ID: 905008872

View in Genome Browser
Species Human (GRCh38)
Location 1:34733270-34733292
Sequence TAACCCTGCTTCACAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905008872_905008873 -1 Left 905008872 1:34733270-34733292 CCTTTGTCTGTGAAGCAGGGTTA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 905008873 1:34733292-34733314 AATGATAATACCTACTTCAATGG 0: 1
1: 4
2: 51
3: 348
4: 1437
905008872_905008874 0 Left 905008872 1:34733270-34733292 CCTTTGTCTGTGAAGCAGGGTTA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 905008874 1:34733293-34733315 ATGATAATACCTACTTCAATGGG 0: 1
1: 1
2: 10
3: 114
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905008872 Original CRISPR TAACCCTGCTTCACAGACAA AGG (reversed) Intronic
901134621 1:6984936-6984958 GGACCCTGCTTCCCAGAGAAAGG + Intronic
901799286 1:11698126-11698148 TAATCCCATTTCACAGACAAGGG + Intronic
903216377 1:21845776-21845798 TACCCCTTCTTTACAGATAAGGG + Intronic
904553499 1:31341467-31341489 TAACCCTGTTTCTCAGAAAATGG + Intronic
904659737 1:32075458-32075480 TAATCCTGCTTGTCAGACAAAGG - Intronic
905008872 1:34733270-34733292 TAACCCTGCTTCACAGACAAAGG - Intronic
906496720 1:46309764-46309786 TAGGCCTGGTTCTCAGACAAGGG + Intronic
907246849 1:53114230-53114252 TAACCTTGCTTCTCAGACCTAGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909578627 1:77205962-77205984 TCACCCTGCAGCACAGACATGGG + Intronic
910269030 1:85372856-85372878 TAAATCTGCTTGAGAGACAATGG - Intronic
910820956 1:91345685-91345707 TGACCATGCTTCACACAGAAAGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
915716351 1:157948636-157948658 TAGCCCTTCTTCACAGCCAGAGG - Intergenic
916504145 1:165412546-165412568 AATCTCTGCTTCACAGATAAGGG - Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920034066 1:203054342-203054364 GATCCCTGTTTTACAGACAAGGG + Intronic
920600103 1:207316537-207316559 TAATTCTGCTTCACAGAATAAGG - Intergenic
920624278 1:207580595-207580617 TTACCCTTCATCACAGACAAAGG - Exonic
920636914 1:207712848-207712870 TCACCCTTCATCACAAACAAAGG - Intronic
921348745 1:214213892-214213914 AAATACTGCTTCTCAGACAAAGG + Intergenic
922180673 1:223230610-223230632 CAACCCTGCTTCACACGCATCGG - Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
922743626 1:228030824-228030846 CAACCCTGCTTCACAGCCTCTGG + Intronic
924703956 1:246482871-246482893 AAACACTGCTCCACAGACAAGGG + Intronic
1062965730 10:1606417-1606439 GAGCCCTGCTTCACAGCCCAAGG + Intronic
1064949041 10:20826248-20826270 AAACACTGCTTCAGAGTCAAGGG + Intronic
1069882036 10:71599054-71599076 TGGCCCTGCTTCTCTGACAAAGG - Intronic
1070481861 10:76890659-76890681 TAAACCTGTTACACAAACAATGG - Intronic
1074375689 10:112939230-112939252 CAACCCTGTTTTACAGATAAGGG + Intergenic
1075176909 10:120172802-120172824 TTACTTTGCTTCACTGACAATGG + Intergenic
1075241657 10:120784943-120784965 TAATCCAGCTTTACAGAAAAAGG + Intergenic
1078633929 11:13031205-13031227 GAACACTGTTTCACAGACCAGGG - Intergenic
1079321637 11:19456413-19456435 TATCCCTACTTCACAGATAAAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1085390305 11:76178887-76178909 TAACCCCGACTTACAGACAAGGG - Intergenic
1085606395 11:77903386-77903408 TCACTCTGCTTCAAATACAAAGG + Intronic
1085606416 11:77903565-77903587 TCACTCTGCTTCAAATACAAAGG + Exonic
1085954182 11:81370867-81370889 TAACCCTACTTTAGAGATAAGGG + Intergenic
1090224609 11:125062727-125062749 TTCCCCGGCTTCACAGACACCGG - Intergenic
1104764261 12:131316211-131316233 TTTCCCTGCTTTACAGAGAAGGG + Intergenic
1104815289 12:131642188-131642210 TTTCCCTGCTTTACAGAGAAGGG - Intergenic
1107012158 13:35680094-35680116 TAACCCTGCTGCAGATACAAAGG + Intergenic
1110482239 13:75992915-75992937 AAACCCTGCATCAAAGACACAGG + Intergenic
1110584535 13:77172924-77172946 TATCCCTGTTTCACAGATGATGG - Intronic
1113734885 13:112671507-112671529 TGTCCCTGTTTCACAGACAAGGG + Intronic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119175199 14:72563490-72563512 TGCCCCAGCTTCACACACAAAGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121696108 14:95913681-95913703 TGACCCTGCTGGACAGACCATGG - Intergenic
1122667140 14:103338451-103338473 TAATCCTCCTCCACATACAATGG + Exonic
1123413990 15:20081872-20081894 AGACCCAGCCTCACAGACAAAGG + Intergenic
1123472718 15:20566872-20566894 TAGCCTGGCTTCACAGACAGAGG + Intergenic
1123523332 15:21088983-21089005 AGACCCAGCCTCACAGACAAAGG + Intergenic
1123733025 15:23161863-23161885 TAGCCTGGCTTCACAGACAGAGG + Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1125226158 15:37398632-37398654 TACTCCTGCTTAACAGACAAGGG + Intergenic
1130066470 15:80609048-80609070 TCAACCAACTTCACAGACAAGGG + Intergenic
1130249299 15:82286730-82286752 TCACCCTGTATCACAGACACAGG + Intergenic
1130801791 15:87272383-87272405 TAACCCTGCTTATCAGTCATTGG + Intergenic
1131311969 15:91298370-91298392 TAAGCCTGCCTCACAATCAAAGG - Exonic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132028609 15:98422475-98422497 TTACCCTGCTCCACCTACAATGG + Intergenic
1134316996 16:13127732-13127754 TAAGCCCATTTCACAGACAAGGG - Intronic
1135801114 16:25497118-25497140 TCACACTGCTTAACAAACAATGG - Intergenic
1135931370 16:26740380-26740402 AAACCCTGCTGCACAGGCCAGGG + Intergenic
1137672297 16:50286042-50286064 AAGCCGTGCTTCACAGAAAAGGG - Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139418736 16:66835092-66835114 TAACCCCGTTTTACAGACAGAGG + Intronic
1139954918 16:70688491-70688513 TAGCCCTGCCTCTCAGAGAAAGG - Intronic
1141631978 16:85292851-85292873 TGTCCCTGTTTCACAGACAATGG - Intergenic
1144322635 17:14144961-14144983 TAAACGTGCTATACAGACAAGGG + Intronic
1145263787 17:21369740-21369762 CAAGCCTGTTTCACAGACAGAGG + Intergenic
1145313614 17:21715247-21715269 TAAGCCTGCTTCACAGTAAGTGG - Intergenic
1147507637 17:41035289-41035311 TAGTCTTGCTTCACAGTCAAAGG - Intergenic
1148388211 17:47251816-47251838 TAACCCTTCCTCTCAGCCAAGGG - Intergenic
1151057706 17:71052770-71052792 GAACCCTCCTTCTCAGAGAAGGG + Intergenic
1156732458 18:40210950-40210972 TGACCATGCTTCACAGACAAAGG + Intergenic
1159127163 18:64237067-64237089 TAAGCCTGCTCCACTGGCAAAGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160094303 18:75857411-75857433 GAACCCTGCTCAACAGACAAAGG + Intergenic
1165399323 19:35587706-35587728 TATGCCTGCTTTAGAGACAAAGG - Intergenic
1165782351 19:38441845-38441867 GACCTCTGCTTCACAGACACAGG - Intronic
1166002103 19:39883574-39883596 TGCCTCAGCTTCACAGACAAGGG - Intronic
1166004887 19:39899825-39899847 TGCCTCAGCTTCACAGACAAGGG - Intronic
925247231 2:2394749-2394771 TCAAGCTGCTTCACAGAGAAGGG - Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927452679 2:23222495-23222517 TAACCCAGATTCAAAGAGAAGGG - Intergenic
928405624 2:31012266-31012288 TAACCCTGGTTCCCACACACTGG + Intronic
928698116 2:33871304-33871326 TTACCCTACTTCACAGATGAGGG - Intergenic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
930554728 2:52881499-52881521 TTACCCTGCTTCAGATAAAATGG - Intergenic
932543554 2:72683041-72683063 TTACCCAGGTACACAGACAAAGG + Intronic
933305115 2:80587832-80587854 GCAACCTGCTTCACAGACAGGGG - Intronic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
935089920 2:99885260-99885282 TTACCCTACCTCACACACAAAGG + Intronic
937263083 2:120598736-120598758 TAACCCAGCCACACAGACAGAGG - Intergenic
938657775 2:133452239-133452261 CATCCCTGCTCCAAAGACAAGGG + Intronic
939012719 2:136865226-136865248 AAACCATGCTTCATAGAGAATGG + Intronic
941277202 2:163504294-163504316 TAACACTGTTTAAGAGACAAAGG + Intergenic
942485510 2:176435685-176435707 TAACTCTCCTTCGCTGACAATGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
945207876 2:207351476-207351498 TGACCATGCTTCACACAGAAAGG + Intergenic
945442002 2:209890679-209890701 TAACCCAGTTTTACAGAAAAGGG - Intronic
1169881836 20:10355186-10355208 CAACTCTTCTTCCCAGACAATGG + Intergenic
1171862330 20:30412574-30412596 TACCCCTGAGTCACAGAGAAGGG + Intergenic
1172140401 20:32718815-32718837 TAACTGTGCTTCACAGATACTGG + Intronic
1174494352 20:50929850-50929872 TAACCCCATTTCACAGACAAAGG - Intronic
1175184560 20:57171285-57171307 TATCCCTGTTTTGCAGACAAGGG + Intronic
1175692922 20:61078945-61078967 TACCCATTCTTCACAGAAAACGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179378836 21:40879719-40879741 GAAAACTGCTTCCCAGACAAAGG - Intergenic
1181983313 22:26781850-26781872 TAATCCTGATTCACAGAAAAAGG + Intergenic
1182546129 22:31077695-31077717 AGACCCAGCCTCACAGACAAAGG - Intronic
1182569251 22:31224005-31224027 GAACCCTGTTTCACAGGCACAGG - Intronic
1183658375 22:39204204-39204226 CATCCCTGTTTTACAGACAAGGG + Intergenic
1184496528 22:44845578-44845600 TAACCCCACTGGACAGACAAGGG - Intronic
950665830 3:14494454-14494476 TCACCTTGCTTCACAGCCGATGG - Intronic
951834353 3:26964613-26964635 TATCCCTGCTTTACAGATATGGG + Intergenic
953435829 3:42876367-42876389 TATCCCTACTTCACAGATGAGGG - Intronic
953559101 3:43971187-43971209 TAATTCTCCTTCCCAGACAAGGG - Intergenic
953785221 3:45906341-45906363 TAACCCTGATTTACAGAGGAAGG + Intronic
955019702 3:55107394-55107416 TAAACCGACTTCAGAGACAAAGG - Intergenic
957315675 3:78573041-78573063 ATACCCTGCTTCACAGAAGAAGG + Intergenic
959938384 3:112054429-112054451 TTAACCTGCTTGACAGACAGAGG - Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961865878 3:129953142-129953164 TAACTCTGCTTCTCAGAGATGGG - Intergenic
962493464 3:135916431-135916453 CAACCCTGATTGACAGAAAAAGG + Intergenic
962637646 3:137347213-137347235 TATGCCTGCTTCACAGAAGAGGG - Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964086787 3:152828204-152828226 TCTCTCTACTTCACAGACAAAGG - Intergenic
966429464 3:179816000-179816022 TATCCCTGCAACACAGAAAAAGG + Exonic
966500288 3:180631924-180631946 AATCCCTGTTTCAGAGACAACGG + Intronic
967779510 3:193419907-193419929 TACCCCAGCTTCACAGAGTATGG + Intronic
968530795 4:1090369-1090391 GAACCCAGCTTTAAAGACAAGGG - Intronic
969150678 4:5166329-5166351 TATCCCCGCTTCACAGAGAGAGG - Intronic
971003652 4:22350857-22350879 TAACACTACTTCATTGACAATGG - Intronic
973089639 4:46118638-46118660 GAACCCTGCTTAACACACAATGG + Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978840417 4:113205760-113205782 TAACCCATTGTCACAGACAATGG + Intronic
979689851 4:123548372-123548394 TATCCCTGCTTCTCAGAGAGAGG - Intergenic
979755093 4:124330572-124330594 TAACCTTGGTTCAGAGACAAGGG + Intergenic
980588994 4:134858290-134858312 TAGCCTTGCTTCACATACATGGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983911205 4:173241638-173241660 TGACCCTGTTTCAAAAACAAAGG - Intronic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987118170 5:14742802-14742824 TCACCCAGCTTGACAGTCAAAGG + Intronic
987767469 5:22251556-22251578 CATCCCTGCTTTACAGATAAGGG - Intronic
987920967 5:24280563-24280585 TATCCCCGGGTCACAGACAAGGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988701041 5:33674734-33674756 AAATCCTGAGTCACAGACAAAGG - Intronic
990156022 5:52878109-52878131 TCACCCTGATCCACAGGCAATGG - Intronic
992553323 5:77880117-77880139 TATCCCTGCTTCACAGATAAAGG + Intergenic
993034079 5:82737709-82737731 CAACCATGCTTCACACAGAAAGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996009126 5:118461335-118461357 TAACACTGCTGCAGAAACAAAGG + Intergenic
997444371 5:133930617-133930639 TGCCCCTGGTTGACAGACAAGGG - Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
1000127932 5:158265524-158265546 TCACTCTGCTTCATAGACAGAGG - Intergenic
1002465559 5:179406512-179406534 GAACACTGCTTCCCAGACCAGGG - Intergenic
1003958969 6:11191608-11191630 AATCCCTACTTTACAGACAAGGG - Intronic
1004852355 6:19713100-19713122 AAACCCTGCTACACAGCCTAAGG + Intergenic
1005220418 6:23581180-23581202 TAACTCAGCTTCAGAGACAGAGG + Intergenic
1006262827 6:32890884-32890906 TGACCATTCTTCACATACAAGGG + Intergenic
1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG + Intronic
1007792259 6:44317164-44317186 TAACCCTGTTTCAGAGAGCACGG - Intronic
1010451421 6:76008142-76008164 AATCCCAGCTTCACAGAAAAGGG + Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013734099 6:113205708-113205730 TATCCCAGTTTTACAGACAAGGG - Intergenic
1014457047 6:121647993-121648015 TATCCCTGTTTTACAGATAAGGG + Intergenic
1014545617 6:122731992-122732014 TGACCCTGTTACACAGAAAAAGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019554857 7:1624143-1624165 TACCCCTGCTTTTCTGACAATGG - Intergenic
1019869486 7:3746003-3746025 TAGCCCTGCTTTACAGATGAGGG - Intronic
1022401238 7:30040337-30040359 TAAACATGATTCACACACAAAGG - Intronic
1024230149 7:47357704-47357726 TAACCCTGATTCTAAGAGAACGG + Intronic
1024441678 7:49426665-49426687 TATCCCTATTTCACAGATAAGGG - Intergenic
1025896464 7:65706558-65706580 TCACTCTGCTTCAAATACAAAGG - Intergenic
1030116169 7:106063913-106063935 TAGCCCTATTTTACAGACAATGG - Intergenic
1031390740 7:121211497-121211519 TAACACTGCTTTAAAGACAGAGG - Intronic
1031678460 7:124640530-124640552 GAAGCCTGCTACACACACAAAGG - Intergenic
1032236770 7:130131340-130131362 TAACCTTCCTTCAAAGCCAAAGG - Exonic
1032505117 7:132428600-132428622 TACCCCTGCTACTCAGACACAGG + Intronic
1038091726 8:24261858-24261880 TATTCCTCCTTCACAAACAAAGG - Intergenic
1038271258 8:26078044-26078066 TAACCCTGTTTTACAGAGAGGGG + Intergenic
1040325098 8:46337641-46337663 TCACCCTGCTTCAAAGACTGGGG - Intergenic
1040336752 8:46419950-46419972 TAACCCTGCTCCAAAGCCATGGG - Intergenic
1042287069 8:67125339-67125361 TAACCATTCATCACATACAAGGG - Intronic
1046047379 8:108980402-108980424 TAACTGTGCTTCAAAGAAAAAGG - Intergenic
1046139191 8:110067932-110067954 TAACAATGCTTCACATATAATGG - Intergenic
1047281578 8:123450579-123450601 TTGCCCTGCTTCAGAGACAGTGG - Intronic
1047722001 8:127649672-127649694 TCACCCTGCTTCCCATTCAATGG - Intergenic
1047809913 8:128397137-128397159 TGACCATGCTTCACATAGAAAGG - Intergenic
1049081739 8:140448637-140448659 TGCCCCTGCTTTACAGAGAAGGG - Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1053462863 9:38284270-38284292 TAAGCCTCCTTCCCAGGCAATGG + Intergenic
1057268732 9:93635378-93635400 TGCCCTTCCTTCACAGACAAAGG - Intronic
1057925395 9:99142520-99142542 TAATTCTGTTTTACAGACAATGG + Exonic
1058196676 9:101985371-101985393 TAACCATGCTTCCCAGCCTATGG - Intergenic
1059466875 9:114474492-114474514 CAACCTTGTTTCACAGCCAAAGG + Intronic
1059791999 9:117650128-117650150 TATCCCCATTTCACAGACAATGG - Intergenic
1059880841 9:118687191-118687213 TAGCCCTGCTGCTGAGACAAAGG + Intergenic
1060732929 9:126049480-126049502 GACCCCTGCCTCACAGACAGGGG - Intergenic
1187428945 X:19203929-19203951 TAATCCTGCTTTATGGACAAGGG + Intergenic
1188372903 X:29390737-29390759 TATCACTGATTCACTGACAAAGG - Intronic
1190057692 X:47191216-47191238 AAATCCTGCTCCACGGACAAGGG - Intronic
1190464750 X:50715178-50715200 TAACCAGGCTTCACAGGGAAGGG - Intronic
1193459094 X:81768927-81768949 TAACCTTGTTTTACAGAAAAGGG - Intergenic
1196293050 X:113966186-113966208 TACCCCTGCTTCACAGCTAGTGG + Intergenic
1197787192 X:130210723-130210745 TAATCAAGCTTCACAGCCAATGG + Intronic
1198371022 X:135989157-135989179 TACTCCTGCTTCTCAGATAAAGG - Intronic
1199409827 X:147508608-147508630 AACCCCAACTTCACAGACAATGG - Intergenic
1200078207 X:153562312-153562334 TAACCCTGCTTCAGAGCCTTGGG + Intronic