ID: 905015223

View in Genome Browser
Species Human (GRCh38)
Location 1:34773499-34773521
Sequence CTGGGTCGGGGGCAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4457
Summary {0: 1, 1: 6, 2: 97, 3: 852, 4: 3501}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905015223 Original CRISPR CTGGGTCGGGGGCAAGGGGA GGG Intronic
Too many off-targets to display for this crispr