ID: 905011207

View in Genome Browser
Species Human (GRCh38)
Location 1:34748128-34748150
Sequence CACTTTTAGCACCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905011207_905011219 28 Left 905011207 1:34748128-34748150 CCAGGCTCCAGGTGCTAAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 905011219 1:34748179-34748201 ACCCTGAGGTCCCTTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 149
905011207_905011216 14 Left 905011207 1:34748128-34748150 CCAGGCTCCAGGTGCTAAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 905011216 1:34748165-34748187 CCCTTCACCTGGACACCCTGAGG 0: 1
1: 0
2: 1
3: 27
4: 256
905011207_905011213 3 Left 905011207 1:34748128-34748150 CCAGGCTCCAGGTGCTAAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 905011213 1:34748154-34748176 TGGGAGTGGACCCCTTCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905011207 Original CRISPR CACTTTTAGCACCTGGAGCC TGG (reversed) Intronic
903071638 1:20729718-20729740 CTCTGTTAGCACCAAGAGCCCGG + Intronic
905011207 1:34748128-34748150 CACTTTTAGCACCTGGAGCCTGG - Intronic
905544715 1:38788445-38788467 CACTTTTACCACCTGCAGCGTGG - Intergenic
907686185 1:56614107-56614129 CACGTTGTGCACCTGGACCCTGG + Intronic
908491202 1:64645897-64645919 CACTTTTTGCACCTTTAACCTGG + Intronic
910658140 1:89639486-89639508 TGCTTTCAGCATCTGGAGCCTGG + Intronic
912431232 1:109629545-109629567 CACTCTTGGCACCTTGGGCCAGG + Intronic
915111801 1:153568642-153568664 AATTTCTGGCACCTGGAGCCCGG - Intergenic
921578989 1:216873812-216873834 CATTGTTAGCACTTGGAGCCTGG + Intronic
924580738 1:245321878-245321900 CACCTTTAACTCCTGGAGGCTGG + Intronic
1062925923 10:1315234-1315256 CACCTGCAGCACCTGGTGCCTGG - Intronic
1064307181 10:14177828-14177850 GCCATTTAGCCCCTGGAGCCTGG + Intronic
1067430991 10:46245774-46245796 CACAGTAAGGACCTGGAGCCAGG + Intergenic
1067442417 10:46316454-46316476 CACAGTAAGGACCTGGAGCCAGG - Intronic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1077056782 11:597762-597784 GCCTCTGAGCACCTGGAGCCAGG + Intronic
1078643197 11:13114918-13114940 CTCTTTCAGAACCTGGAGCCAGG + Intergenic
1078844038 11:15105894-15105916 CTCTTTTTGCACCTGGTTCCTGG + Intergenic
1080021248 11:27562445-27562467 GACTTCTAGTACCTAGAGCCTGG - Intergenic
1081331333 11:41804208-41804230 CACTTTGAGAGACTGGAGCCTGG + Intergenic
1082771908 11:57214349-57214371 CTCTTTAAGCACCTGGTGACAGG + Intergenic
1084487929 11:69461849-69461871 CCCTTGTAGCAACTGGAGTCTGG + Intergenic
1085220862 11:74872733-74872755 CAGTTTCAGCTGCTGGAGCCAGG - Intronic
1085388044 11:76168351-76168373 CACTTCCAGTAGCTGGAGCCTGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088494637 11:110420786-110420808 CTCTTTTAAGAACTGGAGCCAGG + Intergenic
1091877227 12:3945438-3945460 CATTTTTAAAACCTGTAGCCAGG - Intergenic
1092258359 12:6939082-6939104 CACATTGAGCATCTGCAGCCGGG - Exonic
1093595178 12:20950756-20950778 CAGTTTGAGCAACTGGAGCCAGG + Intergenic
1094481562 12:30886242-30886264 CACTCTGAGCACCTGTACCCTGG + Intergenic
1095494352 12:42769172-42769194 CACTTTTAGAAAGTGGGGCCAGG + Intergenic
1096553092 12:52386790-52386812 CTCTTTTAGGACCCTGAGCCAGG + Intergenic
1097687691 12:62706388-62706410 CACTCTTAGCTCCTGCATCCAGG + Intronic
1100286522 12:93172241-93172263 CACTCTGAGAACCTGGGGCCAGG - Intergenic
1102166363 12:110809979-110810001 CACTTTCAGCAGCTGGAACAGGG - Intergenic
1104216290 12:126736953-126736975 CATTCTATGCACCTGGAGCCTGG - Intergenic
1108572230 13:51763218-51763240 GACTTTCAGCACCTTGAGACAGG + Exonic
1113117005 13:106884985-106885007 CACTCTCAGCACCTGGATCAGGG + Intergenic
1113830110 13:113289014-113289036 CTCTGTCAGCAGCTGGAGCCAGG + Intergenic
1115417580 14:33154147-33154169 CCATTTTGGCTCCTGGAGCCTGG + Intronic
1118747344 14:68783948-68783970 TTTTTTCAGCACCTGGAGCCAGG - Intergenic
1120365343 14:83561547-83561569 CACTTTTACCTGCTGGAGCCAGG + Intergenic
1121664222 14:95659486-95659508 GATTTTTAACACCTGCAGCCTGG - Intergenic
1125735003 15:41918732-41918754 CAGTGTTACCACCTGGATCCAGG - Intronic
1129657215 15:77532220-77532242 CACTTTCAGCAGCTGGGCCCTGG + Intergenic
1130320236 15:82835497-82835519 CCCTTTCAGCAGCTGCAGCCTGG + Exonic
1130518618 15:84645355-84645377 CAACTTTAACTCCTGGAGCCAGG + Intronic
1130832176 15:87612158-87612180 CACTTGTAGCTCCTGGATCTGGG - Intergenic
1134597672 16:15509032-15509054 CAAGCTAAGCACCTGGAGCCTGG + Intronic
1135789927 16:25384542-25384564 AACATTCTGCACCTGGAGCCAGG + Intergenic
1135916609 16:26610706-26610728 CACTGTTAGCATCTGGGGCTGGG + Intergenic
1138686597 16:58731859-58731881 CACTTTTACCATTTGGAGCTAGG + Intronic
1138941608 16:61798116-61798138 AACTTTTTTCCCCTGGAGCCAGG + Intronic
1141173616 16:81705539-81705561 CAGGTTCAGCACCTGGAGCATGG - Exonic
1141384608 16:83608399-83608421 GACTTTTAGAAATTGGAGCCTGG - Intronic
1142491087 17:280218-280240 CACTTTTAGTCCCTGAACCCTGG - Intronic
1142495520 17:304578-304600 CACTCTGAGCAGCTGGTGCCTGG + Intronic
1150353592 17:64464693-64464715 CACTTTGATCACCTGAAGTCTGG + Intronic
1151575544 17:74951092-74951114 CACCTTTTTCCCCTGGAGCCTGG + Exonic
1153200666 18:2644386-2644408 TACTTATAGAACCTGGGGCCAGG + Intergenic
1155107214 18:22679309-22679331 CACTTCTATGACCTGAAGCCTGG + Intergenic
1155677366 18:28445990-28446012 CAGATTGAGCTCCTGGAGCCAGG - Intergenic
1161507514 19:4651875-4651897 CACCTTCAGCACCAAGAGCCTGG + Exonic
1164187195 19:22880669-22880691 CAGTTTGAGCCACTGGAGCCAGG - Intergenic
1164908004 19:31983448-31983470 CGCTTTTGGTGCCTGGAGCCTGG + Intergenic
1165707418 19:37986470-37986492 TGCTTTTGGCACCTGAAGCCTGG - Intronic
1165991315 19:39816276-39816298 CCCTCTGAGAACCTGGAGCCTGG + Intergenic
1166438711 19:42791714-42791736 CAGTTTGAGCTGCTGGAGCCAGG + Intronic
1166473723 19:43102503-43102525 CAGTTTCAGCTGCTGGAGCCAGG + Intronic
1166494505 19:43289440-43289462 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG + Intergenic
1168510540 19:56970049-56970071 CTCTGTGAGCAACTGGAGCCAGG + Intergenic
932269038 2:70392740-70392762 CCCTTTTAACTCCTGGAGACTGG + Intergenic
940658513 2:156518273-156518295 CATTTTTACCTCCAGGAGCCAGG - Intronic
941160191 2:162026648-162026670 CACTCTCAGCCCCTGCAGCCTGG - Intronic
941839660 2:170067142-170067164 CACTGTTAACATCTGGACCCAGG + Intronic
1168832609 20:854948-854970 GACTATGAGCACCTGGAGCCAGG + Intronic
1170174711 20:13455938-13455960 CACTTTTGGCACCTGGCGAGTGG - Intronic
1171971806 20:31569454-31569476 CACTTTTCCCACCTGGCTCCCGG - Exonic
1173765583 20:45606438-45606460 CACTTTGAGTACCTGTAGTCAGG + Intergenic
1174952172 20:55054219-55054241 AACTTTCTGCACCTGGAGGCAGG - Intergenic
1175223174 20:57429143-57429165 CACGTTCAGCAGCTGGATCCTGG - Intergenic
1175270556 20:57730939-57730961 CACTATTGGCATTTGGAGCCAGG + Intergenic
1175900769 20:62359107-62359129 CACCTGTAGCACCTGCAGCGTGG + Intronic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1179025718 21:37676827-37676849 CACTATTGGCATTTGGAGCCAGG - Intronic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1183168662 22:36167379-36167401 CACTTGGATCACCTGGAGTCAGG + Intergenic
1183653725 22:39173396-39173418 CTCTCTGACCACCTGGAGCCAGG + Intergenic
949340392 3:3023597-3023619 CAGTTTTAGGGACTGGAGCCTGG + Intronic
954693098 3:52406286-52406308 CACCTTCAGCACATGCAGCCTGG + Exonic
954854896 3:53635556-53635578 CATTTGGAGCACCTGGAGGCAGG - Intronic
960654620 3:119989413-119989435 CACATGTATCACCTGAAGCCAGG + Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
966514739 3:180806319-180806341 AACGTTTAGTACCTGGAGTCCGG + Intronic
968023891 3:195421470-195421492 CACTACTAGCACCTGTCGCCAGG + Intronic
979354044 4:119681459-119681481 AGCTTTTACCACCTGGTGCCTGG - Intergenic
983064411 4:163192529-163192551 CAGTTTAAGCTGCTGGAGCCTGG + Intergenic
988377449 5:30455645-30455667 CACGTTTAGCACATGTATCCCGG - Intergenic
990840816 5:60077511-60077533 CACTGCAAGCACCTGCAGCCAGG + Intronic
990922132 5:60979366-60979388 CACTTTTAGGCCCTGGCTCCTGG + Intronic
996036290 5:118762541-118762563 CAATTTTGGCAACTGCAGCCAGG + Intergenic
997787005 5:136722825-136722847 CAGTTTTGTCATCTGGAGCCTGG - Intergenic
998160210 5:139808942-139808964 CATCTTTGGCTCCTGGAGCCAGG + Intronic
1001672710 5:173487436-173487458 CACTGGTAACAACTGGAGCCAGG - Intergenic
1003492543 6:6636164-6636186 CACTTTGAGAACCTCTAGCCTGG + Intronic
1004207736 6:13608004-13608026 CACTTTTAGGAGCTTGAGCTAGG - Intronic
1004454553 6:15779760-15779782 CACTTTCAGGAGCTGGATCCAGG - Intergenic
1006519036 6:34560993-34561015 GCCTTTTCGCAGCTGGAGCCTGG - Intergenic
1007224457 6:40303091-40303113 CACTTGCAGCACCTGCAGCCAGG + Intergenic
1007449376 6:41931527-41931549 CCCTTTTCAAACCTGGAGCCTGG + Exonic
1010574028 6:77510419-77510441 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1011755493 6:90494515-90494537 CAGTATTAGAGCCTGGAGCCAGG - Intergenic
1016737972 6:147500988-147501010 CACTTTGAGAAGCTGGGGCCAGG + Intergenic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1018360560 6:163063261-163063283 CACTTTCACCCCCTGGATCCAGG + Intronic
1020689010 7:11331335-11331357 CACTTAAAGCATCTGGAGTCTGG + Intergenic
1025868229 7:65405908-65405930 CATTTTGAGCCACTGGAGCCAGG - Intergenic
1028291567 7:89071977-89071999 CATTTTTATCACCTGCAGCAAGG - Intronic
1028610294 7:92702854-92702876 CACTTTTGGCATTTGGAGCCAGG + Intronic
1029019290 7:97347379-97347401 CACTTTTACCAACTGGTGGCTGG - Intergenic
1030615627 7:111735135-111735157 CACCCCTAGCAGCTGGAGCCTGG - Exonic
1030621822 7:111798293-111798315 CAGTTTGAGCTGCTGGAGCCAGG - Intronic
1033685818 7:143640475-143640497 CATTTTTAGCCCCTCGAGACAGG - Intronic
1033689925 7:143726840-143726862 CATTTTTAGCCCCTCGAGACAGG + Intronic
1033698796 7:143817146-143817168 CATTTTTAGCCCCTCGAGACAGG + Intergenic
1034205308 7:149309434-149309456 AACTTTTAGCTCCTGAGGCCGGG + Intergenic
1034400301 7:150857465-150857487 CACGTTCAGGACCTGCAGCCCGG - Exonic
1041105892 8:54443751-54443773 CACAGCTATCACCTGGAGCCAGG - Intergenic
1042003365 8:64152384-64152406 CACTTTCAGCATCTGGCTCCTGG + Intergenic
1045098177 8:98819979-98820001 AACTTGTAGCATCTGTAGCCCGG - Intronic
1045772016 8:105753280-105753302 GACTTTTAGCACTTGGAGGTTGG + Intronic
1050719083 9:8564451-8564473 CACTTTGAGAAGCTGGAGGCGGG + Intronic
1050752590 9:8958123-8958145 CACATTTAGCACCTGCAGGATGG - Intronic
1052842073 9:33300687-33300709 GACTTTGAGCTCCTGGAGCCAGG + Intronic
1053015510 9:34659854-34659876 CACCTGGAGCACCTGGAGCCCGG + Exonic
1053366228 9:37524400-37524422 CACTTGTAGCTCCTGGAACACGG + Intronic
1054919286 9:70525909-70525931 AGGTTTTATCACCTGGAGCCTGG + Intergenic
1056751418 9:89354382-89354404 GACTTTTGGAAGCTGGAGCCTGG - Intronic
1057881732 9:98797049-98797071 CGCTTTTAGCCCCAGCAGCCTGG - Intergenic
1058503645 9:105647546-105647568 CACTCTAAGCGCCTGGAGCTGGG + Intergenic
1060999546 9:127895437-127895459 CACCTGCAGCACCTGGAGGCTGG + Intronic
1062351753 9:136142999-136143021 CAGTTTTACAACCTGGAGACAGG - Intergenic
1185523672 X:760792-760814 CACGTCCAGCACCTGGAGGCTGG - Intergenic
1189523035 X:41790236-41790258 CAACTTTAGCACCTGGAGATGGG + Intronic
1190358766 X:49629784-49629806 TACATTAAGGACCTGGAGCCAGG + Intergenic
1197355916 X:125437384-125437406 CAGTTTAAGCCACTGGAGCCAGG + Intergenic
1199916127 X:152342851-152342873 CACTTTTAACACCTGGTACATGG - Intronic