ID: 905016850

View in Genome Browser
Species Human (GRCh38)
Location 1:34783700-34783722
Sequence GCCTGTCCACGTGTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905016850_905016858 27 Left 905016850 1:34783700-34783722 CCCACACACACACGTGGACAGGC 0: 1
1: 0
2: 1
3: 45
4: 343
Right 905016858 1:34783750-34783772 CACAGAAACAAGGCACACTCAGG 0: 1
1: 0
2: 0
3: 14
4: 214
905016850_905016856 17 Left 905016850 1:34783700-34783722 CCCACACACACACGTGGACAGGC 0: 1
1: 0
2: 1
3: 45
4: 343
Right 905016856 1:34783740-34783762 CCCACAGCAGCACAGAAACAAGG 0: 1
1: 0
2: 2
3: 28
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905016850 Original CRISPR GCCTGTCCACGTGTGTGTGT GGG (reversed) Intronic