ID: 905008872

View in Genome Browser
Species Human (GRCh38)
Location 1:34733270-34733292
Sequence TAACCCTGCTTCACAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905008872_905008873 -1 Left 905008872 1:34733270-34733292 CCTTTGTCTGTGAAGCAGGGTTA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 905008873 1:34733292-34733314 AATGATAATACCTACTTCAATGG 0: 1
1: 4
2: 51
3: 348
4: 1437
905008872_905008874 0 Left 905008872 1:34733270-34733292 CCTTTGTCTGTGAAGCAGGGTTA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 905008874 1:34733293-34733315 ATGATAATACCTACTTCAATGGG 0: 1
1: 1
2: 10
3: 114
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905008872 Original CRISPR TAACCCTGCTTCACAGACAA AGG (reversed) Intronic