ID: 905011680

View in Genome Browser
Species Human (GRCh38)
Location 1:34751380-34751402
Sequence TCCTTTCTTTCGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 6, 3: 36, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905011680_905011685 28 Left 905011680 1:34751380-34751402 CCTTCCACATTCGAAAGAAAGGA 0: 1
1: 1
2: 6
3: 36
4: 258
Right 905011685 1:34751431-34751453 TGACCAAGGCCACATAGTTAGGG 0: 1
1: 0
2: 3
3: 43
4: 212
905011680_905011683 14 Left 905011680 1:34751380-34751402 CCTTCCACATTCGAAAGAAAGGA 0: 1
1: 1
2: 6
3: 36
4: 258
Right 905011683 1:34751417-34751439 GAGAAAAAATGAGTTGACCAAGG 0: 1
1: 0
2: 2
3: 65
4: 722
905011680_905011684 27 Left 905011680 1:34751380-34751402 CCTTCCACATTCGAAAGAAAGGA 0: 1
1: 1
2: 6
3: 36
4: 258
Right 905011684 1:34751430-34751452 TTGACCAAGGCCACATAGTTAGG 0: 1
1: 0
2: 13
3: 79
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905011680 Original CRISPR TCCTTTCTTTCGAATGTGGA AGG (reversed) Intronic
900904713 1:5546798-5546820 TTTTTTCTTTCCAATTTGGATGG - Intergenic
901531314 1:9854588-9854610 TTCTTCCTTTCCAATCTGGATGG - Intronic
901720355 1:11192445-11192467 TCCTTTCTTTAAACTGTGAATGG - Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
902739143 1:18422588-18422610 TCCTTTTTTTCGAATGTGTAAGG - Intergenic
904436676 1:30503244-30503266 TCCTTTCTTTCGGTTGTTCAAGG + Intergenic
904976436 1:34460514-34460536 CCCTTTATTAGGAATGTGGAGGG - Intergenic
905011680 1:34751380-34751402 TCCTTTCTTTCGAATGTGGAAGG - Intronic
906776244 1:48532121-48532143 TCATTCCTTTCTAATGGGGAAGG + Intergenic
907512488 1:54972357-54972379 TCCCTTCTGTCCAATGGGGAGGG - Intergenic
907973881 1:59412308-59412330 TCCTTTCTCTCTATCGTGGATGG + Intronic
908637143 1:66179952-66179974 TCCTTTCTATAGAATAGGGATGG - Intronic
909206880 1:72769801-72769823 GCCTTTCTTTGGAATGTGTAAGG - Intergenic
910701412 1:90078874-90078896 TTCTTTCTTTCTCATTTGGATGG + Intergenic
911044872 1:93620048-93620070 TCCCTTCTTTCGAAGGGGGAAGG - Intronic
912231809 1:107802315-107802337 TTCTTCCTTTCCAATATGGATGG + Intronic
912994286 1:114517660-114517682 ACCTTTCTTTGGAATGTGCAAGG + Intergenic
913218032 1:116636767-116636789 TGCTGTCTTTGGAGTGTGGAAGG - Intronic
914220008 1:145672774-145672796 TTCCTTCTTTAGAATCTGGAGGG + Exonic
914472588 1:147995640-147995662 TTCCTTCTTTAGAATCTGGAGGG + Intergenic
914779213 1:150769098-150769120 TCCTTTCTTTCTAATATGACAGG + Intergenic
915251586 1:154593189-154593211 TCCTTTCTGTCTACTGTGGCTGG - Intronic
915618424 1:157060902-157060924 TCCTTCCTTTCCAATTTGGATGG + Intergenic
917195343 1:172458250-172458272 TTCTTTCTTTCTAATGTGGATGG - Intronic
919854263 1:201694959-201694981 TCCTTGCTTCCAAATGTAGAGGG + Intronic
920040777 1:203094591-203094613 GCCTTTCTTTGGTGTGTGGATGG + Intronic
920301771 1:204993331-204993353 TCCTTACATTCCAAGGTGGAAGG - Intronic
1063255301 10:4320917-4320939 TTCTTTCTTTGGCATGTAGAAGG + Intergenic
1064509365 10:16072686-16072708 TCATTTTTTACGAATGTGTATGG - Intergenic
1065865052 10:29907613-29907635 TCCTTTTTTTGGAGTGGGGAGGG + Intergenic
1065922154 10:30402266-30402288 TCCTTTTTTTGGAATGTGCAGGG + Intergenic
1066148427 10:32587718-32587740 TTCTTCCTTTCCAATTTGGATGG + Intronic
1067909331 10:50329793-50329815 TGGCTTCTTTTGAATGTGGAAGG - Intronic
1068158741 10:53235968-53235990 TCCTTTCTGACAAATGTGTATGG + Intergenic
1068433766 10:56964939-56964961 TTCTTTTTTTCCTATGTGGATGG - Intergenic
1068436754 10:57002613-57002635 TGTTTTCTTTCCAATGAGGATGG + Intergenic
1068533854 10:58218186-58218208 ACCCTTCTTTCAAGTGTGGAAGG - Intronic
1069633195 10:69910097-69910119 TGGTTTCTTTGGGATGTGGAGGG + Intronic
1070445327 10:76494131-76494153 TTCTTTCTTTCCAATGTAGTTGG + Intronic
1071014265 10:80976065-80976087 ACATTTCTTTTGAATGTGAATGG + Intergenic
1071667515 10:87575337-87575359 TTCTTCCTTTCCAATTTGGATGG + Intergenic
1071850999 10:89570333-89570355 TACTTTCTTTGGCATGAGGAAGG - Intergenic
1073873421 10:107892601-107892623 TTCTTCCTTTCTAATTTGGATGG + Intergenic
1076578376 10:131488564-131488586 TTCTTCCTTTCAAATCTGGATGG - Intergenic
1079384403 11:19966154-19966176 ACCTTCCTCTCGAATCTGGAGGG - Intronic
1080090994 11:28348885-28348907 TCCTTTCTTTCTATTATGAAAGG + Intergenic
1080992720 11:37558883-37558905 TCCTCTCTTTCAATTGTGAAAGG + Intergenic
1082916805 11:58446363-58446385 ACCTTTCTTTCGAAGATGGGAGG + Intergenic
1083101064 11:60306644-60306666 TCCCTTCTCTCAAGTGTGGATGG - Intronic
1083567101 11:63728476-63728498 ACCTTTCTTTGGCATGTGCAGGG + Intronic
1083690665 11:64406619-64406641 TCCTCTCTTTGGAATGTGCAGGG - Intergenic
1086019551 11:82210194-82210216 TCCCTTCTTTCTCATCTGGAGGG + Intergenic
1086492438 11:87369100-87369122 TCCTGTTTTTCGACTGAGGAAGG - Intergenic
1086524671 11:87711362-87711384 TCCTTCCTTTGGAAAGGGGAGGG + Intergenic
1090999221 11:131894373-131894395 CCCTTACTTTCTTATGTGGAAGG - Intronic
1091205864 11:133820629-133820651 TCCTTTCCTTCTAAGGGGGATGG + Intergenic
1092746886 12:11681103-11681125 TAATTTCTTTCTAATATGGATGG + Intronic
1095724088 12:45433315-45433337 GCCTTTCCTTCTCATGTGGATGG + Intronic
1096429230 12:51529709-51529731 TCCTTTCTTTGGAATGTGCAAGG - Intergenic
1096888780 12:54744833-54744855 TCCTTTGTTTGGAATGTGCAGGG + Intergenic
1098503325 12:71220058-71220080 TCCTTGCTTTCCAAGGTGAATGG + Intronic
1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG + Intergenic
1100814697 12:98375094-98375116 ACATTTCTTTCAAATGTGGAAGG - Intergenic
1101484316 12:105136943-105136965 TACTTTCTTTCACATGTGGTGGG + Intronic
1101934004 12:109041118-109041140 TGTTTTCTTTCTAATCTGGAAGG - Intronic
1102673700 12:114641787-114641809 TCCTCTGTATCAAATGTGGATGG + Intergenic
1103967440 12:124648871-124648893 TCTTTTCTTTGGAATGTGCAGGG - Intergenic
1104146022 12:126034654-126034676 TCCATCCTTTTGAATGTGGAGGG + Intergenic
1106965996 13:35068557-35068579 TACTTTTTTTTGAATGAGGAGGG - Intronic
1110980209 13:81888677-81888699 TTCTTTCTTTCCAATTTGTATGG - Intergenic
1112083541 13:96003486-96003508 TCCATTCTTTTGAATCTGGCTGG + Intronic
1112209493 13:97361708-97361730 TTCTTTCATTCCAGTGTGGAGGG - Intronic
1112457143 13:99573318-99573340 TCCTTTCTTTTGAAGGTTTAAGG + Intergenic
1113170867 13:107501647-107501669 TACTTTCTGTTGAATGTGTATGG + Intronic
1115706265 14:36002128-36002150 GCCTTTCTTTGGAATGTTCAGGG - Intergenic
1116728768 14:48595838-48595860 TTCTTTCTTTGGAGTGTGCAGGG + Intergenic
1121040949 14:90746934-90746956 TCCTTCCTTTGGAATGTACAGGG - Intronic
1122759555 14:104012327-104012349 GCCTTTCTCTGGAATGTGCATGG + Intronic
1124626579 15:31311090-31311112 TCCTTTTTTGCAAATGTGTAGGG + Intergenic
1125118990 15:36130189-36130211 TCCTTTCTTTTGAACTTTGATGG - Intergenic
1128307643 15:66610509-66610531 TGCTTTCTTTCTAACATGGAAGG + Intronic
1129834526 15:78693710-78693732 TCCTCTTTTTGGAATGTGCAGGG - Intronic
1130071586 15:80650955-80650977 TCCTTTCTTTGGAACATGCAGGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131885236 15:96905208-96905230 TCATTTCTCTAGAATGTAGATGG + Intergenic
1132008221 15:98250043-98250065 TCTTTTATTTGGAAAGTGGAAGG - Intergenic
1132083764 15:98889657-98889679 TCCTTTCTTATGTATGTGCATGG - Intronic
1135301856 16:21335717-21335739 TTCTTTCTTTCCAATTTGAATGG + Intergenic
1135426178 16:22338672-22338694 TCTTTTCTTTCTGATGTGGGTGG - Intergenic
1135515124 16:23125513-23125535 TCCTTTCTTTCCCATCTGAAGGG + Intronic
1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG + Intronic
1136314121 16:29440504-29440526 TCCTGTGTTTCGTATGTGGCTGG - Intergenic
1136327560 16:29542269-29542291 TCCTGTGTTTCGTATGTGGCTGG - Intergenic
1136442249 16:30282269-30282291 TCCTGTGTTTCGTATGTGGCTGG - Intergenic
1136489830 16:30599836-30599858 AGCTTTCTTTGGAATGTGCAGGG + Intergenic
1137006278 16:35276663-35276685 TCCTTTGTTTAGAAAGGGGAGGG + Intergenic
1137904668 16:52309157-52309179 TCCTTACTTTCTAATGAGGTAGG - Intergenic
1138650231 16:58456281-58456303 CCCCTTCTTTGGAATGTGCAGGG - Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1142779900 17:2173516-2173538 TCCTTTCTCTCATTTGTGGAAGG + Intronic
1146601027 17:34216190-34216212 TTCTTCCTTTCCAATCTGGATGG + Intergenic
1149697974 17:58631853-58631875 GAGTTTCTTTCGCATGTGGAAGG - Intronic
1150371986 17:64646889-64646911 GCCTTTCTTTGTAAAGTGGAAGG + Intronic
1150655898 17:67039212-67039234 TTCTTTCTTTGGAATGTGTAGGG + Intergenic
1151561043 17:74869723-74869745 ACCTGACATTCGAATGTGGAGGG - Intronic
1154034284 18:10784342-10784364 TTCTTTATTTCCAAAGTGGAAGG + Intronic
1155946302 18:31855979-31856001 TTCTTTCTATCCAATTTGGAAGG + Intronic
1156691681 18:39714946-39714968 TCAATTCTTTCAAATGTTGAAGG + Intergenic
1157342243 18:46789799-46789821 TCCTTTATTTGGCATGTGCAGGG - Intergenic
1157754859 18:50208572-50208594 TCCTTTCTTTGGAATGTGCAGGG + Intergenic
1157817110 18:50737385-50737407 GCCTTTCTTTGAAATGTGCAGGG + Intergenic
1158080444 18:53583728-53583750 ACTTCTCTTTCGAATATGGAAGG + Intergenic
1162820105 19:13217795-13217817 TCCTTTCATCGGAATGTGCAGGG - Intronic
1164492697 19:28729146-28729168 TCCTTTCTTTAGGATATGGAGGG - Intergenic
1167097858 19:47384601-47384623 TCCTTTCTTTCCAAGGAAGAAGG + Intergenic
1167242895 19:48355703-48355725 TCCTTTCTTTGGAATGTGCGGGG - Intronic
1167828507 19:51997594-51997616 TTCTTTCTTTGGAATGTGTAGGG - Intronic
1168006482 19:53493753-53493775 TTCTTTCTTTCTGATTTGGATGG + Exonic
1168141366 19:54389678-54389700 TCCTTTCCTAAGAATGAGGAAGG + Intergenic
926378595 2:12261069-12261091 TCATTTGATTGGAATGTGGAAGG + Intergenic
926796448 2:16623274-16623296 TCCTTTCCTTCTTATGTGCAAGG - Intronic
927011410 2:18908427-18908449 TCCTTTCTTTAGAATAGGGCTGG + Intergenic
927059452 2:19401982-19402004 TACTTTCTTTTGTATATGGATGG - Intergenic
927286249 2:21360101-21360123 TCCTCTCTTTGGAATGGAGAGGG + Intergenic
929677449 2:43951344-43951366 TCCTGTTTTTCAAATGTGGTAGG - Intronic
932061318 2:68501708-68501730 TACTTTGATTTGAATGTGGATGG + Intronic
932369467 2:71175405-71175427 TCCTTTTTTTGGGATGTGCAGGG - Intergenic
933208885 2:79542256-79542278 TTCTTTCTTTCGATTTTGAAGGG - Intronic
933784296 2:85826904-85826926 TTCTTCCTTTCCAATATGGATGG + Intergenic
936950100 2:117969057-117969079 CCCTTTCTTTTGGGTGTGGACGG + Intronic
937425008 2:121791363-121791385 TCTCTTCTGTCGAATGTGGGCGG + Intergenic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
939811577 2:146839462-146839484 TCCTTTCTTTGGAATGGGCAAGG - Intergenic
940359471 2:152782035-152782057 GCCTTTCTTTGGAATGTGCAGGG - Intergenic
941713288 2:168737355-168737377 TCCTTTTTCTCTAATGTGTAAGG + Intronic
941766126 2:169298649-169298671 TCCCTTCTTCCTAATGTGGATGG - Intronic
941803773 2:169689574-169689596 TTCTTCCTTTCCAATCTGGATGG + Intronic
942733643 2:179085754-179085776 TTCTTTGTTTCTAATTTGGATGG + Intergenic
943294740 2:186122912-186122934 TTCTTTCTATCTAATTTGGATGG - Intergenic
944462229 2:199961954-199961976 TCCTTTCTTCAGAAAATGGAAGG + Intronic
944484246 2:200187459-200187481 GTCTTCCTTTCTAATGTGGATGG - Intergenic
944640593 2:201720867-201720889 TTCTTTCTTTACAATATGGAAGG - Intronic
945318925 2:208399298-208399320 GCCTTTCTTGGGAATGTGCAGGG - Intronic
946093646 2:217252828-217252850 GCCTTTCTTACCAATGTGGCTGG + Intergenic
947601701 2:231455149-231455171 TCCTTTCTTTCAAATGGAAAAGG + Exonic
947686020 2:232085641-232085663 TGCTTTTTTGCTAATGTGGATGG + Intronic
948245609 2:236481753-236481775 TTCTTTCTTTTGTATGTGCATGG + Intronic
1170407327 20:16051984-16052006 TCATTTATTTCAAATGTGGGTGG + Exonic
1170725463 20:18922311-18922333 CTCTTTCTTTCGAATCTGGGTGG + Intergenic
1171446754 20:25209981-25210003 TCTTTTCCTTTGAATGTGGTAGG + Intronic
1171803888 20:29656251-29656273 TTCTTCCTTTCCAATTTGGAAGG - Intergenic
1172220853 20:33273889-33273911 TACTTTCTTTCTAAGGGGGAAGG - Intronic
1172350702 20:34237612-34237634 TCCTTCCTTTTTAATGCGGATGG + Intronic
1173336693 20:42117813-42117835 TCCTTTCTTTTTAAGATGGAAGG + Intronic
1174961334 20:55160475-55160497 TCCTTTATTTAGAATGTGTAGGG + Intergenic
1175139506 20:56849856-56849878 TCATTTCTTTCTGATGTAGAAGG + Intergenic
1175434634 20:58935563-58935585 TTCTTCCTTTCCAATTTGGATGG - Intergenic
1176551837 21:8226527-8226549 TCCTTTCTTGCGTTTGAGGAGGG + Intergenic
1176570746 21:8409526-8409548 TCCTTTCTTGCGTTTGAGGAGGG + Intergenic
1176578655 21:8453673-8453695 TCCTTTCTTGCGTTTGAGGAGGG + Intergenic
1177331564 21:19671754-19671776 TTCTTTCTTTCCAATTCGGATGG - Intergenic
1177808457 21:25899359-25899381 TCCCTTCCTTCGAATGTGGTCGG + Intronic
1177851513 21:26354539-26354561 TTATTTCTTTCTAATGTGTATGG + Intergenic
1177948776 21:27507360-27507382 TCCTTTCTATAGATTTTGGAAGG - Intergenic
1178059204 21:28833898-28833920 GCCTTTCTTGGGAATGTGCAAGG - Intergenic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1178167684 21:29999325-29999347 TCCCTCCTTTCTAATGTGCAGGG + Intergenic
1178493037 21:33066161-33066183 GTCTTTATTTCCAATGTGGAAGG - Intergenic
1180819333 22:18814851-18814873 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
1181205558 22:21249296-21249318 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
1183596532 22:38815913-38815935 TCCTTTCTTTGGAATGCACAGGG - Intergenic
1184061198 22:42082794-42082816 TCCTTTCATTTGAAAGTTGACGG + Intronic
1203221365 22_KI270731v1_random:46117-46139 TGCTGTCTTTGGAGTGTGGAAGG + Intergenic
1203256858 22_KI270733v1_random:143449-143471 TCCTTTCTTGCGTTTGAGGAGGG + Intergenic
1203269461 22_KI270734v1_random:40704-40726 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
949330323 3:2915458-2915480 TCTTTCCTTTCCAATTTGGATGG + Intronic
950207386 3:11091567-11091589 TCCTTTCTTTGGAATCCTGAAGG - Intergenic
951274243 3:20665793-20665815 TCCTTTCTTTTTCATGTGGCTGG + Intergenic
951368211 3:21811952-21811974 TACTTTCTTTAGAATTTTGAAGG - Intronic
953600516 3:44359290-44359312 ACCTTTCTTTGGAATGTGCAAGG - Intronic
955393828 3:58540621-58540643 TCCTTTCTTTGGACTATGCAGGG + Intergenic
956082764 3:65577255-65577277 TTATTTCTTTCATATGTGGAGGG - Intronic
957454781 3:80427473-80427495 TTCTTTGTTTCCAATTTGGATGG - Intergenic
958706277 3:97660366-97660388 TCATTTCTTTCCAATGTGAATGG - Intronic
958821773 3:98982738-98982760 TCCTTTCTCTGCATTGTGGAAGG + Intergenic
958869689 3:99543292-99543314 TCCTTTCTATCGATTTTGCAAGG + Intergenic
959306989 3:104680061-104680083 TTCTTGCTTTCCAATTTGGATGG - Intergenic
961071878 3:123938560-123938582 TCTTTCCTTTCCAATGTGGCTGG + Intronic
964784468 3:160379969-160379991 TCTTTTCCTTTGCATGTGGATGG + Intronic
964833989 3:160916840-160916862 TCTTTTCTTTCCTATTTGGAGGG - Intronic
966088072 3:176094548-176094570 TTCTTTCTTTCTAATCTGAATGG + Intergenic
966148723 3:176842478-176842500 TCCTTTCTGTTGAATGTATAGGG - Intergenic
969211389 4:5690305-5690327 TCCTTTCTCCTGAATGTGGAGGG - Intronic
970545860 4:17129384-17129406 TCCTTTCTTTGGAACGTACAGGG + Intergenic
970558655 4:17260810-17260832 TCCTTTCTTCCACATGTAGATGG + Intergenic
971671918 4:29571528-29571550 TGCTTTCATGCAAATGTGGATGG - Intergenic
972344213 4:38179203-38179225 TACTTTCTTTCGACTGGGGTTGG + Intergenic
972447141 4:39155551-39155573 TCCATTCTTTTGCATGTGTATGG - Intergenic
973608748 4:52613204-52613226 TCCTTTCTTTCCAGTGGGCATGG - Intronic
974134104 4:57792572-57792594 TGCTTTCTTTTGGATGTGGGTGG + Intergenic
974608931 4:64189742-64189764 TTCTTCCTTTCTAATTTGGATGG + Intergenic
974999410 4:69202421-69202443 TCCTTTATTTCCAATATGGCTGG + Intronic
975056239 4:69933969-69933991 TCCTTTCTTTAGATTATGGCTGG - Intronic
975469570 4:74749550-74749572 TCCTTTCTTTGCAATGTGCTAGG - Intronic
975902572 4:79170037-79170059 CCCTTTCTTTTGAATTTGGGTGG + Intergenic
976517720 4:85989332-85989354 TTCTTTCTTTCTAATCTTGAGGG - Intronic
977965551 4:103143449-103143471 ACCTTTCTATAGCATGTGGATGG - Intronic
978625878 4:110684587-110684609 TCCTTCCTTCCTAATGTGAAGGG + Intergenic
979489819 4:121312813-121312835 TTCTTCCTTTCCAATCTGGACGG - Intergenic
979830794 4:125298795-125298817 TCCTTTCTTTGGAATGTGCAAGG + Intergenic
981280902 4:142956884-142956906 TCCTTTTTTTGGAATAAGGAAGG - Intergenic
982169172 4:152644639-152644661 TGCTTTCTTTTAGATGTGGATGG + Intronic
982824021 4:159979548-159979570 AACTTTCTTTGGAATGTGTAGGG - Intergenic
983307533 4:166011593-166011615 TTCTTTCTGTCCAATTTGGATGG + Intronic
983658263 4:170105466-170105488 TTTTTTCTTTCTAATTTGGATGG - Intergenic
983882608 4:172950372-172950394 TCCTTTCTTTCTAAGGTGCCTGG - Intronic
988503257 5:31800643-31800665 TCCTTTCTTTGGAATGCACATGG + Intronic
991964225 5:72075125-72075147 TCCTTTCTTTCCATTGTGTTGGG + Intergenic
992617816 5:78562186-78562208 TCCTTTCTTCCCAAAGTGGTGGG - Intronic
993043371 5:82840341-82840363 CCCTTTCTTTCCATTGTGGAAGG - Intergenic
993677440 5:90833855-90833877 TTCTTCCTTTCCAATTTGGATGG + Intronic
993894503 5:93516456-93516478 TACTTTCTTTAGAATGGGAAGGG - Intergenic
994138423 5:96315663-96315685 GCCTTCCCTTTGAATGTGGATGG + Intergenic
995058774 5:107791342-107791364 TCCTTTCTTTGGAATATAAATGG + Intergenic
995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG + Intergenic
996096082 5:119400595-119400617 TCCTTTCTTTGGAATTTGCAGGG + Intergenic
997275804 5:132587766-132587788 TTGTTTTTTTCCAATGTGGATGG - Intronic
998047448 5:138999926-138999948 TTCTTCCTTTCCAATTTGGATGG + Intronic
1003238418 6:4319437-4319459 TCTTCTCTTTCAAATGAGGAAGG - Intergenic
1007063667 6:38967314-38967336 TTCTTCCTTTCCAATGTAGATGG - Intronic
1007150570 6:39686658-39686680 TCATTTTTTTCTAATGTGGGGGG - Intronic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010766717 6:79783542-79783564 TATTTTCTTTTGAATGTGAAAGG + Intergenic
1013392120 6:109696386-109696408 TCCTTTCTTTTGAATATATAAGG - Intronic
1014397289 6:120940808-120940830 TCCTTTCTTTTGAAGAGGGAAGG + Intergenic
1015457215 6:133439940-133439962 ACCTTTCTTTTGAATGTGCAGGG + Intronic
1017056148 6:150437158-150437180 ACATTTCTTTTGAATGTGAACGG - Intergenic
1017468043 6:154713204-154713226 AACTTTCTTTGGAATGTGCAAGG - Intergenic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1019969418 7:4528167-4528189 TTCTTTCTTTGGAATGTGCAGGG - Intergenic
1023087257 7:36583354-36583376 AACTTTCTTTCTAATGTGGATGG + Intronic
1024202750 7:47122919-47122941 TCCTTGCTTCCGAATGGGAACGG - Intergenic
1024577002 7:50772608-50772630 TTCTTCCTTTCCAATTTGGATGG - Intronic
1028084752 7:86622799-86622821 TTCTATCTTTTGAATGAGGATGG + Intergenic
1031209595 7:118805656-118805678 GCCTTTCTTTGGAATGCGGTAGG + Intergenic
1031521639 7:122773827-122773849 TCATTTCTTTAAAATGTGAAAGG - Intronic
1032448225 7:132003142-132003164 TTCTTTCTTTCCTATGTGGAAGG + Intergenic
1032732940 7:134662002-134662024 TCCTTTCATTCCAATAGGGAAGG - Exonic
1033063117 7:138127025-138127047 ACCTTTCTTTGGAAGGTGCAGGG - Intergenic
1034589104 7:152124495-152124517 TCCTCTCTCACGAATGTGGGTGG + Intergenic
1039536784 8:38323453-38323475 TCCTTTTTTTCTTAAGTGGAAGG - Intronic
1041080984 8:54214645-54214667 TCTTTTTTCTCGAATCTGGATGG - Intergenic
1041576569 8:59403491-59403513 TTCTTTCTTTCCAATTTAGATGG - Intergenic
1043108863 8:76152093-76152115 TCCTTCCTTTAGCATGTGTATGG - Intergenic
1043600605 8:81933004-81933026 TTCTTCCTTTCCAATTTGGATGG - Intergenic
1046593479 8:116233424-116233446 TACTTTATTTTAAATGTGGAGGG - Intergenic
1048285132 8:133135642-133135664 TCCTATCTTGCAAATGTGGAAGG + Intergenic
1048852488 8:138658234-138658256 ACATTTCTTTGGAATGTGCAGGG - Intronic
1049077150 8:140407547-140407569 CCCTTTCTTTAAAAGGTGGAGGG - Intronic
1050648596 9:7749999-7750021 TTCTTCCTTTCCAATTTGGATGG - Intergenic
1051448646 9:17170349-17170371 TTCTTCCTTTCTAATTTGGATGG + Intronic
1051585486 9:18722588-18722610 TCCTTTCTTTGGGACTTGGAGGG + Intronic
1052130667 9:24842683-24842705 TCTTTTTTTTTGCATGTGGATGG + Intergenic
1052258384 9:26486133-26486155 TTCTTCCTTTCCAATTTGGATGG + Intergenic
1057298657 9:93863859-93863881 CCCTTTCTATAGAATGGGGAGGG - Intergenic
1057451400 9:95164228-95164250 TCCTTCCTTTCCAATTTGGATGG + Intronic
1059034519 9:110739640-110739662 ACCTTTCTTTGGAATGTGTAGGG + Intronic
1059368094 9:113802642-113802664 TTCCTTCTTTCACATGTGGATGG - Intergenic
1060009535 9:120031535-120031557 TTCTTTCTTTAGGATGTTGAGGG + Intergenic
1061083025 9:128383513-128383535 TCCTTTCTTCCAAATCTGAAGGG + Intronic
1061673019 9:132199779-132199801 ATCTTTCTTTGGAATGTGCAGGG + Intronic
1062052486 9:134454799-134454821 ACCTTTCTTTGGAATGTGCAGGG - Intergenic
1062492425 9:136812739-136812761 TCCTTTCTTTCAAATGGGAGAGG + Intronic
1203473016 Un_GL000220v1:125131-125153 TCCTTTCTTGCGTTTGAGGAGGG + Intergenic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186135554 X:6516522-6516544 ATCTTTTTTTAGAATGTGGAGGG + Intergenic
1186357623 X:8803604-8803626 ACCTTTCTTTGGAAAGTGCAGGG + Intergenic
1186583971 X:10851679-10851701 TCCATTCCTTTGAATGTGAATGG - Intergenic
1186686923 X:11934969-11934991 TCTTTTCTTGTGAATGTTGAAGG + Intergenic
1186856163 X:13628208-13628230 ACCTTTCTTTGGAATGTGTATGG + Intronic
1188510014 X:30925808-30925830 CCCTTTCTTTTGAGTGTGGGTGG + Intronic
1189866681 X:45337602-45337624 TTCTTTCTTTCCTATTTGGATGG + Intergenic
1190774838 X:53544414-53544436 TCCTTTTTTCAGAATGTTGATGG - Intronic
1191342289 X:59483912-59483934 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1191344734 X:59516771-59516793 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1191394009 X:60175372-60175394 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1191401273 X:60272894-60272916 TTCTTTCTTTGGAATCTGCAAGG + Intergenic
1191510715 X:61737746-61737768 CCCTTTCTTTGGAATCTGCAAGG + Intergenic
1191512382 X:61760206-61760228 CCCTTTCTTTGGAATCTGCAAGG + Intergenic
1191518487 X:61841989-61842011 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1192063036 X:67850406-67850428 TTCTTCCTTTCCAATTTGGATGG - Intergenic
1192756120 X:74048637-74048659 TCCTTCCTTTCCAATCTGTATGG - Intergenic
1192775937 X:74244550-74244572 TTCTTTCTTTCTAGTGTGTACGG - Intergenic
1193572244 X:83158836-83158858 TGCTTTCTTTCCAATTTGAATGG + Intergenic
1193903137 X:87208130-87208152 TTCTTTCTTTGTAATTTGGATGG - Intergenic
1194850908 X:98867486-98867508 TCTTTTGATTTGAATGTGGAGGG + Intergenic
1195762402 X:108260986-108261008 TCCTTTTTCTCCAATGTGGAAGG - Intronic
1195944769 X:110198110-110198132 TCCCTTCCTTTGACTGTGGATGG - Exonic
1196087843 X:111705652-111705674 TCCTTTTTTTTGCATGTGGATGG + Intronic
1198672312 X:139094156-139094178 TCCTTTCTTAAAAATGTGGCAGG + Intronic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1200128006 X:153826262-153826284 TTCTTCCTTTCCAATCTGGATGG - Intronic