCCCAAGG - Intronic
1148787742 17:50153679-50153701 GAGGATAAGTGACTTGTCCAAGG - Intergenic
1148895142 17:50835208-50835230 GTGGAAAAACAACAAGTTCACGG - Intronic
1148992020 17:51674372-51674394 AAGGATAAAGTGCTTGTTCAAGG - Intronic
1149138433 17:53399592-53399614 CAGGATAACCAACTCCTTCAGGG - Intergenic
1149208975 17:54281791-54281813 GAGGATAAGTAACTTGTCCCAGG - Intergenic
1149411259 17:56409862-56409884 GGGGTTAAGTAACTTGTTCAAGG - Intronic
1149436953 17:56641125-56641147 GAGGCAAAACATCTTGTGCAAGG + Intergenic
1149778897 17:59380654-59380676 GAGGTTAATGAGCTTGTTCAAGG + Intronic
1149831723 17:59878453-59878475 GAGATTAAAAAACTTGTCCAAGG - Intronic
1150283801 17:63944494-63944516 GAGGCCAAGCCACTTGTTCAAGG + Intronic
1150298048 17:64025161-64025183 GAGGTTACACAACTTGCTCAAGG - Intergenic
1150624425 17:66832655-66832677 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1150749500 17:67847080-67847102 GAGGCTAAATGACTTGTCCAAGG - Intronic
1150845478 17:68653384-68653406 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1151180508 17:72324107-72324129 GAGGATAAATGACTTGCTCAAGG - Intergenic
1151400211 17:73850962-73850984 GAGGTTAAACAACCTGCTCAAGG - Intergenic
1153057638 18:962925-962947 GAGCGCAAACAACTTGTTCAAGG - Intergenic
1153251154 18:3123497-3123519 GAAGAAAAATAACATGTTCATGG + Intronic
1153417318 18:4861441-4861463 GAGTTTAATCAACTTGTACAAGG + Intergenic
1153579290 18:6555904-6555926 GAGGATAACTTATTTGTTCATGG - Intronic
1155079189 18:22390702-22390724 GAGGTAAAGCGACTTGTTCAAGG + Intergenic
1155082308 18:22422939-22422961 GAGGTGAAGCAACTTGCTCAAGG + Intergenic
1155208150 18:23578280-23578302 GAGGCTAAACAACTTGTCCAAGG + Intronic
1155256304 18:24000925-24000947 GATGTTAAGCAACTTGATCAAGG + Intronic
1155456518 18:26021246-26021268 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1155727267 18:29103129-29103151 GTAGATAAACAATTTGTTCAAGG + Intergenic
1156460139 18:37317002-37317024 GAGGCTAGATAACTTGTTCCAGG - Intronic
1156816962 18:41323028-41323050 ATGGTTAAATAACTTGTTCAAGG + Intergenic
1157185255 18:45534804-45534826 GAGGAGAACTAACTAGTTCATGG + Intronic
1157215960 18:45783664-45783686 GAGGCTAAATAACTTGTTCTGGG + Intergenic
1157267578 18:46241310-46241332 GAGGAGAAACAACTGGTCCAAGG - Intronic
1157302518 18:46489234-46489256 GAGGACAGATAACTTGTCCAGGG - Intronic
1157336362 18:46740735-46740757 GAGGTTAAGTAATTTGTTCAAGG - Intronic
1157340403 18:46772822-46772844 GAGGGAAAGCAACTTGTTCATGG - Intergenic
1157389469 18:47289089-47289111 GAGGTGAAGCAACTTGTCCAAGG + Intergenic
1157499710 18:48180972-48180994 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1157508541 18:48250333-48250355 GAGTTTAACTAACTTGTTCAAGG - Intronic
1157564367 18:48670017-48670039 GAGGTTAAACAACTTGTACAGGG + Intronic
1157798249 18:50596199-50596221 GAGGTTAAATGACTTGTCCAAGG + Intronic
1158110075 18:53931096-53931118 GAGATTCAAAAACTTGTTCAAGG - Intergenic
1158118372 18:54022430-54022452 GAAGTTAAACAACCTGTTCATGG - Intergenic
1158143518 18:54283554-54283576 AAGGTTAAATAACTTGTCCAAGG + Intronic
1158253383 18:55516205-55516227 GAGGTTAAATGACTTGTTCAAGG - Intronic
1158357194 18:56634359-56634381 GAGGTTAAATAATTTGTTTAAGG - Intronic
1158507535 18:58059993-58060015 GAGGTTAAATAACTTGCCCAGGG + Intronic
1159271701 18:66161493-66161515 GAGGTTAAACAACATGTCTAAGG + Intergenic
1159480832 18:68989457-68989479 AAAGAAAAATAACTTGTTCAAGG - Intronic
1159966767 18:74602642-74602664 TAGGATAAATAGCTTGTGCAAGG + Intronic
1160692983 19:468514-468536 TAGGATAAATAACTTGGCCAAGG - Intronic
1161602854 19:5195423-5195445 GAGGTTAAATAACTTGCCCAAGG - Intronic
1161606714 19:5219159-5219181 GAGGTTAAGCCACTTGATCAAGG - Intronic
1161632318 19:5364318-5364340 GAGGTCACACAGCTTGTTCAAGG - Intergenic
1162146636 19:8616434-8616456 GAGGTTGAGTAACTTGTTCAAGG + Intergenic
1162151121 19:8646393-8646415 GAGGTTAAGCAATTTGTCCAAGG + Intergenic
1162204770 19:9047416-9047438 GAGATTAAGCAACTTGCTCAAGG - Intergenic
1163258016 19:16169488-16169510 GAGGTTAAGACACTTGTTCATGG - Intronic
1164138160 19:22433049-22433071 GAGTAAAAACAATTGGTTCAGGG + Intronic
1164567374 19:29336963-29336985 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1164573625 19:29392264-29392286 GAGGTAAAGCAATTTGTTCAAGG - Intergenic
1165217154 19:34283601-34283623 GAGGTTAAGGAACTTGCTCAAGG + Intronic
1165847858 19:38830365-38830387 GAGGTTAAGCATGTTGTTCATGG + Intronic
1166442847 19:42830993-42831015 AAGAAAAAACAATTTGTTCAGGG - Intronic
1166450634 19:42897421-42897443 AAGAAAAAACAATTTGTTCAGGG - Intronic
1166519304 19:43469434-43469456 GGGGCTTAACAACTTGCTCAGGG + Intergenic
1166643767 19:44516082-44516104 GAGGGTAAGTAACTTGTCCAAGG + Intronic
1166838943 19:45684447-45684469 GAGGGTAAGCAACTTGCTCGGGG - Intergenic
1166928868 19:46288963-46288985 GAGGTTAAGTAATTTGTTCAAGG + Intergenic
1167020005 19:46866483-46866505 GAGGTCAAGCAATTTGTTCAAGG - Intergenic
1167487070 19:49768779-49768801 GAGGTTAAACAACTCGTGGAGGG - Intronic
1168272318 19:55256952-55256974 GACGAGGAACAACTTGTCCAAGG + Intronic
925309011 2:2868763-2868785 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
925422240 2:3722154-3722176 GAGGTTATACAACTTGATCAAGG + Intronic
925656262 2:6152836-6152858 TAGGATAAAGACCTTGCTCAGGG + Intergenic
925673382 2:6335158-6335180 GAGGTTGAACAAATTGTCCAAGG + Intergenic
926048564 2:9728264-9728286 GAGGTTAGGCAACTTGTCCATGG + Intergenic
926463296 2:13160774-13160796 GAGGATAAATGACCTGTCCAAGG + Intergenic
926575737 2:14578789-14578811 GAGGTTCAATAACTTGCTCATGG - Intergenic
926591275 2:14742741-14742763 GAGGCAAAACAACTTGTTCAAGG - Intergenic
926607461 2:14911794-14911816 GAAGTTAAGCAACTTGTTCAGGG - Intergenic
926683004 2:15678111-15678133 CAGGATCAATAACTTGTCCAAGG - Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
926809007 2:16739971-16739993 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
926845862 2:17138504-17138526 GAGGATAGACAACTGGCTGAGGG + Intergenic
926881297 2:17547196-17547218 GAGTTTAAACAATTTATTCAAGG - Intronic
927043698 2:19255693-19255715 GAGGTTACACCAGTTGTTCAAGG - Intergenic
927081508 2:19635190-19635212 GAGGCTAGTTAACTTGTTCATGG + Intergenic
927956258 2:27209484-27209506 GAGATTAAATAACTTGCTCAAGG + Intronic
928099812 2:28430233-28430255 GAGGTTAAGTAACGTGTTCAAGG - Intergenic
928214600 2:29350798-29350820 GAGGTTAAGCAACTTGTCCAAGG + Intronic
928912322 2:36434493-36434515 GAGGATAAGAAACTTGGCCAAGG - Intronic
929634674 2:43505876-43505898 GAGGTTAAACCACTTGCCCACGG - Intronic
929835716 2:45396149-45396171 GAGTTTAAATAACTTGTCCAAGG + Intronic
929845323 2:45520013-45520035 AAGGATAAAGAACTTGTACAGGG - Intronic
930065746 2:47326298-47326320 GAGCAGAAGCAACTTGTCCAAGG - Intergenic
930406082 2:50957271-50957293 GAGATTAAATAACTTGCTCAAGG - Intronic
930779778 2:55212927-55212949 GAGGCTAGATAACTTTTTCAGGG - Intronic
931084828 2:58817949-58817971 GAATATAAGCAACTTGTTCAAGG - Intergenic
931097414 2:58956858-58956880 GAGGATAAACAATCTGCTCCGGG - Intergenic
931265887 2:60660240-60660262 GAGGTTACACTACTTGCTCAAGG + Intergenic
931380604 2:61749540-61749562 GAGGTTAACCAAATTGTTCTAGG - Intergenic
931585236 2:63819197-63819219 CAGGTTAAATAACTTGTTCAAGG - Intronic
931593830 2:63917847-63917869 GAGGTTAAGCAACTTGTCTAAGG - Intronic
931599156 2:63985522-63985544 AAAGATAAACAACTTCCTCAAGG + Intronic
931665289 2:64606185-64606207 GAGGTTGAACAACTTGCCCAAGG + Intergenic
931874609 2:66498352-66498374 GAGGTTAAATAACTTGCCCAGGG + Intronic
932279841 2:70481080-70481102 GAGGAAAAACAAATTTTTCATGG - Intronic
932356087 2:71069300-71069322 GAGGGTAAATATCTTGTCCATGG - Intronic
932366614 2:71157146-71157168 GAGGAGAAGCAACTTTCTCAAGG + Intergenic
932721330 2:74140862-74140884 GAGGTTGAAAAACTTGCTCAAGG + Intronic
932796543 2:74700675-74700697 GAGGGTAAGTAACTTGCTCAAGG + Intergenic
932797980 2:74714519-74714541 GAGAATAAATAACTTTCTCAAGG + Intergenic
933573160 2:84036928-84036950 GGGATTAAACAACTTGTCCATGG + Intergenic
933802614 2:85975158-85975180 GAGATTAAATAACTTGTCCAAGG - Intergenic
933884544 2:86705859-86705881 GAGGTTAAATAACTTGCTCATGG + Intronic
933998114 2:87684869-87684891 GAGGTTAAACAACTTTCCCACGG + Intergenic
934307342 2:91838247-91838269 GCAGATATACAACTAGTTCATGG + Intergenic
934325915 2:92014466-92014488 GCAGATATACAACTAGTTCATGG - Intergenic
934464266 2:94245111-94245133 GCAGATATACAACTAGTTCATGG - Intergenic
934792200 2:97070781-97070803 GAGGTTAAACAACTTTCCCACGG - Intergenic
934814417 2:97312928-97312950 GAGGTTAAACAACTTTCCCACGG + Intergenic
934823276 2:97395555-97395577 GAGGTTAAACAACTTTCCCACGG - Intergenic
934855837 2:97729275-97729297 GAGGATAAGCAGTTTATTCAGGG + Intronic
934956165 2:98621886-98621908 GAAGATACACACTTTGTTCAAGG + Exonic
935365526 2:102285845-102285867 GAGAATAAATAACTAGTCCAAGG + Intergenic
935396140 2:102611222-102611244 GAGGATCAACATCTAGTTCAAGG - Intergenic
935682524 2:105650349-105650371 GAGGTTTAGAAACTTGTTCAAGG + Intergenic
935812717 2:106815719-106815741 GATGCTAAGTAACTTGTTCAAGG + Intronic
935985384 2:108667357-108667379 GAGGTTAAGCAACTTGCCCAAGG + Intronic
936066132 2:109333757-109333779 GAGGTTAATTAACATGTTCAAGG - Intronic
936295738 2:111266004-111266026 GAGGTTAAACAACTTTCCCACGG - Intergenic
936952092 2:117987965-117987987 GAGGTTAAAAAACTTGCTGATGG + Intronic
937103714 2:119291308-119291330 ATGGATACACAGCTTGTTCAAGG - Intergenic
937492731 2:122386834-122386856 GAGGTTAAATAACTTGTCCAAGG + Intergenic
937744982 2:125401750-125401772 AAGGATAAGTAACTTGTTCAAGG - Intergenic
937859559 2:126697139-126697161 GGGGTCAAACAAGTTGTTCAAGG - Intergenic
937968037 2:127529030-127529052 GAGGTTCAGCAACTTGCTCAAGG - Intergenic
938590831 2:132734732-132734754 GAGGTTAAGCAACTTGTCCAAGG + Intronic
938664327 2:133518687-133518709 GAGGTTAAATGACTTGTCCAAGG - Intronic
938802280 2:134774296-134774318 GAAGTTAAAGAACTTGCTCAAGG - Intergenic
938913006 2:135903255-135903277 GAGGATAAGCAAGTTATCCAAGG + Intergenic
939297906 2:140293866-140293888 GAGGTTAAATAACTTGCTCAAGG - Intronic
939443537 2:142279442-142279464 GATGATAAAAACCTTGTTAAGGG + Intergenic
939967508 2:148624855-148624877 GAGAATATACCACTTGTTTATGG + Intergenic
940245682 2:151613005-151613027 GAATATAAACAACTGGTTGAAGG + Intronic
940823692 2:158386242-158386264 GAGGTTAAACAACTTGTTCAAGG + Intronic
940864929 2:158808305-158808327 CAGGATAAATAACTTGCTCAAGG - Intronic
941149656 2:161898121-161898143 GAGGTTAAAACATTTGTTCAAGG - Intronic
941728053 2:168885804-168885826 GAGGTTAAGCAACTTTCTCAAGG - Intronic
941938768 2:171010528-171010550 GAGGATAAAAACCTTCTTAAGGG + Intronic
942120934 2:172776225-172776247 GAGGTTAAGCAACTTGTTCAGGG + Intronic
942505863 2:176640932-176640954 GAGGTTATATAACTTGTCCAGGG - Intergenic
942543327 2:177037281-177037303 GAGGCTAAGCAACTTGCCCAAGG + Intergenic
942547893 2:177083723-177083745 GAGGTTAAATAACTTGTTCAGGG + Intergenic
942853086 2:180513612-180513634 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
942877629 2:180820593-180820615 GAGGTTAAATAAATTGTTCAAGG - Intergenic
943150176 2:184101436-184101458 GTGGATAAAAACCTTGTTCATGG + Intergenic
943537037 2:189165644-189165666 GAAGATCAGGAACTTGTTCAAGG + Intronic
943750508 2:191504900-191504922 GAGGTTAAGCAACTTGTTTAAGG + Intergenic
944045694 2:195409003-195409025 GAGATTACACAACTTGTTCAAGG + Intergenic
944855513 2:203763379-203763401 GAGGTTAAGTAACTTGTTTAAGG + Intergenic
944994375 2:205277297-205277319 GAGGTTAAATATCTTGTTCAAGG - Intronic
944996446 2:205300353-205300375 GAAGTCAAACCACTTGTTCAAGG + Intronic
945217354 2:207447869-207447891 GAGGAGAAATGACTTGTTCAAGG - Intergenic
945379079 2:209117554-209117576 GAAGATAAGGAACTTATTCAAGG + Intergenic
945415137 2:209561478-209561500 GAGGTTAAATAACTTCTCCAAGG - Intronic
945465234 2:210161810-210161832 GATAGTAAACAATTTGTTCAAGG + Intronic
945498624 2:210540683-210540705 GAGTTAAAGCAACTTGTTCAAGG + Intronic
945584402 2:211640545-211640567 TAGGTTATACAACTTGTCCAAGG + Intronic
945613931 2:212043769-212043791 AAGATTAAATAACTTGTTCAAGG - Intronic
946049562 2:216850610-216850632 GAAGCTAGACAACTTGTTCAAGG + Intergenic
946070176 2:217028099-217028121 GAGGTTAAAGAACTTGCTCAAGG + Intergenic
946102378 2:217337107-217337129 GAGGTTAAGCAACTTCCTCAAGG + Intronic
946403005 2:219478427-219478449 GAGGTTAAATAACTTGCCCAAGG + Intronic
946504764 2:220287089-220287111 AAGGAAAAGTAACTTGTTCAAGG + Intergenic
946601494 2:221364809-221364831 GAGATTACATAACTTGTTCAAGG - Intergenic
946685331 2:222263721-222263743 GAGGAAAAACAACCAGTTGAGGG - Intronic
946828539 2:223704314-223704336 GAGTTTAAGCAACTTGATCAAGG + Intergenic
947082437 2:226413482-226413504 GAGGTTAAACAACTTGCCCAAGG + Intergenic
947174415 2:227348708-227348730 GAAGCTAAGCAATTTGTTCAAGG - Intronic
947280774 2:228451814-228451836 GAGTATAAACAAATTGCCCAAGG + Intergenic
947393313 2:229662471-229662493 AAGGCAAAATAACTTGTTCAAGG + Intronic
948295029 2:236854250-236854272 GAGGTTAAGCAACTTGTCCAAGG + Intergenic
949086336 2:242158956-242158978 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1168793819 20:597871-597893 GAGGTTAAAGAACTTGGCCAAGG - Intergenic
1168798873 20:631140-631162 GTGGTTAAACAACTTGCTCAAGG - Intergenic
1168840600 20:907663-907685 GAGGTTAAACAACTTGTCCAAGG + Intronic
1168913084 20:1465851-1465873 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1169020086 20:2324391-2324413 GAGGATAAACCACATTTTCCTGG + Intronic
1169036831 20:2460431-2460453 GAGGAAAGCCAACATGTTCATGG - Intergenic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1169724140 20:8711108-8711130 GAGGATGAATAACTTGCTCAAGG + Intronic
1169833938 20:9856520-9856542 AAGGTTAAAAAACTTGTTTAAGG + Intergenic
1169853978 20:10083415-10083437 GAGATTAAACAACTTTTTCAAGG - Intergenic
1170073739 20:12396843-12396865 GACGTTAAGCAATTTGTTCAAGG + Intergenic
1170085995 20:12532298-12532320 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1170414734 20:16127591-16127613 GATGTTAAACAACTCCTTCAAGG - Intergenic
1170441636 20:16385498-16385520 AAGGTTAAATAACTTGTTCATGG - Intronic
1170880419 20:20292145-20292167 GATGCTGAAGAACTTGTTCAAGG - Intronic
1170963209 20:21043832-21043854 GAGGTTAAGGAACTTGCTCAGGG + Intergenic
1171976082 20:31595620-31595642 GAAGGTAAGCAACTTGCTCAAGG - Intergenic
1172067461 20:32231633-32231655 GAGGTCAAATAACTTTTTCAAGG - Intronic
1172429948 20:34881736-34881758 GAGGTTAAATAACTTGTCTAAGG - Intronic
1172588341 20:36100603-36100625 GAGGCTAAATAACTTGCCCAAGG + Intronic
1172695254 20:36817974-36817996 GAGGAGAACCACCTTGTCCAAGG + Intronic
1172749763 20:37242594-37242616 GAGGTTAAACTACTTGCCCAAGG - Intergenic
1172930534 20:38583286-38583308 GAGGAGAAGCAACCTGTCCAAGG + Intronic
1173026883 20:39315834-39315856 GAGAATAAGAAACTTGTTTAAGG - Intergenic
1173027220 20:39319577-39319599 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1173087318 20:39936218-39936240 GAGGCCAAATAACTTGTTCATGG - Intergenic
1173294053 20:41739964-41739986 GAGGTTAAGTGACTTGTTCAAGG - Intergenic
1173343918 20:42180932-42180954 GAGATTAAATAACTTGCTCAAGG - Intronic
1173659242 20:44721852-44721874 GAGGCTAAGCAACTTGCCCAAGG + Intronic
1173684691 20:44914881-44914903 GAGAATAAATGACTTGTCCAAGG - Intronic
1173841022 20:46157395-46157417 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1173900529 20:46584253-46584275 GAGCAGAAACAACTTGTTCAAGG + Intronic
1173957307 20:47043611-47043633 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1173969469 20:47140667-47140689 AAGGTTAGGCAACTTGTTCAAGG - Intronic
1173984152 20:47248124-47248146 AGAGATAAATAACTTGTTCAGGG - Intronic
1174146117 20:48453799-48453821 CAGGTTAAAAAACTTGCTCAAGG - Intergenic
1174298468 20:49565715-49565737 AAGGCTAAGCAACTTGCTCAAGG - Intronic
1174356056 20:49998645-49998667 GAGGTTGAACAACTTGCTCTAGG - Intergenic
1174395880 20:50246667-50246689 AAGGTGAAACGACTTGTTCAAGG + Intergenic
1174455784 20:50647802-50647824 GAGGATAAGTGACTTGTCCAAGG - Intronic
1174546446 20:51328873-51328895 GAGGTTAAGCAACTTGTCCTAGG - Intergenic
1174595628 20:51681122-51681144 CAGGTTAAGCAACTTGTTCAAGG - Intronic
1174904121 20:54532245-54532267 GAGGTTAAACAACCTGCCCAAGG + Intronic
1175409210 20:58754910-58754932 GAGGTCACACAACTTGCTCAAGG - Intergenic
1175915772 20:62425038-62425060 GAGGAAAAGCAACTTGCCCAAGG - Intronic
1176595320 21:8688253-8688275 GCAGATATACAACTAGTTCATGG - Intergenic
1176916421 21:14631372-14631394 GAGTTTAAAGAACTTGTCCAAGG + Intronic
1177919458 21:27132740-27132762 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1178105802 21:29317896-29317918 GAGGTTAAGCAACTTGGCCAAGG + Intronic
1178337532 21:31756974-31756996 GAGGCTAAGTAACTTGTCCAAGG - Intergenic
1178373729 21:32049449-32049471 GAGGGTAAGAAACTTGGTCAAGG - Intergenic
1178381361 21:32112318-32112340 GAGGCTAATCAATTTGTCCAAGG - Intergenic
1178462074 21:32811470-32811492 GAGGTTAAATAACTTGTCCAAGG + Intronic
1179249919 21:39664127-39664149 GAGGGTGAACAACTCATTCAAGG + Exonic
1179594740 21:42435102-42435124 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1180278176 22:10665406-10665428 GCAGATATACAACTAGTTCATGG - Intergenic
1180585428 22:16884259-16884281 GCAGATATACAACTAGTTCATGG - Intergenic
1180632268 22:17237772-17237794 GTGGGTACACAACTTGTCCATGG - Intergenic
1180699078 22:17772045-17772067 GAGGCTAAGTAACTTGTCCAAGG - Intronic
1180743802 22:18072955-18072977 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1181457024 22:23065605-23065627 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1181791204 22:25268091-25268113 GAGGTCAAGCAACTTGCTCAAGG - Intergenic
1181850300 22:25744887-25744909 GAGGGAAAGCCACTTGTTCAAGG + Intronic
1181882975 22:25996144-25996166 GAGGTTGAATAACTTGTCCAAGG - Intronic
1181940186 22:26469948-26469970 GAGGCTAAGCAACTTGCCCAAGG + Intronic
1181983197 22:26781246-26781268 GAGGTTAAGCAACTTGCCCATGG + Intergenic
1182041375 22:27241349-27241371 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1182081756 22:27534195-27534217 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1182227793 22:28813089-28813111 GAGGTTAAGCAACTTGTCCAAGG - Intergenic
1182554818 22:31123395-31123417 GAGGAAAAGCAACTTGGCCAAGG - Intronic
1182769939 22:32787460-32787482 GAGGTTAAATCACTTGCTCAAGG - Intronic
1182770474 22:32792197-32792219 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1182835984 22:33341746-33341768 GAAGAGAAACGAGTTGTTCAAGG - Intronic
1183016178 22:34989503-34989525 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1183075476 22:35423969-35423991 GAGGCTAAGCCACTTGCTCAAGG - Intronic
1183105206 22:35610515-35610537 GAGGTTAAGCAGCTTGTCCACGG - Intronic
1183248890 22:36714298-36714320 GAGGGTAAGCAACTTGCCCAAGG + Intergenic
1183347757 22:37317373-37317395 GAGGGTAAGCAACTCGTTCGGGG - Intergenic
1183383390 22:37501688-37501710 GAGGTTAAGCAACTTGCCCAGGG - Intronic
1183489709 22:38109828-38109850 GAGGTTAAACAGCTCATTCAAGG - Intronic
1183945207 22:41321738-41321760 GAGGTTAAGCAACTTGTTTAAGG + Intronic
1184001382 22:41676421-41676443 GAAGTTAAACACCTTGCTCAAGG - Intronic
1184103974 22:42356843-42356865 GAGGTGAAGGAACTTGTTCAGGG + Intergenic
1184445421 22:44544310-44544332 GAGGTTAAGTAACTTGTCCAGGG + Intergenic
1184446274 22:44548907-44548929 GAGGTTAATGAACTTGGTCAAGG + Intergenic
949420357 3:3858663-3858685 AAGGTTAAGCAATTTGTTCAAGG + Intronic
949473031 3:4416616-4416638 GAGGTTAACTAACTTGCTCAAGG - Intronic
949644952 3:6082702-6082724 GAAGTTAAATAACTTGTTCAGGG + Intergenic
949801849 3:7912804-7912826 CAGGTTAAAAAACTTGTTCAAGG - Intergenic
949857778 3:8477746-8477768 GAGGTTAAGGAACTTGGTCAAGG + Intergenic
949918011 3:8979996-8980018 GAGGCTAAACAGCTTGCCCAAGG - Intergenic
950048230 3:9964414-9964436 GAGGTCAAATAATTTGTTCAAGG + Intronic
950148476 3:10668277-10668299 GAGGTTAAGCGACTTGGTCATGG + Intronic
950165526 3:10794499-10794521 GAGGTTAAGAAACTTGTCCAGGG - Intergenic
950180788 3:10911775-10911797 GAGGTTAAGTAACTTGTCCAGGG + Intronic
950240497 3:11365744-11365766 GAGGGGAAACGACTTCTTCATGG + Intronic
950327611 3:12126673-12126695 GAGATTAAGTAACTTGTTCAAGG - Intronic
950673844 3:14542844-14542866 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
950689996 3:14647928-14647950 GAAGGTAAATAACTTGTCCATGG - Intergenic
951064633 3:18249574-18249596 GAAGCTAAACAACTTGCTCAAGG + Intronic
951127310 3:18998720-18998742 GAGGTTGAGCAACTTGTTCAAGG - Intergenic
951359306 3:21705652-21705674 GAGAATAAAAGACTTGTCCATGG + Intronic
951484681 3:23198897-23198919 GAAGTTAAACCACTTGCTCATGG + Intergenic
951765692 3:26195868-26195890 GAGAAAAAATAATTTGTTCAAGG + Intergenic
951808223 3:26670699-26670721 GAGGTTAAGGAACTTGTTCAAGG - Intronic
952304008 3:32129543-32129565 GAGGCTAATGAACTTGTCCAGGG + Intronic
952541868 3:34375320-34375342 GAGTTTAAGCAACTTGTCCAGGG + Intergenic
952683262 3:36120495-36120517 AAGGATAAACAATTTTTTCATGG + Intergenic
952753767 3:36847865-36847887 GAGAATAAACAATGTGTTCGAGG - Intronic
952842954 3:37663801-37663823 GATGTTAAGCAACTTGCTCAAGG - Intronic
952934241 3:38383226-38383248 GTGGTTAAATAACTTGGTCAGGG + Intronic
952979810 3:38725537-38725559 GAGGTTAAACAACTTGCCTAAGG - Intronic
953042934 3:39270968-39270990 GAGGGTGAATAACTTGTTCGAGG + Intronic
953113038 3:39962122-39962144 GAAGTTAAGCCACTTGTTCAAGG - Intronic
953258476 3:41313217-41313239 GAGGTTAAATAACTTGCTCATGG - Intronic
953414301 3:42706883-42706905 GAGGTTAAATAACTTGCCCAAGG + Intronic
953428520 3:42817033-42817055 GAGGCTAAATAACGTGTTCAAGG - Intronic
953475215 3:43200222-43200244 GAGGTTAAACAACTTGCTCCAGG - Intergenic
953578359 3:44130979-44131001 GAGGATAAAGAATTTGTTGGAGG - Intergenic
953623655 3:44553371-44553393 GAGGCTAAGTAACTTGTCCATGG + Intergenic
954173029 3:48820620-48820642 GAGGTTAAGTAACTTATTCAAGG - Intronic
955071096 3:55572991-55573013 GAAGTTAAGCAACTTGTTCAAGG - Intronic
955128000 3:56133601-56133623 GAGGATGTATAACTTGCTCAAGG - Intronic
955130968 3:56168152-56168174 GAGGATAAGCAACCTGCCCATGG - Intronic
955340383 3:58120860-58120882 GAGGTTAAGTAACTTGTCCAGGG - Intronic
955391090 3:58522809-58522831 GAGGTTAACCAATTTGTCCAGGG + Intronic
955408552 3:58641347-58641369 GAGGTTAAGCAACTTGCCCAAGG - Intronic
955440210 3:58946989-58947011 GACATTAAGCAACTTGTTCAAGG + Intronic
955515175 3:59719305-59719327 GATGTTAAATAACTTGTTCAAGG - Intergenic
955551027 3:60085748-60085770 AAAGATAAACAACTTGTCCAAGG - Intronic
955579081 3:60399625-60399647 GAGGATAAATTACTTTTTCTAGG + Intronic
955676819 3:61457496-61457518 GATGTTAAGTAACTTGTTCATGG + Intergenic
955866918 3:63394218-63394240 GAGGTTAAGAGACTTGTTCAAGG - Intronic
955870748 3:63436115-63436137 GAAGATTAACAACTTTCTCATGG + Intronic
955947903 3:64213025-64213047 AAGGATTAAAAACTTGGTCAAGG - Intronic
956240372 3:67123379-67123401 GAGGTTAAATAACTTACTCAAGG - Intergenic
956429980 3:69176823-69176845 GAGGATAAACTACTTGCCTAAGG - Intronic
956433570 3:69211282-69211304 GAGATTAAACAACATGCTCAAGG + Intronic
956789045 3:72666583-72666605 GAGGTTAAATGACTTGTCCAAGG - Intergenic
956892105 3:73623494-73623516 GAGGTTAAGCAGCTTGCTCAAGG + Intronic
957057675 3:75456565-75456587 GAGGGTAAGTAACTTGGTCAAGG + Intergenic
957354957 3:79070231-79070253 CAGTAACAACAACTTGTTCAAGG - Intronic
957535767 3:81501363-81501385 CAGGAAAGACAACTTTTTCACGG + Intronic
957746821 3:84354801-84354823 GAGAATAAACAATTTGACCAAGG - Intergenic
957871913 3:86099896-86099918 GAGGATAAACAACTAGTCCAAGG - Intergenic
957924014 3:86785318-86785340 GAAGTTAAACAACTTGTACAAGG + Intergenic
958014411 3:87921773-87921795 TATGGTAAACAAGTTGTTCATGG - Intergenic
958735498 3:98004380-98004402 GAGATTAAGCAACTTGTCCAAGG + Intronic
958774839 3:98469596-98469618 GAGGATAAACTCATTTTTCATGG - Exonic
958777015 3:98497700-98497722 GAGGATAAACTCATTTTTCATGG - Exonic
958792890 3:98672032-98672054 GAGAGTAAACAACTTGTCCAAGG - Intergenic
958891426 3:99787672-99787694 GAAGATAAAGGACTTGTCCAAGG + Intronic
959086332 3:101854234-101854256 GAGGTTAAATAACTTGCCCAAGG - Intronic
959140918 3:102486151-102486173 CAGGATAAACAACTTGATATGGG + Intergenic
960171816 3:114471311-114471333 GATGGTAAATAACTAGTTCAAGG + Intronic
960193991 3:114742609-114742631 GAGATTAAATAACTTGTCCAAGG + Intronic
960639754 3:119813959-119813981 AAGGATAAGAAACTTGTACAAGG + Intronic
960719764 3:120614424-120614446 GAGGTTAAGTAACTGGTTCAGGG + Intergenic
960903443 3:122574627-122574649 GAGGATAAGCAACTTGCCAAAGG + Exonic
961222022 3:125208607-125208629 GAGGTTACGAAACTTGTTCAAGG + Intronic
961295781 3:125883170-125883192 GAGGGTAAGTAACTTGGTCAAGG - Intergenic
961890021 3:130122997-130123019 GAGGGTAAGTAACTTGGTCAAGG + Intergenic
961905173 3:130255663-130255685 GAAGTTAAATAACTTGCTCAAGG + Intergenic
961945267 3:130680310-130680332 GAAGTTAAGTAACTTGTTCAAGG - Intronic
962145748 3:132837809-132837831 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
962459797 3:135599787-135599809 GAGGTTAATGAACTTGCTCAAGG - Intergenic
962627884 3:137245146-137245168 GAGGTTAAGCATCCTGTTCAAGG - Intergenic
962814258 3:138984275-138984297 GAGTGTAAACAACTTGCCCAAGG - Intergenic
962869346 3:139474697-139474719 AAGGTTAAAAAACTGGTTCACGG + Intronic
963238076 3:142974886-142974908 GAGGCTAAACAACTTGCCCGAGG - Intronic
963262603 3:143207827-143207849 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
963712246 3:148759749-148759771 GAGGCTAATCAACTTTTTCATGG - Intergenic
963930100 3:150995105-150995127 GAAGTTAAGCAACTTGTTCAAGG - Intergenic
964016582 3:151954611-151954633 CATGATAAACATGTTGTTCAGGG + Intergenic
964108071 3:153060247-153060269 CAGGATAAACAACTTGGCCTAGG - Intergenic
964121844 3:153193467-153193489 GAGGTTAAATAACTTGCCCAAGG + Intergenic
964292578 3:155197904-155197926 GAAGATGAATAACTTGCTCAAGG - Intergenic
964671776 3:159234144-159234166 GAGAATAAGTAACTTGTCCAAGG - Intronic
964760363 3:160129925-160129947 GAGGTTAAATGACTTGCTCAAGG - Intergenic
964841568 3:160999235-160999257 GAGGTTAAGTAACTTGCTCAAGG + Intronic
964850050 3:161086333-161086355 GAGGATGAACACCTTCTTTATGG - Exonic
964980949 3:162678118-162678140 GAGGCTAAACAACTTGCTAAAGG + Intergenic
965629138 3:170712771-170712793 GGGGTTACATAACTTGTTCAAGG + Intronic
965638491 3:170808697-170808719 GAGGTTAAATAACTTGCCCAAGG - Intronic
965984020 3:174729376-174729398 GAGACTAAGCAACTTGCTCAAGG + Intronic
966042679 3:175510669-175510691 GAAGTTAAAGAACTTATTCAAGG + Intronic
966044991 3:175537142-175537164 GAAAATATATAACTTGTTCAAGG + Intronic
966219163 3:177533459-177533481 GAGGCTCAGCAACTTGCTCATGG - Intergenic
966476917 3:180359625-180359647 AAAGATAAGTAACTTGTTCAAGG - Intergenic
966635057 3:182123823-182123845 AAGGATAAGCAACTTGCCCAAGG + Intergenic
966677555 3:182605628-182605650 GAGGCTAAATTATTTGTTCAGGG + Intergenic
966902920 3:184500038-184500060 GAGCATAAAGAACTCGTACATGG + Intronic
966966227 3:184997308-184997330 GAGGTTAAATAACTTGTCCAAGG - Intronic
966984723 3:185168720-185168742 GAGGTTAAGGAACTTGTCCAAGG + Intergenic
967138689 3:186534307-186534329 GAGGCTAAACAACTTGTCTGAGG - Intergenic
967173268 3:186840663-186840685 GAGGGTAAATAATTTGTTCAAGG - Intergenic
967292944 3:187939201-187939223 AAGGTTAAGCAACTTGTCCACGG + Intergenic
967328749 3:188268953-188268975 GAAGATAAATAACTTGCTCAAGG + Intronic
967341212 3:188400342-188400364 GAGGTTGAATAACTTGCTCAAGG - Intronic
967355615 3:188567242-188567264 GAGGTTAAGGAACTTGTTCAAGG - Intronic
967601000 3:191389320-191389342 GAAGATAAATAATTTATTCAAGG + Intronic
967775085 3:193377911-193377933 GAGGTTAAATAACTTGCCCAAGG - Intronic
968007945 3:195255750-195255772 GAGGCCAAGCAACTTGCTCAGGG - Intronic
968401101 4:298494-298516 GAAGATAAATGACTTATTCAGGG - Intronic
969087677 4:4668558-4668580 GAGGTTAAATAACCTGTCCAAGG - Intergenic
969090003 4:4686568-4686590 GAGGTTAAGCAACTTGTTCAAGG + Intergenic
969194433 4:5549358-5549380 GAGGTTGAAGAACTTGTCCAGGG + Intronic
969201119 4:5606894-5606916 AAGGTTAAATAACTTGCTCAAGG + Intronic
969260845 4:6032447-6032469 GAAGGTAAGCAACTTGTCCAAGG - Intronic
969261082 4:6034288-6034310 GAGGTTAAATAATTTGTCCAAGG + Intronic
969396664 4:6926040-6926062 GAGGTGAAGGAACTTGTTCAAGG - Intronic
969428234 4:7138291-7138313 GAGGCTAAGAAACTTGTCCAAGG - Intergenic
969587082 4:8100359-8100381 GAGGGTAAGTAACTTGGTCAAGG - Intronic
969753521 4:9131692-9131714 GAGGGTAAGTAACTTGTTCAAGG - Intergenic
969813424 4:9667875-9667897 GAGGGTAAGTAACTTGGTCAAGG - Intergenic
970231708 4:13917497-13917519 GAGATTAAATAACTTGTCCAAGG - Intergenic
970450123 4:16157931-16157953 AAGGTTAAGTAACTTGTTCAGGG - Intergenic
970484583 4:16511728-16511750 GAGGTAAAATAACGTGTTCAAGG - Intronic
970661919 4:18294795-18294817 AAGAATAAACATCTTGTTAATGG + Intergenic
970790183 4:19849035-19849057 GAGGCTAAATAACTTGCCCAAGG + Intergenic
970809625 4:20077268-20077290 AAGGTTAAACAACTTATCCAAGG + Intergenic
970842677 4:20493659-20493681 GAGGATAAGTAACTTGTCCATGG - Intronic
970848702 4:20575480-20575502 AACGATAAACCACTTATTCAAGG + Intronic
970930901 4:21510616-21510638 GAGTATCATCAACTTGTTAATGG - Intronic
971263784 4:25080311-25080333 GAGGTTAAAGAACTTACTCAAGG + Intergenic
971340147 4:25760920-25760942 GTGGTTAAACAACTTGCCCAAGG + Intronic
971358403 4:25914568-25914590 GAGGTTGAGCAACTTGTCCACGG - Intronic
971496476 4:27271331-27271353 GAGGATAAATAGCTTGCTCAAGG + Intergenic
971626634 4:28928999-28929021 GAGGATAAAGCACTTCTTCTTGG + Intergenic
972031339 4:34462695-34462717 GAGGCTAAGTGACTTGTTCAAGG - Intergenic
972294899 4:37728285-37728307 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
972366553 4:38380996-38381018 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
972388490 4:38590567-38590589 GAGATTAAATAACTTGCTCATGG - Intergenic
972392228 4:38624383-38624405 GAGGCTAAGTAACTTGTCCAAGG + Intergenic
972428522 4:38958251-38958273 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
973264344 4:48196364-48196386 GAGGTTAAGTAACTTGTTCAAGG - Intronic
973541900 4:51943140-51943162 GAGGATAAATAACTTGATGAAGG + Intergenic
973604661 4:52574664-52574686 GAAGTTAAATAACTTGTCCAAGG + Intergenic
973725881 4:53775149-53775171 GAGGAAGAGTAACTTGTTCAAGG - Intronic
973832370 4:54774454-54774476 GGAGTTAAACAACTTGCTCAAGG + Intergenic
974047775 4:56911664-56911686 GAGGTTAAACAACTTGTGCAAGG - Intronic
974103683 4:57444018-57444040 GAGGTTAAACAATTTGCTCCAGG + Intergenic
974580165 4:63788157-63788179 GAGGTTGAAGAATTTGTTCAGGG - Intergenic
974828278 4:67156792-67156814 GAGGTTAAGCTACTTGTTCAAGG - Intergenic
975110694 4:70619862-70619884 GAAGTTAAATAAGTTGTTCAAGG - Intergenic
975211560 4:71706553-71706575 GAGGTCATATAACTTGTTCAAGG - Intergenic
975278843 4:72536633-72536655 AAGGTTAAATAACTTGCTCAAGG + Intronic
975340901 4:73238874-73238896 AAGAATAAGTAACTTGTTCAAGG - Intronic
975382795 4:73721746-73721768 GAGGATATGCAGCTTGTTCAAGG - Intergenic
975434484 4:74335177-74335199 GAGAATAAACAAATTTTACAAGG + Intergenic
975796838 4:78015015-78015037 AAGGGTAAACAACTCTTTCATGG - Intergenic
975822487 4:78286105-78286127 GAGATTAAACAACTTGCCCATGG - Intronic
975919312 4:79365343-79365365 GAGGTTAAGTAACTTATTCAAGG - Intergenic
976341579 4:83951671-83951693 GAAGATAAATGACTTGCTCAAGG + Intergenic
976383409 4:84426965-84426987 GAGGTTAAGTAACTTGTTGAAGG - Intergenic
976406081 4:84661564-84661586 AAAGAAAAACAACTTGTTTAGGG - Intergenic
976580965 4:86736777-86736799 GAAGTTAAACACATTGTTCAAGG - Intronic
976644776 4:87375956-87375978 GAGGTTAAGTAACTTGGTCAAGG - Intronic
976704901 4:88009448-88009470 GAGGATAAGTAACTTGCTCAAGG - Intronic
976855200 4:89596247-89596269 GGAGATAAGCAACTTATTCAAGG + Intergenic
977094626 4:92724666-92724688 GAGGTTAAGTAACTTGTTCAAGG - Intronic
977282827 4:95063484-95063506 GAAGATAAATAACTTGCTCGAGG + Intronic
977864626 4:102009643-102009665 GGGGTTAAATAACTTGTCCAAGG - Intronic
978057702 4:104292934-104292956 GAAGAGAAACAACTTAGTCAAGG + Intergenic
978120037 4:105067459-105067481 GAGGCTAAGTAACTTGTCCAAGG - Intergenic
978277425 4:106968376-106968398 CAGGATAATCAACTTGCTTAAGG + Intronic
978562851 4:110051914-110051936 GAGGATAACTAACTTGTCCAGGG - Intronic
978711840 4:111791724-111791746 GAGGTTAAATAACATGTACAAGG - Intergenic
979101817 4:116626548-116626570 GATGATAGATAACTTGCTCAGGG + Intergenic
979238058 4:118423935-118423957 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
979341393 4:119528614-119528636 GAGATTGAACATCTTGTTCAGGG - Intronic
979474973 4:121144904-121144926 AAAGTTAAATAACTTGTTCAAGG + Intronic
979785183 4:124708771-124708793 GAGGCTAAATAAATTGTTCAAGG - Intronic
980212460 4:129807498-129807520 GTGGATAAATAACTTGAACAGGG + Intergenic
980938439 4:139248979-139249001 GAGGATATATGATTTGTTCAAGG + Intergenic
981079976 4:140629997-140630019 GAGGTTAAGTAATTTGTTCAAGG + Intronic
981431517 4:144666825-144666847 GAGGTTAAACAACTTGCCCAAGG - Intronic
981714921 4:147743430-147743452 GAAGTTAAACAACTTGCCCAAGG - Intronic
981780033 4:148418831-148418853 GAGGATAGGTAACTTGCTCAAGG + Intronic
981888705 4:149711193-149711215 GAAGAAAAGCAACTTGCTCAAGG + Intergenic
982057460 4:151566873-151566895 GAGGTTAAATAACTTGCTTAAGG + Intronic
982156148 4:152522832-152522854 GAGGTTAAACAACTTGCCAAAGG + Intronic
982165167 4:152607611-152607633 GAGGTTAAGCAACTTGCTGAGGG - Intergenic
982208201 4:153013176-153013198 GAAGATAATCAACTTATTCAAGG - Intergenic
982305499 4:153926378-153926400 GAGGCTAAATGACTTGTCCAAGG - Intergenic
982533937 4:156584963-156584985 GAAGATAAGTAACTGGTTCAGGG - Intergenic
982798839 4:159676984-159677006 GAGATTAAATAAGTTGTTCAAGG - Intergenic
982803338 4:159731839-159731861 GAGGTTAAATAACTTGTCCAGGG + Intergenic
982956793 4:161779561-161779583 GATGTGAAATAACTTGTTCAAGG + Intronic
983221890 4:165051855-165051877 GATTATAAATTACTTGTTCAAGG + Intergenic
983402549 4:167283720-167283742 GAAGACAAACTACTTATTCATGG - Intergenic
983573615 4:169236526-169236548 GAGGTTACATAACTTGTTTAAGG - Intronic
983961910 4:173764169-173764191 GAGGTTAAGTAACTTGTTCCAGG - Intergenic
983992308 4:174135409-174135431 GAGGTAAAATAATTTGTTCAAGG + Intergenic
984539055 4:181014300-181014322 GAGTTTAAACAACTTGTCCAAGG - Intergenic
984897544 4:184554923-184554945 GAGAATAAACAAACTGTTCATGG + Intergenic
985031264 4:185792911-185792933 GAAGTTAAACAACTTGCACAGGG - Intronic
985773857 5:1830141-1830163 GAGGACAATCAACATCTTCAAGG - Intergenic
985949060 5:3209500-3209522 TAGGATAAAGGACTTGTCCAGGG - Intergenic
986470670 5:8071225-8071247 GAGGTTAAGCAAGTTGTCCAAGG + Intergenic
986627620 5:9737348-9737370 GAAGTTAAATAACTTGTCCAAGG - Intergenic
986970460 5:13329415-13329437 GAGGAAAAACAACTTATTATAGG + Intergenic
987258610 5:16180948-16180970 AAGGCAAAATAACTTGTTCAAGG + Intergenic
987298052 5:16571615-16571637 GAAGAAAAACAACTAATTCAGGG - Intronic
987711731 5:21509470-21509492 AAGATTAAACAACTTGTTGAGGG - Intergenic
987968195 5:24904883-24904905 GAGGAGAAGCAAATTGTTCTTGG + Intergenic
988167319 5:27610781-27610803 GAGGGTAAGCAATTTGTCCAAGG + Intergenic
988302683 5:29451346-29451368 GAGATTAAACAACTTGTTGAGGG + Intergenic
988352022 5:30120853-30120875 GAGGAAAAACTACTTGATAAGGG + Intergenic
988901153 5:35733859-35733881 GAGGTTAAACAGCTTGTACAAGG - Intronic
989111490 5:37910728-37910750 GAGGCTAAGTAACTTGCTCAAGG + Intergenic
989128348 5:38078935-38078957 GAGGTTAAGTAACTTGTTCATGG + Intergenic
989162227 5:38402338-38402360 GAGATTAAATAACTTGCTCAAGG - Intronic
989641732 5:43589540-43589562 GAGGATAAACAAATGATTCTGGG + Intergenic
989651958 5:43700340-43700362 GATGAAAAAGAACTTGTACATGG + Intronic
990020858 5:51125713-51125735 GAGGTTAAATAACTTGTCCAAGG - Intergenic
990178216 5:53130884-53130906 GAGGATAAACAACTCCATGAGGG - Intergenic
990337779 5:54792146-54792168 GAGGCCAAGTAACTTGTTCAAGG - Intergenic
990675889 5:58184193-58184215 GAGCATGAACAACATGTGCAAGG + Intergenic
990943253 5:61225499-61225521 GAGAATAGACAACTCTTTCAAGG - Intergenic
991110902 5:62897979-62898001 GAGGATAAGCAAATTGCCCAAGG - Intergenic
991188015 5:63833598-63833620 GAGGAAAAAAAACTTTTTCTGGG + Intergenic
991254550 5:64599806-64599828 GAAGTTAAACAACTTGTTCCAGG - Intronic
991412789 5:66361544-66361566 GAGGTTAAACAACTGGCTCTGGG + Intergenic
991497304 5:67239194-67239216 GAAATTAAACAACTTGTGCAAGG + Intergenic
991515561 5:67431318-67431340 GAGGATAAATAACTTGCTCGAGG + Intergenic
991614117 5:68478333-68478355 GAGGTTAAATAACTTGTTCAGGG + Intergenic
991762097 5:69928596-69928618 AAGATTAAACAACTTGTTGAGGG - Intergenic
991785231 5:70189504-70189526 AAGATTAAACAACTTGTTGAGGG + Intergenic
991841325 5:70803645-70803667 AAGATTAAACAACTTGTTGAGGG - Intergenic
991877677 5:71189907-71189929 AAGATTAAACAACTTGTTGAGGG + Intergenic
992365962 5:76089799-76089821 GAGGTTAAGAAACTTGTTCATGG - Intronic
992495428 5:77288528-77288550 GAGAATAAATAAATTGTCCAGGG + Intronic
992548195 5:77836165-77836187 GAGGTGAAGCAACTTGTCCAGGG + Intronic
992562208 5:77963984-77964006 GAGGATAAGCGACTTGCCCAAGG - Intergenic
992661152 5:78962143-78962165 GAAGTTAAGTAACTTGTTCAAGG - Intronic
992810245 5:80380162-80380184 CAGAATAAAGAAATTGTTCAAGG + Intergenic
992887528 5:81173630-81173652 GAGGTTAAGTAACTTGTTTAAGG - Intronic
993225125 5:85159966-85159988 GAGGTTTAACAACTTGCCCAAGG + Intergenic
993418742 5:87672468-87672490 AAGGCCAAACAACTTATTCAAGG + Intergenic
993566563 5:89483311-89483333 GAGGATAAATGACTTGACCAAGG - Intergenic
993604228 5:89968252-89968274 GAAGATGAACAATTTGTCCAAGG - Intergenic
993650925 5:90521158-90521180 GAGGTTAAACAACTTGCCCCAGG - Intronic
993661211 5:90637160-90637182 GAGGTTAAGTAACTTGCTCAAGG + Intronic
993881295 5:93364783-93364805 GAAGCTAAGCAACTTGTCCAGGG - Intergenic
993992355 5:94674934-94674956 GAGTTTAAATAACTTATTCAAGG + Intronic
994176484 5:96717594-96717616 GAGGTTAAGCAACTTGCTCAAGG + Intronic
994650189 5:102517743-102517765 GAGGATAGGTCACTTGTTCAAGG - Intergenic
994732770 5:103513289-103513311 GAGGATAAATGACTTGTCCAAGG - Intergenic
994759447 5:103834742-103834764 GAGGTTAAACAACTTGTCCATGG + Intergenic
994792773 5:104252019-104252041 GAAATTAAACAACATGTTCATGG - Intergenic
995007641 5:107219466-107219488 GAGGTTAAATAACTTTTCCAAGG - Intergenic
995132010 5:108640785-108640807 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
995619678 5:114010778-114010800 GAGGCTAAATGACTTGCTCAAGG - Intergenic
996156196 5:120105242-120105264 GAGGATAAGTAACTTGTCCATGG - Intergenic
996808655 5:127488575-127488597 GAGGCTAAAGAACTTATCCAAGG + Intergenic
997280873 5:132644445-132644467 CAGGACAAATAACTTGCTCAAGG - Exonic
997404801 5:133636936-133636958 GAGGTTAGGCAACTTATTCATGG + Intergenic
997593982 5:135094199-135094221 GAGGTTAAACAACTTGCTTAAGG - Intronic
997619168 5:135273532-135273554 GAGGTTAAGCAAGTTGCTCAGGG - Intronic
997659757 5:135580159-135580181 GAGAAGAAATAACTTGTCCAAGG + Intergenic
997679380 5:135738587-135738609 GAGCAGAAGCAACTTGTGCAAGG - Intergenic
997803525 5:136890499-136890521 GAGGTTAAATAACTTGCCCAAGG - Intergenic
997883214 5:137609121-137609143 GAGGTTAAACAGCTTGCACAGGG - Intergenic
998077080 5:139245695-139245717 GAGGTTAAGTAACTTGTCCAAGG - Intronic
998371717 5:141666222-141666244 GAGGTTAAATAACTTGTCCAGGG + Intronic
998629799 5:143885360-143885382 GAGGTTAAACCATTTGTCCAAGG + Intergenic
998693014 5:144608354-144608376 GAGGTTAAAGGACTTGCTCAAGG - Intergenic
998769661 5:145527720-145527742 GAAGTTAAACAACTTGCTGAAGG - Intronic
998785889 5:145708349-145708371 GAGGTTAAGCAACTTGCTTAAGG - Intronic
998882068 5:146654746-146654768 GAGGTTAAGCACCTTGTCCATGG + Intronic
998901327 5:146858160-146858182 GAGGTTAAATAACTTGCCCAAGG + Intronic
999034749 5:148334873-148334895 GCGGATAAATAGCTTGTACAAGG + Intronic
999060941 5:148634427-148634449 GAGGTTGAATAACTTGTTCAAGG - Intronic
999062941 5:148654576-148654598 GAGGCTAACCAACTTGTCCAAGG - Intronic
999220312 5:149970792-149970814 GAGGATAAATATATTATTCAAGG + Intronic
999272508 5:150304844-150304866 GAGGTGAAATAACTTGTGCAAGG - Intronic
999371138 5:151056122-151056144 GAGGATAAGTGACTTGTCCAAGG + Intronic
999537553 5:152533972-152533994 GAGAATAATTAATTTGTTCAAGG + Intergenic
999642982 5:153690394-153690416 GAGGCTAAATAATGTGTTCAAGG - Intronic
999828223 5:155294427-155294449 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
999989708 5:157038477-157038499 GAGGCTAAATAGCTTGTCCATGG - Intronic
1000039008 5:157471226-157471248 GAGGTTAAGCAACTTGGCCAGGG - Intronic
1000126975 5:158255033-158255055 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1000298886 5:159937339-159937361 GAGTTTAAACAACTTGCCCAGGG + Intronic
1000322009 5:160141953-160141975 GAGGTTAAATAACTTGCTCAAGG + Intergenic
1000440567 5:161258458-161258480 GAGGTTCAGAAACTTGTTCAAGG - Intergenic
1000462060 5:161535596-161535618 GAGGTTAAATGATTTGTTCAAGG - Intronic
1000484185 5:161819092-161819114 GTGGATAAGCAACTTGTCCATGG - Intergenic
1000815232 5:165912915-165912937 GAGGATGAGGAACTTGCTCAAGG - Intergenic
1000942053 5:167373765-167373787 GAGGTTAAACACCATGTCCAAGG - Intronic
1000981142 5:167818556-167818578 GAGGATGAACAACTTTCCCAAGG + Intronic
1001134873 5:169094258-169094280 GAAGTTAAACGACTTGTCCAAGG + Intronic
1001143698 5:169166040-169166062 GAGGTTAAATAACTTGCCCAAGG + Intronic
1001309530 5:170601008-170601030 GAGGCTAAGTGACTTGTTCAAGG - Intronic
1001378809 5:171288579-171288601 GCAAATAAATAACTTGTTCAAGG - Intronic
1001966924 5:175916534-175916556 GAGGAGAAATAATTTGTGCAGGG - Intergenic
1001971036 5:175955141-175955163 GAGGTTAGAGAACTTGTCCAGGG - Intronic
1002202775 5:177539836-177539858 GAAGTTAAATAACTTGCTCAAGG - Intronic
1002246406 5:177888636-177888658 GAGGTTAGAGAACTTGTCCAGGG + Intergenic
1002250020 5:177922672-177922694 GAGGAGAAATAATTTGTCCAGGG + Intergenic
1002327085 5:178416703-178416725 GAGATTAAATAACTTGTCCAAGG + Intronic
1002738486 5:181415911-181415933 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1003020225 6:2503075-2503097 GAGCTTCAATAACTTGTTCAAGG + Intergenic
1003970857 6:11297812-11297834 GAGGGTTAATAACTTGTTCAAGG + Intronic
1004211127 6:13645615-13645637 AAGGTTAAATAACTTGCTCATGG + Intronic
1004289911 6:14357263-14357285 AGGGTTAAATAACTTGTTCAAGG + Intergenic
1004443802 6:15678971-15678993 GAGGTTAAGTAACTTGTTTAAGG + Intergenic
1004462307 6:15849033-15849055 GAGGAAAAGAAACTTCTTCAAGG + Intergenic
1004548194 6:16619935-16619957 GAGGATAAGCAACTTGCCCAAGG - Intronic
1004962101 6:20801249-20801271 GAGGATAGAAAATTTCTTCAGGG - Intronic
1004990165 6:21127928-21127950 GAAAATAAATAACTTATTCAGGG - Intronic
1005107869 6:22245002-22245024 GTGACTAAACAATTTGTTCAAGG - Intergenic
1005404473 6:25471528-25471550 AAGCGTAAACAACTTGTGCAAGG - Intronic
1006028129 6:31160306-31160328 GAGGTTAAGGAACTTGTCCAGGG + Intronic
1006231535 6:32591620-32591642 GAGTTTAAACAACTTTTGCAAGG + Intergenic
1006316401 6:33294346-33294368 GAGGATAAGGAACTTGTCCAAGG + Intronic
1006643313 6:35499388-35499410 GAGGTTAAGCAACTTGCCCACGG - Intronic
1006743586 6:36325934-36325956 GAGGTAAAACAATGTGTTCAAGG - Intronic
1006743826 6:36327403-36327425 GAGGTTAAGAAACTTATTCAAGG - Intronic
1006864644 6:37199578-37199600 GAGGTTAAGCAACTTATTCAAGG - Intergenic
1006901635 6:37506341-37506363 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1006928850 6:37675249-37675271 GAGGTTAAACAACTTTCCCAAGG - Intronic
1006988907 6:38196228-38196250 GAGGCTAAGCAACTTGCTTAAGG - Intronic
1007276402 6:40677490-40677512 GAGGCTAATTAACTTGTCCAAGG + Intergenic
1007529369 6:42527397-42527419 GAGGTTAAGTAACTTGTACAAGG + Intergenic
1007569499 6:42879398-42879420 GGGGTTAAATAACGTGTTCAAGG + Intergenic
1007605065 6:43112022-43112044 AAGGATAAACAGCTTGTCCAAGG + Intronic
1007758748 6:44119060-44119082 GAGGTTAAATAACTTGCCCAAGG + Intronic
1007766458 6:44163195-44163217 GAGGTCAAACAACTTGCCCAAGG + Intronic
1008161858 6:48087620-48087642 GAGGATAAATAACTTTCTTAAGG + Intergenic
1008713241 6:54255281-54255303 GAGGTAGAATAACTTGTTCAAGG - Intronic
1008724846 6:54404915-54404937 AAGGTTAAATGACTTGTTCAAGG + Intergenic
1008918347 6:56815051-56815073 GAGGATAAGCGACTTGCCCACGG - Intronic
1008937351 6:57006122-57006144 GTGGTTAAACAACTTGCACAAGG - Intronic
1009005968 6:57787216-57787238 AAGATTAAACAACTTGTTGAGGG + Intergenic
1009035433 6:58112231-58112253 GAAGTTAAATAATTTGTTCAAGG - Intergenic
1009719319 6:67445783-67445805 GAGGATAGACAATTTATTTAAGG - Intergenic
1010019329 6:71140876-71140898 GAAAATAAACAACATGTTCCTGG + Intergenic
1010418712 6:75646393-75646415 AAGGTTAATCAACTTGTCCATGG - Intronic
1010437706 6:75853977-75853999 GAGAATAAGTAACTTATTCAAGG + Intronic
1011004727 6:82631403-82631425 GAGGATAACCAAGTTGTCCAAGG + Intergenic
1011563027 6:88642685-88642707 GAGGTTAAATAACTTGCCCATGG - Intronic
1011759950 6:90552909-90552931 GAGGTTAAATAACTTGCTTAAGG - Intronic
1011774947 6:90719391-90719413 GAGGTTAAACAACTTGTAAGTGG + Intergenic
1012050726 6:94340489-94340511 GAGATTAAACAACTTGATGAAGG + Intergenic
1012177630 6:96108371-96108393 GAGGTTAAGCAATTTGTCCAAGG - Intronic
1012301787 6:97598419-97598441 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1012303890 6:97626095-97626117 GAAGTTAAATAACTTGCTCAAGG + Intergenic
1012592708 6:101002214-101002236 GAGGTTAATTAACTTGCTCAAGG + Intergenic
1012805692 6:103890169-103890191 GAAGATAAACTATTTATTCATGG - Intergenic
1012877686 6:104747670-104747692 GAAGATATGGAACTTGTTCATGG - Intronic
1012974112 6:105761376-105761398 GAGGAAATAAAATTTGTTCATGG + Intergenic
1013363890 6:109420550-109420572 GATAAAAAATAACTTGTTCATGG - Intronic
1013432856 6:110070785-110070807 GAGGCTAAATGACTTGTCCAAGG + Intergenic
1013548833 6:111187302-111187324 GTGGCGAAACAACTTGCTCAGGG + Intronic
1013599127 6:111687855-111687877 CAGGTTAAGCAACTTGTTCAAGG + Intronic
1013758836 6:113492700-113492722 GATGATAAACAACTAGCACACGG - Intergenic
1013864135 6:114674112-114674134 CAGGTTAAATAATTTGTTCAAGG - Intergenic
1013876071 6:114830367-114830389 GAGGTTAAGCAACCTGTCCAAGG + Intergenic
1014641451 6:123915690-123915712 GTAGATAAACAAGTTCTTCAGGG + Intronic
1015152701 6:130056460-130056482 GAGGAGAAGCACCTGGTTCATGG - Intronic
1015457868 6:133449630-133449652 GAGCTTAAGTAACTTGTTCAAGG - Intronic
1015906367 6:138121464-138121486 GAAGTTAAACAACATGTCCAAGG + Intergenic
1016806478 6:148217245-148217267 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1017452975 6:154571655-154571677 GAGGTTAAATGACTTGCTCAAGG - Intergenic
1018354434 6:162997987-162998009 GAGGCTAAGTAACTTGTTTAAGG - Intronic
1019092687 6:169552559-169552581 GAGGTGAAATCACTTGTTCAAGG + Intronic
1019243589 6:170691463-170691485 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1019376941 7:697735-697757 GAGGGTAAAGGATTTGTTCAGGG + Intronic
1020437721 7:8183610-8183632 AAGGTTAAATAACTTGCTCAGGG - Intronic
1021491554 7:21224770-21224792 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1021512086 7:21444480-21444502 GAGGTTAAATAATTTGCTCATGG + Intronic
1021596959 7:22327654-22327676 GAAGTTAAATAACTTGTCCAAGG - Intronic
1021670789 7:23032994-23033016 GAAGTTAACCAACTTGATCAAGG + Intergenic
1021993240 7:26156113-26156135 AAGGATAAGCAACTTGTCCAAGG - Intronic
1022012121 7:26317367-26317389 GAGGTAAAGTAACTTGTTCAAGG - Intronic
1022012277 7:26318930-26318952 GAGGTTAAGTAACTTGTTCAAGG + Intronic
1022056276 7:26738174-26738196 GAGGTTAAGTGACTTGTTCAAGG - Intronic
1022194040 7:28046258-28046280 GAAGTTAAGCAACTTGCTCAAGG + Intronic
1022424488 7:30255350-30255372 GAAGACAAACCACTTGGTCAAGG + Intergenic
1022622846 7:32002422-32002444 GAGGATCAATAACTTGCCCAAGG - Intronic
1022660686 7:32363997-32364019 GAGGCTGAATAACTTGCTCAAGG + Intergenic
1022841386 7:34167303-34167325 AAGATTAAGCAACTTGTTCAAGG - Intergenic
1022884130 7:34624279-34624301 GAGATTAAATAATTTGTTCAAGG - Intergenic
1023012886 7:35939254-35939276 GAGGCTAAATAACTTGCCCAAGG - Intergenic
1023186097 7:37534714-37534736 GAGGTTAAATCACTTGTCCAAGG + Intergenic
1023411448 7:39892724-39892746 GAGGTTAAGCAACTAGTCCAAGG + Intergenic
1024078246 7:45834598-45834620 GAGGCTAAATAACTTGCCCAAGG + Intergenic
1024232231 7:47371382-47371404 GAGAATAAATAACTTGCCCAAGG + Intronic
1024624235 7:51190619-51190641 AAGGATAAAGGACATGTTCAGGG + Intronic
1024676138 7:51639339-51639361 GATGTTAAACAACTGGTACAAGG + Intergenic
1025205718 7:56992402-56992424 GAGGAAAAACCACTTGGGCAGGG - Intergenic
1025249089 7:57339828-57339850 GAGGTTAAGTAACTTGTGCAAGG - Intergenic
1025666222 7:63584536-63584558 GAGGAAAAACCACTTGGGCAGGG + Intergenic
1025719280 7:63995319-63995341 GAGAGTAAACAACATGTTCCTGG + Intergenic
1026030062 7:66784362-66784384 GAGGATAAGTGACTTGTCCAAGG + Intronic
1026198282 7:68191992-68192014 GAGGTTAAACAAATTGATCAAGG - Intergenic
1026374532 7:69737394-69737416 GAGGTTAGATAACTTGCTCAAGG + Intronic
1026418292 7:70206062-70206084 GAGGTTAAATAACTTGTTGTAGG + Intronic
1027207858 7:76117183-76117205 GAGGATAAGTGACTTGTCCAAGG - Intergenic
1027414832 7:77963850-77963872 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1027422123 7:78027026-78027048 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1027508327 7:79046619-79046641 GAGTTTACAAAACTTGTTCAAGG + Intronic
1027759470 7:82259821-82259843 GAGGTTAAGTAACTTGTTCAAGG - Intronic
1028551516 7:92072920-92072942 GAAGTTAAATAACTTGATCATGG + Intronic
1028610663 7:92707289-92707311 GAGGCTAAAGAACTTATTTAAGG + Intronic
1028845143 7:95471907-95471929 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1028995817 7:97098759-97098781 GAGGTTAAACAACTAGCCCAAGG + Intergenic
1029063118 7:97819280-97819302 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1029199768 7:98831048-98831070 GAGGTTTAGTAACTTGTTCAAGG - Intergenic
1029275948 7:99404416-99404438 GAGGCTAAACAACGTCTCCAGGG + Intronic
1029371976 7:100156086-100156108 GAGGTTAAGTAACTTATTCAAGG + Intronic
1029581790 7:101441179-101441201 GAGGTTAAGCAACTTTGTCAAGG - Intronic
1029896848 7:103991593-103991615 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1030108055 7:106003542-106003564 CAGGTCAAACAATTTGTTCAAGG + Intronic
1030130638 7:106196595-106196617 GAGGTTAAGGAACTTGTCCAGGG + Intergenic
1030221843 7:107106383-107106405 GAGGATAAACAAATGATTCTGGG - Intronic
1030511048 7:110482213-110482235 GAGGAGAGAGAACTTGTACAGGG + Intergenic
1030665937 7:112278644-112278666 AAGGTTAAATAACTTGGTCAGGG + Intronic
1030880605 7:114873874-114873896 GAGGAAAAACAAGATGGTCATGG - Intergenic
1030916418 7:115319766-115319788 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1031526257 7:122824259-122824281 GAGGATAAGGATCTTGTGCAAGG + Intronic
1031883585 7:127222772-127222794 GAAGTTAAATAACTTGATCAAGG + Intronic
1032536356 7:132667943-132667965 GAAGTAAATCAACTTGTTCAAGG + Intronic
1032642748 7:133787889-133787911 AAGGTTAAATAACTTATTCAAGG + Intronic
1032854054 7:135819454-135819476 GATGATAAAAACCTTGCTCATGG - Intergenic
1032917396 7:136507720-136507742 GTGAATAAAGAACTTGTTGAAGG + Intergenic
1033314001 7:140283034-140283056 GAGGTGAAATTACTTGTTCAAGG + Intergenic
1033356000 7:140600966-140600988 GAGGTTAGATAACTTGTTTAAGG + Intronic
1033671049 7:143493480-143493502 GAGGATGAACAACTGTATCAAGG - Intergenic
1033730375 7:144172141-144172163 GAGAAGAGACAGCTTGTTCAGGG - Intergenic
1033778285 7:144638677-144638699 GAGATTAAATAACTTGTCCAAGG + Intronic
1033888388 7:145977036-145977058 GCGGATAAACAACTTCAGCAAGG - Intergenic
1034095065 7:148400148-148400170 GAGGTTCAGCAACTTTTTCAAGG + Intronic
1034111921 7:148545373-148545395 GAGGTAAAGCAACTTGATCAAGG - Intergenic
1034213234 7:149383199-149383221 GAGGTTAGATAACTTGTTTAAGG + Intergenic
1034522344 7:151630550-151630572 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1035193491 7:157194137-157194159 GGGGTAAAACAACTTTTTCATGG - Intronic
1035504533 8:116697-116719 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
1036091367 8:5669123-5669145 GAGCCTAAAGAACTTGCTCAAGG + Intergenic
1036166830 8:6443170-6443192 GAGGTCAAACAGCTTGTCCAAGG + Intronic
1036376742 8:8207024-8207046 GAGGGTAAGTAACTTGGTCAAGG - Intergenic
1036852794 8:12216114-12216136 GAGGGTAAGTAACTTGGTCAAGG + Intergenic
1036874165 8:12458636-12458658 GAGGGTAAGTAACTTGGTCAAGG + Intergenic
1037375382 8:18221767-18221789 AATGATAAACAGCTTGTTCATGG - Intronic
1037438336 8:18888440-18888462 GAGGTTAAATAACTTGCTCAAGG - Intronic
1037625114 8:20599883-20599905 GAGCATAAATGACTTGTCCAAGG + Intergenic
1037670896 8:21014572-21014594 GAGGCTAAGGAACTTGTCCAAGG - Intergenic
1037818255 8:22123299-22123321 GAGGATAAGCGACTCGTCCAAGG - Intronic
1037934141 8:22903268-22903290 TAGGTTAAGCAACTTGTCCAAGG - Intronic
1038007654 8:23446655-23446677 AAGGATAATCAACTTGTTGAGGG + Intronic
1038219158 8:25591407-25591429 GAGGTTAAGTAACTTGTCCAGGG + Intergenic
1038534676 8:28345318-28345340 GAGGTTCAATAACTTGCTCAAGG - Intergenic
1038576375 8:28707301-28707323 AAGGATAGGAAACTTGTTCAAGG - Intronic
1038672026 8:29590380-29590402 GAGCTTAAATAACTTGCTCATGG + Intergenic
1039394691 8:37215256-37215278 GAGGATAAGTGACTTGTCCAAGG + Intergenic
1039438012 8:37574040-37574062 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1039618458 8:38975253-38975275 GAGGTTGAATAACCTGTTCAAGG + Intronic
1039817446 8:41107021-41107043 GAGGTCAAACACCTTGTTGAAGG + Intergenic
1039904949 8:41779763-41779785 GAGGTTAAAAAACTTGCCCAAGG + Intronic
1039953960 8:42193221-42193243 GAGAAAAAACAGCTTGATCACGG + Intronic
1040367760 8:46736431-46736453 GAGGCTAAATAACTTACTCAAGG + Intergenic
1040760423 8:50835107-50835129 GAAATTAAACAACTTGTTCCTGG + Intergenic
1041076387 8:54174069-54174091 GAGGTTAATAAACTTGCTCAAGG + Intergenic
1041492582 8:58451010-58451032 GGGGTAAAACAACTTTTTCATGG + Exonic
1041705959 8:60846548-60846570 GAGGCTGAATAACTTGCTCAAGG - Intronic
1042075636 8:64991677-64991699 GAGGTTAAATAACATGTCCAGGG - Intergenic
1042108268 8:65351956-65351978 GCTGATAAACAACTTCCTCAAGG - Intergenic
1042228671 8:66535568-66535590 GAGGTTCAATAACTTGCTCAAGG + Intergenic
1042404219 8:68385250-68385272 GAGGTTAAGAAACTTGTCCAAGG + Intronic
1042526192 8:69767448-69767470 GAGCTTAAGCAACTTGCTCAAGG - Intronic
1042834963 8:73071252-73071274 GAGGTGGAACAAGTTGTTCAAGG + Intronic
1042925257 8:73961408-73961430 GAGGATAAATAATTTGTTTCAGG + Intronic
1042983342 8:74555050-74555072 GAAGATAACCACCTTGTTCAAGG - Intergenic
1043141229 8:76592805-76592827 GAGCATAAACGACTCATTCAGGG + Intergenic
1043316521 8:78929024-78929046 GAGGTTAAATGACTTGTTCTGGG - Intergenic
1043337863 8:79199402-79199424 GAAGTTAAACAACTTTCTCAGGG + Intergenic
1043355569 8:79408164-79408186 AAGAGTAAATAACTTGTTCAAGG - Intergenic
1043939529 8:86181087-86181109 GAGGTTAAGTAACTTGTTCAAGG - Intergenic
1044193467 8:89346826-89346848 GAGGTTAAACAACTTGTCCAAGG + Intergenic
1044306117 8:90643409-90643431 GAGAATAAACAACTTGCCCAAGG + Intronic
1044359407 8:91264000-91264022 GAGGTTAAATAACTTGTATAAGG + Intronic
1044665237 8:94627996-94628018 GAGGTTAAATGACTTGTTCCAGG - Intergenic
1044927290 8:97220415-97220437 GAGGAAAAATAAATTGTACATGG - Intergenic
1045008302 8:97935448-97935470 GAGGTTAAATAACTTGTCCAAGG + Intronic
1045294616 8:100862434-100862456 GAGGTTTAATAACTAGTTCAAGG + Intergenic
1045470959 8:102511699-102511721 CAGGATGAACAGCTTGCTCAGGG - Intergenic
1045523624 8:102924823-102924845 GAGGATAAGCGACTTGCTCAAGG - Intronic
1045651233 8:104343228-104343250 GAGGTTAAACAACTTGGTCAAGG - Intronic
1045754510 8:105526939-105526961 GAGATTAAATAACTTGTGCAAGG - Intronic
1045792454 8:106000135-106000157 GAGGAAAAACCATTTGTTAAAGG + Intergenic
1045872729 8:106944874-106944896 GAGGATAAGAGACTTGCTCAAGG + Intergenic
1046103483 8:109641478-109641500 GAGGTTAAGCAACTTGCTGAAGG + Intronic
1046232436 8:111374600-111374622 CAGGAAAGACAGCTTGTTCAGGG - Intergenic
1046859422 8:119073149-119073171 GAGGTAAAATAACTTGTTCTAGG + Intronic
1047502624 8:125453996-125454018 GAGGTTAAATAACTTGCCCACGG + Intergenic
1047515037 8:125546644-125546666 GAGGTTAAGCAACTTGCTCTAGG + Intergenic
1047521677 8:125599823-125599845 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1047526267 8:125637006-125637028 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
1047767967 8:128004731-128004753 GAGGGAAAGTAACTTGTTCAGGG - Intergenic
1047777182 8:128082254-128082276 GAGGTTAAGTAACTTGTTCGGGG + Intergenic
1047800883 8:128308661-128308683 GTGGTTAATCAACTTGTCCAAGG + Intergenic
1047919447 8:129618825-129618847 GAGGATAAACACCTGTTGCATGG - Intergenic
1047949159 8:129914507-129914529 AAGTATTAACAACTTGTCCAAGG + Intronic
1048056997 8:130876736-130876758 GAGGATAAAAGAAATGTTCATGG + Intronic
1048155722 8:131948272-131948294 GAGAATAAATAACTTGCTCAAGG - Intronic
1048203617 8:132397763-132397785 GAAGCTAAGGAACTTGTTCAAGG + Intronic
1048344351 8:133565789-133565811 GAGGTTAAACAACGTGCCCAAGG + Intronic
1048348871 8:133599695-133599717 GAGGCAAACCAACCTGTTCAAGG - Intergenic
1048421030 8:134278536-134278558 GTGGTTAAATAACTTGCTCAAGG - Intergenic
1048432581 8:134384001-134384023 GAGGTTAAATGACTTGTCCAAGG - Intergenic
1048481149 8:134795014-134795036 AAAGATGAACAACTTGTTCAAGG + Intergenic
1048556849 8:135486536-135486558 GAGGTTAAATAACTTGCCCAGGG + Intronic
1048613672 8:136051251-136051273 GAGGTTAAACGACTTGTCTAAGG + Intergenic
1048660219 8:136591219-136591241 GAGGTTAAATAACTTTTTCAAGG - Intergenic
1049125867 8:140787284-140787306 GAGGCTAAATAATTTGTCCAAGG - Intronic
1049275551 8:141718413-141718435 GAGGAGAACCAACTTGTGTATGG + Intergenic
1050110908 9:2214818-2214840 AGGGTTAAACAACTTGTCCAAGG + Intergenic
1050613316 9:7375754-7375776 GAGGACAAGTGACTTGTTCAAGG + Intergenic
1050613721 9:7380129-7380151 GAGGGTAAAGAATTTGTTCAGGG + Intergenic
1051237010 9:15011952-15011974 GGGGTTAAATAATTTGTTCAAGG - Intergenic
1051287140 9:15509493-15509515 AAGGTAAAACAACTTCTTCAAGG + Intronic
1051328919 9:16003211-16003233 GAGGATATATGACTTGCTCAAGG - Intronic
1051347784 9:16168191-16168213 AAGGTGAAACAACTTGCTCAGGG + Intergenic
1051681540 9:19612565-19612587 GAGGATAAACAAATCATCCAAGG + Intronic
1051709899 9:19920912-19920934 GAGATTAAATAACTTGCTCAGGG - Intergenic
1051712151 9:19942374-19942396 GAGGGTGAATAACTTGTCCAAGG + Intergenic
1051857365 9:21584194-21584216 GAGGTTAAGCAACTTGCTCAAGG - Intergenic
1052625497 9:30971492-30971514 GAGGCTAAATAACTTGTCCATGG - Intergenic
1053050371 9:34956987-34957009 GAGGTTAAACAACTCGCCCAAGG - Intergenic
1053370713 9:37559434-37559456 GAGGTTAAGTGACTTGTTCAAGG - Intronic
1053694355 9:40621883-40621905 GCAGATATACAACTAGTTCATGG - Intergenic
1053941346 9:43252289-43252311 GCAGATATACAACTAGTTCATGG - Intergenic
1054270481 9:63018245-63018267 GCAGATATACAACTAGTTCATGG + Intergenic
1054305600 9:63421107-63421129 GCAGATATACAACTAGTTCATGG - Intergenic
1054404346 9:64745094-64745116 GCAGATATACAACTAGTTCATGG - Intergenic
1054437968 9:65230591-65230613 GCAGATATACAACTAGTTCATGG - Intergenic
1054492436 9:65791371-65791393 GCAGATATACAACTAGTTCATGG + Intergenic
1054840135 9:69729679-69729701 GAGGCTAAGCAACTTCCTCAAGG + Intronic
1054865332 9:69994485-69994507 GAGGCTAAACAACTTGATCATGG + Intergenic
1054924678 9:70577404-70577426 GAGGTTAAAGAACTTGTTGAAGG - Intronic
1054949657 9:70835648-70835670 GAGGATAAATAACTTGCTTAGGG - Intronic
1054966825 9:71038325-71038347 CAGGAAAAATAACTTATTCAAGG + Intronic
1055084516 9:72300337-72300359 GAAGATAAATAACTTGTCCAAGG + Intergenic
1055278331 9:74644898-74644920 GAGGAAAAATGACTTGTTCAGGG - Intronic
1055388826 9:75796228-75796250 GAGAATGAACAAATTGTCCAAGG + Intergenic
1055642141 9:78327548-78327570 GAGGTTAAGTAACTTGCTCAGGG + Intronic
1055963391 9:81842235-81842257 GAGGTTAAGAAACTTGCTCAAGG + Intergenic
1056066730 9:82943273-82943295 GAGGTTAAGCAATTTGTCCAAGG + Intergenic
1056281398 9:85044529-85044551 GAGGTTAATTAACTTGTCCAGGG - Intergenic
1056411762 9:86335185-86335207 GAGATTAAATAACTTGCTCAAGG + Intronic
1056453928 9:86742358-86742380 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1056786828 9:89598535-89598557 GAGGTTGAACAACTTGCTCAAGG - Intergenic
1056836011 9:89955808-89955830 GAGGTTAAGTAACTTGTTCGAGG + Intergenic
1056947850 9:91015045-91015067 GAGACTAAGCAACTTGTCCAAGG - Intergenic
1057076481 9:92140857-92140879 GAGGAGAAATGATTTGTTCAAGG - Intergenic
1057805371 9:98216103-98216125 GAGGTTAAGTAACTTGTCCAGGG - Intronic
1057810649 9:98254459-98254481 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1057881004 9:98792554-98792576 GAGGATACACCAGTTCTTCAGGG - Intronic
1057944917 9:99317681-99317703 GAGGATAGAAAACTTGCCCAAGG + Intergenic
1057954818 9:99399169-99399191 GAGGTTCAATAACTTGCTCAAGG - Intergenic
1057956721 9:99415379-99415401 GAAGAGAAACAACCTGCTCAGGG + Intergenic
1058049836 9:100394389-100394411 GAGATTAAGTAACTTGTTCAAGG + Intergenic
1058067116 9:100561988-100562010 GAGGTTATGTAACTTGTTCAAGG + Intronic
1058391694 9:104502505-104502527 GAGGATCATCAACTTGCTCTAGG + Intergenic
1058430787 9:104917219-104917241 GAAGTTAAATAACTTGTTCATGG - Intronic
1058501311 9:105620592-105620614 GAGGTTAAATAACTTGCTCAAGG - Intronic
1058603403 9:106695724-106695746 AAGTTTAAATAACTTGTTCAAGG - Intergenic
1059143149 9:111873490-111873512 AAGGTGAAACCACTTGTTCAAGG + Intergenic
1059459211 9:114419194-114419216 GAGGAGAAGCAACTTGCCCAAGG - Intronic
1059465805 9:114468105-114468127 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1059560089 9:115325858-115325880 GAGGTTAAACAACTTACTCAAGG - Intronic
1059576541 9:115495066-115495088 GAGTAAAAACAACTTGCTGAAGG - Intergenic
1059695640 9:116727768-116727790 GAGGTTAAATAACTTGCCCAAGG - Intronic
1059744696 9:117188696-117188718 GAGAATAAACAACTTGTTTAAGG + Intronic
1059769033 9:117410561-117410583 GGGGATAAATGACTTATTCAAGG + Intronic
1060001496 9:119962892-119962914 GAGGCTAAGCAACTTGCCCAAGG - Intergenic
1060076812 9:120598239-120598261 AAGGATAAACAACTAATTGAAGG - Intergenic
1060114202 9:120928168-120928190 GAGGCTAAGCGACTTGTTCAAGG + Exonic
1060262096 9:122084773-122084795 GAGGTAAAGCAACTTGTCCAGGG + Intronic
1060648346 9:125302029-125302051 GAAGATACACAATTTGTTGATGG + Exonic
1060884014 9:127137860-127137882 GATATCAAACAACTTGTTCAAGG - Intronic
1060900978 9:127258031-127258053 GAGGATAAGTAACTTGTTTGAGG + Intronic
1060973250 9:127750983-127751005 GAGGTGAAGCAACTTGTTCAAGG + Intronic
1061187257 9:129061878-129061900 GAAGTTAAGCGACTTGTTCAGGG - Intronic
1061562014 9:131410599-131410621 AAGGTTAAATAACTAGTTCAAGG - Intronic
1061635107 9:131902950-131902972 GAGGGTAAGTGACTTGTTCAAGG - Intronic
1061636475 9:131913343-131913365 AAGGTTCAATAACTTGTTCAAGG - Intronic
1061706296 9:132455937-132455959 GTGGATAAATAACTTGCTCAAGG - Intronic
1203603778 Un_KI270748v1:40686-40708 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1186010097 X:5120642-5120664 AAAGATAAAGAACTTGTCCAAGG + Intergenic
1187089360 X:16078890-16078912 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1187095089 X:16139775-16139797 GAGGTTAAGTAACTTGTTCACGG - Intronic
1187153654 X:16704236-16704258 AAGGATAAATAACTTGCCCAAGG - Intronic
1187254372 X:17628755-17628777 GAGGTTAAACAACTTGCCCAAGG - Intronic
1187258130 X:17659854-17659876 GAGAATAAATAACTTGCCCAAGG + Intronic
1187317021 X:18205992-18206014 GAGGTTAAGTAACTTGCTCAGGG - Intronic
1187406057 X:19005047-19005069 GAGGTTAAGTAACTTGCTCAAGG + Intronic
1187410275 X:19045131-19045153 GAGGTTTAGAAACTTGTTCAAGG + Intronic
1187829803 X:23369515-23369537 GAGCTTAAATAACTTGTCCATGG - Intronic
1188058889 X:25576148-25576170 GAGGTAAAATAACTTCTTCAAGG + Intergenic
1188786399 X:34352008-34352030 GAGGTTAAATAACTTGCGCATGG + Intergenic
1189212409 X:39295035-39295057 GAGGAGAAGCAACTTACTCAAGG - Intergenic
1189265078 X:39709090-39709112 GAGGATCAACAACTTGGGCTGGG + Intergenic
1189283923 X:39838637-39838659 GAGGCTAAGTAACTTGCTCAAGG - Intergenic
1189551842 X:42101607-42101629 GAGGCTAAGCACCTTGTCCAAGG + Intergenic
1190433174 X:50397455-50397477 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1190737525 X:53265510-53265532 GAGAAGAAAAAACTTGCTCAAGG + Intronic
1190928375 X:54928406-54928428 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1191031899 X:55982648-55982670 GAGGTTAGGCAACTTATTCAAGG - Intergenic
1191853404 X:65602968-65602990 GAGGGGAAACAACGTGCTCAAGG + Intronic
1191862188 X:65674903-65674925 GAAGTTAAATAACTTGTCCAAGG - Intronic
1192100316 X:68257453-68257475 GAGGATGACCTACTTGTTCAAGG - Intronic
1192111212 X:68366916-68366938 GAGGTTAAGTAACTAGTTCAAGG + Intronic
1192185387 X:68943479-68943501 GAGGTTAAATGACTTGTCCAAGG + Intergenic
1192185701 X:68945467-68945489 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1192190148 X:68986055-68986077 GAGGTTAAATAACTTGCCCACGG - Intergenic
1192236372 X:69298800-69298822 GAGGATAACTGACTTATTCAAGG + Intergenic
1192262783 X:69517365-69517387 GAGTTTAAATAACTTGTCCAAGG - Intronic
1192537382 X:71939665-71939687 GAGGTTAAGGAACTTGTCCAAGG - Intergenic
1192911549 X:75609801-75609823 GATGTTAAAGAATTTGTTCAAGG - Intergenic
1193085188 X:77442615-77442637 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1193285166 X:79705143-79705165 GAGTTTACACAACTTTTTCATGG + Intergenic
1193686539 X:84583189-84583211 AAGGTTAACCCACTTGTTCAAGG + Intergenic
1194541891 X:95183407-95183429 TAGGTTAAACAGCTTGTTTAAGG + Intergenic
1194745127 X:97619999-97620021 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1194754486 X:97721993-97722015 GAGATTAAATAACTTGCTCAAGG + Intergenic
1194949058 X:100103288-100103310 GAGGTTAAAAAATTTGTTCAAGG - Intergenic
1195272810 X:103250134-103250156 GAGGATAAATAATTTATACAAGG + Intergenic
1195471076 X:105230803-105230825 GAGGTTAAACAATTTGTCCAAGG + Intronic
1195797883 X:108671955-108671977 GAGGTTAAGAAACTTGCTCAGGG + Intronic
1195800781 X:108707176-108707198 GAGAATAAACATCTTTTTCTTGG + Intergenic
1195877416 X:109556398-109556420 GTAGATTAACAACTTGTTAAAGG - Intergenic
1195958376 X:110359097-110359119 GATGTTAAATAACTTGTTCAAGG + Intronic
1196044377 X:111242086-111242108 GAGGCAAAATAACTTGCTCATGG - Intergenic
1196120597 X:112046242-112046264 GATTATAAAGAGCTTGTTCAAGG + Intronic
1196387318 X:115172317-115172339 GAAGTTAAATGACTTGTTCAAGG - Intronic
1196610563 X:117709792-117709814 AAGGTTAAACAACTTGCCCAAGG + Intergenic
1196677330 X:118433564-118433586 GAGGTTAAATAACTTGCCCAAGG - Intronic
1196678948 X:118451178-118451200 TAGGATAAATAACTTGCCCAAGG - Intergenic
1196813954 X:119650379-119650401 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1197011367 X:121568681-121568703 GAGGATAAATAATTTGGTTAAGG - Intergenic
1197018984 X:121663394-121663416 GAGGTTAAATAACTTGTCCATGG + Intergenic
1197280031 X:124524378-124524400 AAGGTTAAATATCTTGTTCAGGG + Intronic
1197690763 X:129498681-129498703 GAAGTTAAACAACTTACTCAGGG + Intronic
1197691170 X:129502622-129502644 GAGGATAAACTACTCTTTCAAGG + Intronic
1197884359 X:131202933-131202955 GAGGTTAAACAACTTACCCAAGG + Intergenic
1198129894 X:133683112-133683134 GAGAATCAACAACTTGTAGACGG + Intronic
1198194090 X:134342614-134342636 GAAGATAACCAACTTGCTCAAGG - Intergenic
1198408739 X:136343868-136343890 GAGGTTAAGCAACTAGTCCAAGG + Intronic
1198460882 X:136862072-136862094 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1198541784 X:137647814-137647836 GAGGTTAAATGACTTATTCAAGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198670424 X:139074451-139074473 GAGGTGAAGCTACTTGTTCAAGG + Intronic
1198690023 X:139271557-139271579 GAGGTTAAGTAACTTGCTCATGG + Intergenic
1198762429 X:140046735-140046757 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1198912601 X:141631456-141631478 GAGGTTAAGGAACTTGCTCAGGG - Intronic
1198950495 X:142065853-142065875 GAAGTTAAATAACTTGTCCAAGG - Intergenic
1199151534 X:144492559-144492581 GAGGGTAAGTAAATTGTTCAAGG + Intergenic
1199505591 X:148557921-148557943 GAGGTTAAATAACTTGTCCAAGG + Intronic
1199793102 X:151173338-151173360 GAGGTGAAAGAACTTGTCCAAGG - Intergenic
1199820307 X:151439036-151439058 GGGGTTAAACAGCTTGTCCATGG + Intergenic
1199862480 X:151814353-151814375 GCAGATAAACAACTTGTCCAAGG + Intergenic
1199864166 X:151828033-151828055 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1201464087 Y:14260776-14260798 CAGGATAACCGACTTGGTCAGGG + Intergenic