ID: 905012023

View in Genome Browser
Species Human (GRCh38)
Location 1:34754328-34754350
Sequence CCAAGGTGCCCTGTATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905012023 Original CRISPR CCAAGGTGCCCTGTATCAGC AGG (reversed) Intronic
900300571 1:1974755-1974777 CCAAGGGGCACTGTGTCATCTGG - Intronic
905012023 1:34754328-34754350 CCAAGGTGCCCTGTATCAGCAGG - Intronic
906666552 1:47626197-47626219 CCAAGGGGCTCTGTCTCAGTAGG + Intergenic
911477251 1:98388659-98388681 GCAAGTTGCCCTGAGTCAGCAGG - Intergenic
923336684 1:232977125-232977147 CCAAGGTTCCCGGTAAGAGCAGG - Intronic
1076691606 10:132226548-132226570 CCACTGTGCCCAGTCTCAGCTGG + Intronic
1081268441 11:41056853-41056875 CCAAGCTTCCTTGTAGCAGCTGG - Intronic
1083486262 11:62984621-62984643 CCAGGGTGACCTGGATCTGCTGG + Exonic
1085794259 11:79522859-79522881 CCAAATTGCCCTGTATAAGTAGG + Intergenic
1087691289 11:101323461-101323483 CCATGGGGCCTTGTATCAGAAGG + Intergenic
1091011434 11:132004682-132004704 CACAGGTGCATTGTATCAGCTGG + Intronic
1092263432 12:6964050-6964072 CCAGGGTCCCCTGTAGCAACTGG + Intergenic
1094205980 12:27841080-27841102 GCAAGGTACCTTGTTTCAGCTGG - Intergenic
1098185530 12:67892356-67892378 ACAAGGTGACCTGTCTCAGTGGG + Intergenic
1101448740 12:104757115-104757137 CCAAGGTGGCCTGCACCAACTGG + Exonic
1103328299 12:120136419-120136441 ACAAGGTGTCATGTAGCAGCAGG - Intronic
1105210210 13:18253037-18253059 CCCAGGTTCCCAGCATCAGCTGG + Intergenic
1110548861 13:76789606-76789628 CCAGGGGGCCCTGAATCAGCTGG + Intergenic
1113460744 13:110480225-110480247 CCAGGGTCCCCTCTATCACCAGG - Exonic
1113580041 13:111422078-111422100 CCAAAGTGCCTTGTATCCACAGG + Intergenic
1116432545 14:44863709-44863731 CCAGGGTTTCATGTATCAGCTGG + Intergenic
1118859317 14:69650189-69650211 CCAAAGGGCACTGTTTCAGCTGG - Intronic
1120075134 14:80147542-80147564 ACAATGTGCCCTCTATCATCGGG - Intergenic
1121921578 14:97887096-97887118 CCAAAGAGTCCTGTATCAGAAGG + Intergenic
1122298194 14:100717275-100717297 CCTAGATGGTCTGTATCAGCTGG + Intergenic
1123456099 15:20427564-20427586 CCTAGCTGCCCTGTAGGAGCAGG - Intergenic
1123635470 15:22303273-22303295 CCTAGCTGCCCTGTAGGAGCAGG + Intergenic
1124344488 15:28913204-28913226 GCAAGGATCCCTGTATCAGGAGG - Intronic
1127105929 15:55615051-55615073 CCTAGATAACCTGTATCAGCTGG + Exonic
1128612541 15:69085431-69085453 CCAAGGTGGTCTGTATAAGCTGG + Intergenic
1131059552 15:89396070-89396092 CAAGGGTGCCCTGAATCAGAAGG - Intergenic
1132318104 15:100905000-100905022 CCTGGGTGCCATGTATCACCTGG - Intronic
1132558658 16:583735-583757 CCACGGTGCCCCGTAGCAGCAGG + Exonic
1135614817 16:23902107-23902129 CCAAGCTGCCCTCTGTCTGCTGG - Intronic
1136716812 16:32288474-32288496 CCAAGGTGTCCTCTGTCACCAGG - Intergenic
1136835188 16:33494719-33494741 CCAAGGTGTCCTCTGTCACCAGG - Intergenic
1203009615 16_KI270728v1_random:229313-229335 CCAAGGTGTCCTCTGTCACCAGG + Intergenic
1203145361 16_KI270728v1_random:1795040-1795062 CCAAGGTGTCCTCTGTCACCAGG - Intergenic
1142592354 17:1011952-1011974 CCAAGGTGCCCTACATCGTCCGG - Exonic
1143085769 17:4414922-4414944 TATAGGTGCCCTGTATCAGGTGG + Intergenic
1145002794 17:19317347-19317369 CCAAGGTCTTCTGAATCAGCAGG - Intronic
1146824527 17:36011166-36011188 CCAAGGTGGCCTCTTTCAGGAGG - Intergenic
1147017941 17:37507402-37507424 CCCAGGTTCCCTGTAGAAGCCGG - Intronic
1147912192 17:43862335-43862357 CCACGGTCTCCTGCATCAGCTGG + Exonic
1148864110 17:50619709-50619731 CCAGGGAGCCCTGGATCAGCAGG - Exonic
1150282130 17:63934792-63934814 CCCAGGTGTCCTGGATCTGCTGG + Intergenic
1151729277 17:75901317-75901339 CCAAGGCTCCCTGCAACAGCTGG - Intronic
1155544248 18:26899237-26899259 CCAAGGTGACCTGTAACTTCTGG + Intergenic
1160018856 18:75165066-75165088 CCAGGGTACCCTGTAGGAGCTGG + Intergenic
1161540917 19:4850945-4850967 CCAAGGAGTTCTGGATCAGCTGG + Intronic
1163387697 19:17009871-17009893 CCCCGGTGCCTTGTATCAGGAGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167375469 19:49108597-49108619 CCGAGGTGCCCACTATCAACAGG - Intronic
926118682 2:10229239-10229261 TCTAGGTGCCCTGTCTCAGATGG + Intergenic
926479771 2:13377602-13377624 CCTAGCTGCCCTGTAGGAGCAGG + Intergenic
927908604 2:26880450-26880472 CCAGGGTGCCCTGGCACAGCGGG - Intronic
928636941 2:33256383-33256405 CCAAAATGCCATGTATCAGCTGG - Intronic
929799157 2:45084568-45084590 CCAAGCTGCCCAGTACCAGAGGG - Intergenic
934659236 2:96134344-96134366 CCAGGGTGCCCTGAATCAGAAGG + Intronic
936241836 2:110794551-110794573 CCACTGTGCCCTGTGTCAGGAGG + Intronic
938236803 2:129712062-129712084 CCAGGGTGCACTGCATCTGCTGG - Intergenic
940030513 2:149257261-149257283 CCCAGGTGCTCTGTCTCAGGGGG + Intergenic
1169197792 20:3692778-3692800 CCAAGGAGGCCAGGATCAGCCGG + Intronic
1170769512 20:19319785-19319807 CCAAGATGCTCTGTACCAGCTGG - Intronic
1175670581 20:60899563-60899585 CTAATGTGCCCTGAATCAGAGGG - Intergenic
1176102086 20:63368932-63368954 CCAAAGTGAACTGTGTCAGCAGG + Intronic
1176268551 20:64223449-64223471 CCAAGGTGCCAAGCCTCAGCTGG + Intronic
1178698053 21:34810920-34810942 CCAAGGTGCACTATTCCAGCGGG + Intronic
1181862922 22:25833376-25833398 CCAAGGTCCCCAGTCTCTGCTGG - Intronic
1182895596 22:33856663-33856685 CCAAGTTGCCGTTTTTCAGCAGG - Intronic
1183831416 22:40420240-40420262 CCAAGGTGCCCTGTCTGATGGGG + Intronic
952269171 3:31815611-31815633 CCAAAGTGCCCTGCCTCTGCTGG + Intronic
953687015 3:45085841-45085863 CCATGGTGCCCTGGAACGGCCGG + Exonic
955977864 3:64495532-64495554 GCAATGTGCCCTGTATCACCGGG + Intergenic
956797945 3:72732960-72732982 CCTTGGTGCCAAGTATCAGCAGG - Intergenic
957519130 3:81296186-81296208 CCATGGTGCACAGCATCAGCTGG + Intergenic
959886995 3:111514588-111514610 TTAAGGTGCCCTGTATCTGCTGG + Intronic
961389099 3:126541890-126541912 CCAAGGTGGCCTGCACCAACTGG + Exonic
962236691 3:133712998-133713020 CTAAGGTGCCCTAAATCATCTGG - Intergenic
962372058 3:134828871-134828893 CCAAGATTTCCTGTATCTGCAGG + Intronic
976757123 4:88510435-88510457 CCAAAGTCCCCTGGATCACCCGG - Intergenic
981352294 4:143745302-143745324 CCAAGATCCACTGTATGAGCTGG - Intergenic
989577272 5:43000225-43000247 CCTAGATACCCTGTATCCGCTGG + Intergenic
996389573 5:122945131-122945153 CCAAGGTGACCTCTAGAAGCTGG - Intronic
998893595 5:146773208-146773230 CCAAGTTGCTCTCCATCAGCTGG - Intronic
1001904836 5:175463077-175463099 CCAAAGTCCCATGTATCAGTTGG + Intergenic
1007828149 6:44617292-44617314 CCAAGGTGCCCTGTATGGCAGGG - Intergenic
1008207411 6:48679433-48679455 CCAAGTTGACCTGAATCAGCAGG + Intergenic
1011015149 6:82746284-82746306 CCAAGGTGCCCAGGATGTGCTGG + Intergenic
1012385885 6:98682028-98682050 CCAAAATACCCTGTATCATCTGG + Intergenic
1016069380 6:139721340-139721362 GCAAGGTGCTCTGTCACAGCTGG + Intergenic
1019481333 7:1268245-1268267 CCGGGGAGCCCTGTAGCAGCTGG + Intergenic
1019693798 7:2433151-2433173 CCAAGGTGGCCTGCACCAACTGG + Exonic
1023940589 7:44766354-44766376 CCAAGGGGCCCTGTCTCCCCAGG + Intronic
1024089553 7:45923972-45923994 ACAAGGTGCCCTTTAGCAGCAGG - Intergenic
1027128470 7:75573815-75573837 CCAAGATGACCTGGATCAGCGGG + Exonic
1029330761 7:99852769-99852791 CATAGATGCCCTGTATCAGGTGG + Intronic
1032706337 7:134423746-134423768 CCAAGGTGCCCTATGCCAGGTGG - Intergenic
1034316401 7:150137199-150137221 CCTGGGTGCCCTGTGTCAGATGG + Intergenic
1034348763 7:150403304-150403326 CAAACCTGCCCTGTCTCAGCGGG - Intronic
1034684600 7:152959024-152959046 CCAAGATCCCCTGCATCAGGAGG + Intergenic
1041007761 8:53512176-53512198 ACAAGATGCCTTTTATCAGCAGG + Intergenic
1041454899 8:58048358-58048380 CAAAGGTGTCAGGTATCAGCAGG - Intronic
1045652446 8:104353731-104353753 CCAAGGTGCCCAGCGTCCGCTGG + Intronic
1045706846 8:104933939-104933961 CCAAGATGGCCTTTATCAGAAGG - Intronic
1048470321 8:134699036-134699058 ACAAGGTGCCCTGGAACACCAGG - Intronic
1048991068 8:139760387-139760409 CCAGGGTGGCCTGTCTCAGGCGG + Intronic
1049258288 8:141625374-141625396 CCAGGGTGCCCTGACTCACCAGG - Intergenic
1049824554 8:144660186-144660208 CCAAGGTGCCCTGGATGGGATGG - Intergenic
1052295756 9:26894727-26894749 CCAAGGTTCCCTCTTTCATCTGG + Intergenic
1055633910 9:78255284-78255306 CCAAAGAGCCCTGAATCAGCTGG - Intronic
1056826362 9:89878965-89878987 CCAAGGGGGCCTGGAGCAGCTGG + Intergenic
1056933763 9:90900007-90900029 CCAAGGCTCCCTGGGTCAGCTGG + Intergenic
1057435697 9:95038633-95038655 CCAAGGTGCCCTGCAAGAGAAGG + Intronic
1057583632 9:96309826-96309848 CCAGGGTGTCCTTGATCAGCTGG - Intergenic
1059245880 9:112849140-112849162 CCAAGGTGCAATGGAACAGCAGG - Intronic
1191038770 X:56056875-56056897 CCAAGGTGCTCTCCAACAGCTGG + Intergenic
1195208416 X:102626369-102626391 CCAAGGAGCCCTGGATCCCCAGG - Intergenic
1196695629 X:118608269-118608291 CCAGGGTTTCATGTATCAGCTGG - Exonic