ID: 905017268

View in Genome Browser
Species Human (GRCh38)
Location 1:34786271-34786293
Sequence CCCTGGGAGCAGGGTCTGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905017268 Original CRISPR CCCTGGGAGCAGGGTCTGAA AGG (reversed) Exonic
900120816 1:1047962-1047984 TCCTGGGAGCAGGGCCAGGAAGG - Intronic
900409250 1:2505349-2505371 CCCCGGGAGCAGGGGCAGGAGGG - Exonic
900601931 1:3506411-3506433 CCCTGGGGGCAGGGGATGTAGGG - Intronic
900608195 1:3533148-3533170 ACCTGGGAGCAAGGGCTGAGGGG + Intronic
900621753 1:3590730-3590752 CCCTGCCAGCAGGGGCTGGAGGG + Intronic
901192708 1:7422099-7422121 GACTGGCAGGAGGGTCTGAAGGG + Intronic
902404864 1:16177002-16177024 GCCTGGCAGAAGGGGCTGAAAGG - Intergenic
902831290 1:19014591-19014613 CCCTCTGAGCAGGGACTCAAAGG + Intergenic
903535330 1:24062989-24063011 CCCTGGGACCAGGCTCTGCTTGG + Intronic
904906361 1:33900041-33900063 CTCTGGGAGCAGGGTGAGAGGGG + Intronic
905017268 1:34786271-34786293 CCCTGGGAGCAGGGTCTGAAAGG - Exonic
905636796 1:39559428-39559450 CTCTGGGTCCAGGGTCAGAAGGG + Intergenic
905734388 1:40315738-40315760 CCCTGGGAGCGGGGTCCTAGGGG + Intronic
906527876 1:46506940-46506962 CCCTGAGGGCAGAGTCTGATAGG + Intergenic
907513362 1:54978733-54978755 CGCTGGGACCAGTTTCTGAAAGG + Intergenic
907680875 1:56562147-56562169 GTCTGGGAGAAGGGTGTGAAGGG + Intronic
908823089 1:68107940-68107962 CCCGGGGAGCTGGGTCTGGAAGG - Intronic
908845799 1:68323151-68323173 CCCTGGGAGGAGGAACTGAGGGG - Intergenic
909282148 1:73770164-73770186 CCTTGGGAGGAGGCTCTGCATGG + Intergenic
910558503 1:88564345-88564367 CCATGGCAGCAGGGAATGAAAGG + Intergenic
911171432 1:94774412-94774434 CCCTCAGAGCAGTGTCTGAGTGG + Intergenic
912515901 1:110216417-110216439 CCCTGCGGGCAGGGCCTGCAGGG - Intronic
915018774 1:152760633-152760655 CTCTGGGAGCGGCGTCTGATGGG - Exonic
915082638 1:153362411-153362433 CTCTGGGTGCAGGGTTTTAAGGG + Intergenic
915363730 1:155301709-155301731 TCCAGGGAGCAGGGGCTGTAGGG + Intergenic
916019059 1:160776852-160776874 CCCTTGCCCCAGGGTCTGAAGGG + Intergenic
916214731 1:162385106-162385128 CCCTGGGAGAAGGCTGGGAATGG + Intronic
917643889 1:177010381-177010403 GCCTGGCAGCAGGGTCACAAGGG + Intronic
917982347 1:180278163-180278185 CCCAGCCAGCAGGGTCTGGAAGG + Exonic
918064145 1:181088522-181088544 CCCGCGGAGCAGGCTCTTAAAGG - Intergenic
919744858 1:201002349-201002371 CCCTGGGAGCAGGGGCAAAGGGG + Exonic
919824383 1:201493199-201493221 GCCTGGGACCAGGGACTGAGAGG - Intronic
920960008 1:210655619-210655641 CCCTCAGAGCAGGGTCTGTAAGG + Intronic
921127328 1:212189370-212189392 CTCTGGGGGCAGGGTCAGAGAGG - Intergenic
922809021 1:228405898-228405920 CCCCGAGAGCAGGGTCTCATTGG + Intronic
1063010264 10:2014745-2014767 CGCTGGAAGCAGGGTCAGGACGG - Intergenic
1063428896 10:5971526-5971548 TCCTGTGAGCAGAGTCAGAATGG + Intronic
1064157462 10:12915907-12915929 ACCTGGCACCAGGGTCTGCAGGG + Intronic
1066000597 10:31101425-31101447 AGCTGGGAGCAGGGGCAGAACGG - Intergenic
1067225629 10:44374147-44374169 CCTGGGGAGCAGGGTCTGCAGGG - Intronic
1067327207 10:45280977-45280999 CACTGGGGGCAGGGTCGGAGGGG - Intergenic
1067343813 10:45423960-45423982 CCCTGAGAGCTTGGTGTGAAGGG + Intronic
1069627406 10:69876824-69876846 CCCTGGGAGCAGGGACTTTGGGG - Intronic
1070760936 10:79024080-79024102 AGCTGAGAGCAGGGTCTCAAGGG + Intergenic
1076469220 10:130707043-130707065 ACATGGGAGCAGGGACTGTAGGG + Intergenic
1076469233 10:130707089-130707111 ACATGGGAGCAGGGACTGTAGGG + Intergenic
1077062720 11:624916-624938 ACCTGGCAGGAGGGTCTGAGCGG + Exonic
1077109074 11:854202-854224 CCTGGGGAGCAGCGTCTGGAAGG - Intronic
1077158735 11:1103091-1103113 CCATGGGACCAGGGTCTGGTTGG + Intergenic
1077420672 11:2448466-2448488 CCCTGAGAGCTGGCTCTGCATGG - Intronic
1078536920 11:12182759-12182781 CAGTGGGAGGAGGGTCAGAAAGG - Intronic
1078567686 11:12431080-12431102 CCCTGGGAGCAGGGGCAGACAGG - Intronic
1080768061 11:35315147-35315169 TCCTGGGAGCAGTGTGTGGAGGG - Exonic
1081796212 11:45821802-45821824 TCCTGGGAGGAGGGTGTGATTGG + Intergenic
1083838262 11:65287039-65287061 CCCTGGGAGGAGAGTGTGAATGG + Intronic
1083903022 11:65652774-65652796 CCCTGGGTGCAGGCTCCGACGGG - Intergenic
1083949230 11:65944895-65944917 GCCTGGGCCCAGGCTCTGAATGG + Intergenic
1084163679 11:67365088-67365110 AAGTGGGAGCAGGGTTTGAAGGG + Exonic
1084640222 11:70421320-70421342 GCCTGGGAGTAGGATCTCAAAGG + Intronic
1084687158 11:70703466-70703488 CACTGGGGGCAGGGTCCCAAGGG - Intronic
1084873672 11:72115045-72115067 CCTTGAGGGCAGGGACTGAATGG + Intronic
1085176515 11:74493164-74493186 GCCTGGGGGCGGGGTCTGACGGG - Intronic
1085302446 11:75466505-75466527 CTCTGGGAGCAGGGCCAGATTGG - Intronic
1085562812 11:77487550-77487572 CCCTGGGACCAGGGCCCTAAAGG + Intergenic
1085814999 11:79727978-79728000 CCCTGCGAGCAGGTGCTGCAAGG + Intergenic
1089603176 11:119627305-119627327 GTTTGGGTGCAGGGTCTGAAGGG - Intronic
1089691658 11:120190643-120190665 CCCTAGGCCCAGGGGCTGAAGGG - Intergenic
1090026062 11:123168554-123168576 CCCTGGGAGCCGGGTAGGACAGG + Intronic
1090532962 11:127610129-127610151 TCCTGGGAGAAGGGCCTGAGAGG + Intergenic
1091306776 11:134541438-134541460 CCCTGGGAGAAGGCACTGATGGG + Intergenic
1092167695 12:6352978-6353000 CCCTGGGAGGAGGAACTGCAGGG + Intronic
1092765606 12:11850230-11850252 CCAAGGGAGCAGGGTCAGAGGGG - Intronic
1095983150 12:47984035-47984057 CCCTGGGGGCAGGGGCTGGGAGG - Intronic
1096226770 12:49871073-49871095 CTCTGAGAGCAGGGTCCGGAGGG - Intronic
1097023550 12:56037112-56037134 CCCTGGGATTAGGGCCTTAAGGG + Exonic
1099619118 12:84977950-84977972 CCCTGTGAGCAGTTCCTGAACGG + Intergenic
1100087186 12:90925924-90925946 CCCTGGGTCAAGGGTCTGCAAGG + Intronic
1102049930 12:109855209-109855231 CCCTGGGAGCATCTGCTGAAAGG - Intronic
1102969726 12:117156606-117156628 CCCAGGGAGGAAGGTCTGGAGGG + Intronic
1103601379 12:122056862-122056884 CCCTGGGAGCAGGGATCGCAGGG - Intronic
1104212835 12:126706569-126706591 CCCTGACATCAGGGTGTGAAAGG + Intergenic
1104221327 12:126787454-126787476 CTCTGGGAGCAGGGGCTGGCAGG + Intergenic
1104576205 12:129968093-129968115 CCTGAGGAGCAGGGTATGAAAGG + Intergenic
1104603681 12:130171359-130171381 CCCTGGGGGCAGGGGTGGAATGG - Intergenic
1104676358 12:130714730-130714752 CCCTGGGGGCACGGTGTGAGGGG - Intronic
1106000309 13:25716624-25716646 CACTGTCAGCAGGGTGTGAAGGG + Intronic
1107423284 13:40269500-40269522 TCATGGGAGCAGGTTTTGAAAGG - Intergenic
1107963562 13:45579614-45579636 CCCTGGAAGCAGGGTTTGACTGG - Intronic
1111803223 13:93005686-93005708 CCCTGGGTGCATGGTGTGAGGGG + Intergenic
1117841584 14:59866316-59866338 CCCTGGGAGCATGGATTGCAAGG - Intronic
1119262485 14:73245848-73245870 CCCCGGGAGCAGGGTGAGGAAGG - Intronic
1120883127 14:89430303-89430325 CACTGGAAGCAGGTTCTGTATGG - Intronic
1121248896 14:92484743-92484765 GGCTGGGAGTAGGGTGTGAAAGG - Intronic
1123108211 14:105852732-105852754 CTCTTGGAGCAGAGTCTGCATGG + Intergenic
1125887286 15:43238327-43238349 CCCTGGCAGCAGGGTCACAGGGG - Intronic
1126075558 15:44905500-44905522 CCTTGTGTGCAGGCTCTGAAAGG - Intergenic
1126082760 15:44981958-44981980 CCTTGTGTGCAGGCTCTGAAAGG + Intergenic
1126789505 15:52208151-52208173 TCCTGGAAGCAGAGTCGGAATGG + Intronic
1128104642 15:65034524-65034546 CCTTGGGGGTAGGGGCTGAAGGG + Intergenic
1128152165 15:65369889-65369911 CTCTGGGGGCAGGGTCTGGGTGG - Intronic
1129269016 15:74409791-74409813 CCCTGGGAGCCCGGTCTGAGGGG - Exonic
1129884206 15:79027213-79027235 CCTTGGGAGCAGTGTTTGAGAGG - Intronic
1131074440 15:89486413-89486435 CTCTGGGGGCAGGGTCCGACCGG - Intronic
1131873261 15:96781290-96781312 CCATGAGAGCAGGGACTAAAGGG + Intergenic
1132383828 15:101386026-101386048 CCCTGGGAAGATGGTCTGGAAGG - Intronic
1132462856 16:63908-63930 TCCAGGGACCAGGGTCTGAGTGG + Intronic
1132725466 16:1336481-1336503 CCCTGGGTGCAGGCTCTTACGGG - Intronic
1135005611 16:18819364-18819386 CCCTGGGAGGAGGGACGGATGGG - Intronic
1135349817 16:21719228-21719250 CTCTGGCAGAAGGCTCTGAAAGG - Intronic
1136234311 16:28904774-28904796 CCCTGGGAGGAGGCGCTGGAGGG + Exonic
1136399525 16:30010091-30010113 CCCGGGGACCAGGACCTGAAGGG - Exonic
1139638410 16:68273486-68273508 CGCTGGGTGCAGGGTCAGGAAGG + Intronic
1140074861 16:71689119-71689141 TCCTGGGCTCTGGGTCTGAAAGG - Intronic
1140453176 16:75087919-75087941 CTCTGAGAGCAGGCTCTGAGCGG - Intronic
1141982690 16:87560258-87560280 CGTTGGAAGCAGGGTCTGCAGGG + Intergenic
1142292561 16:89199712-89199734 TCCTGGGAGCAGGCTGTGACCGG - Exonic
1142571531 17:878038-878060 CCCTGGGGGCACAGTCTGGAGGG + Intronic
1142591849 17:1009761-1009783 CCTTGGCAGCAGGGTCTGACAGG + Exonic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1144233464 17:13232706-13232728 TCCTGGGACCAGGTTCTGAAGGG + Intergenic
1144582403 17:16466302-16466324 CCATGGGTGCCGAGTCTGAAAGG - Intronic
1144702456 17:17348325-17348347 CCCTGGAGGCAGGGTCAGATAGG + Intergenic
1144806824 17:17973211-17973233 CCGAGGGAGCAGGGCCAGAATGG + Intronic
1146113392 17:30112177-30112199 CAATGGGAGCAGTGTCTAAAAGG + Intergenic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1147140912 17:38460202-38460224 ACCTGGGTGCAGGGTGTCAAGGG - Intronic
1147162749 17:38577601-38577623 CCCTGGGTGAAGGGACTGAGGGG - Intronic
1147553257 17:41460120-41460142 CCCTGGGGGCAGGGTGAGCAAGG + Exonic
1148864747 17:50622647-50622669 CCCTGGGAACAAGGGGTGAAGGG + Intronic
1151034188 17:70779491-70779513 CACTGGGCTCAGGGTCTGCAGGG - Intergenic
1151538222 17:74750369-74750391 CCCTGGTGGCAGTGTCTGATGGG + Intronic
1151586340 17:75010982-75011004 CCCTGGGAGAAAGGCCAGAAAGG - Intergenic
1151732251 17:75918351-75918373 GCCTGGGAGCAAGGGCTGCACGG - Intronic
1152382516 17:79949407-79949429 GGCTGGGAGCAGGGCCTGGAGGG - Intronic
1152570387 17:81119022-81119044 CCGTGGGACCTGGGTCTGCAGGG + Intronic
1152769467 17:82158237-82158259 CCCTGGGAGGAGGCTCAGGAAGG - Intronic
1152840990 17:82568080-82568102 CCCGGGGAGCGGGGTCTTCAGGG + Exonic
1153774616 18:8441641-8441663 CCCTGGGTGCAGGGCCTTGAGGG - Intergenic
1154194092 18:12253620-12253642 CCATGAGAGCAGGGTGTGGACGG + Intergenic
1156455574 18:37291672-37291694 CCCTGTGAGCAGCTGCTGAAAGG - Intronic
1157670232 18:49522195-49522217 CCCATGGAGAAGGATCTGAAAGG - Intergenic
1158201552 18:54947300-54947322 CCCTGGGAGCCCTGTTTGAAAGG - Intronic
1158820223 18:61150710-61150732 CCCTAGGAGCAGGTGCAGAAAGG + Intergenic
1159886692 18:73914391-73914413 CCCTGGGAGGAAGGTGTGTAAGG - Intergenic
1161057969 19:2200150-2200172 CACTGCCAGCAGGGTCTGCAGGG - Intronic
1161425433 19:4200234-4200256 ACCTGGGAGCAGGGTCTGGCTGG - Intronic
1161682815 19:5688425-5688447 ACCTGGTGGCAGGGTCTGAGCGG + Exonic
1161830003 19:6595938-6595960 CCCTGTGAGCAGGCTCAGAGAGG + Intronic
1162152462 19:8655983-8656005 CCCTGAGAGCAGGGCTTGGATGG - Intergenic
1162439217 19:10682405-10682427 TCCTGGGAGCAGGAGCTGAAAGG + Intronic
1162453193 19:10766912-10766934 CCCTGGGAGGAGGGTCAGCCCGG - Intronic
1163034917 19:14564685-14564707 GCCTGGGAGCATGGTGGGAAAGG - Intronic
1163182041 19:15611192-15611214 TCCTGGGAGCTGGGTCTTCATGG + Intergenic
1163582675 19:18147659-18147681 CCCTGGGAGCAAGGGCTGGTGGG + Intronic
1165380238 19:35474318-35474340 CCCTGTGTGCAGGCCCTGAAGGG - Intergenic
1165491810 19:36127904-36127926 CCAGGGGCGCAGCGTCTGAACGG - Intergenic
1166281383 19:41796551-41796573 CCCTGGGAGGAGGCTCAGCATGG + Exonic
1166641292 19:44497441-44497463 TCCTGGGAGCAGGGGCTAATGGG - Intronic
1167158689 19:47754519-47754541 CGCTGAGAGCAGGGTCTGAGGGG - Exonic
1168181305 19:54664525-54664547 TCCTGGCAGCAGGGCATGAACGG - Intronic
925640649 2:5983084-5983106 CCATGGGAGCAGGTTTTAAAAGG + Intergenic
926232694 2:11016939-11016961 CCCAGGCAGCAGGCTCTGAGGGG + Intergenic
927131726 2:20065977-20065999 CCCTGGCAGAAGGGTCTGCTGGG - Intergenic
927189845 2:20510087-20510109 CCCTGAGAGCAGGGTGTGGGAGG - Intergenic
927194294 2:20537211-20537233 CCTGGGGTGCAGGGTCTGGATGG - Intergenic
928671972 2:33611526-33611548 CTCTGGGATCAGGGTTTAAAAGG - Intergenic
931721513 2:65070552-65070574 CCCTGTGAGGAGGCTCTGAGCGG + Intronic
932211044 2:69930834-69930856 CCCTTGGGTCAGGGTCTGACAGG - Intronic
932370920 2:71187110-71187132 CCCTGGGAGAATGGCCTGGATGG + Exonic
933797951 2:85936480-85936502 CCCTGGGAGAAGGGTGTGGCTGG + Intergenic
934561967 2:95318080-95318102 CCCTGGGAGCAGGACCAGGAAGG + Intronic
934725119 2:96611590-96611612 CCCTGGGAGCAGGGACTATGGGG + Intronic
935225272 2:101047251-101047273 CCCTGGGAGCAGGGAGGGTAGGG - Intronic
935664125 2:105495279-105495301 TCGTGGGACCATGGTCTGAAGGG - Intergenic
935889201 2:107657646-107657668 CCCAGGGAGGAGGGAATGAATGG - Intergenic
936519356 2:113201973-113201995 CCCAGGGAGCAGGGTCGCTAAGG + Exonic
937061797 2:118985542-118985564 CCCTGAGAGAAGGTTCTGCAGGG - Intronic
937487509 2:122330808-122330830 CCCTGGGAGGACTGTCTGAATGG + Intergenic
938444430 2:131366561-131366583 CCCTGGGCACAGGGTCTGTGGGG + Intergenic
939875353 2:147571426-147571448 CTCAGGCAGCAGGGGCTGAAGGG + Intergenic
942693530 2:178612879-178612901 CCCTGGGAGCAAGTGCTGAGTGG + Exonic
945918625 2:215731393-215731415 CCCTAAGAGCAGGGTGGGAAAGG + Intergenic
945993574 2:216416751-216416773 TCCTGGGAGCAGGGGCTGGCAGG - Intronic
946515181 2:220403701-220403723 GCCTGGCAGCAGGATCTGATTGG - Intergenic
947241462 2:227998898-227998920 CCCTGGGAACAGACTCTGAGAGG - Intronic
947610010 2:231518929-231518951 CCTGGGGAGAAGGGTCTGACTGG - Intergenic
947612101 2:231530794-231530816 TCCTTGGAGGTGGGTCTGAATGG - Intergenic
948174158 2:235929999-235930021 CGCTGGCAGCAGGGTATGATTGG + Intronic
948998586 2:241597812-241597834 CCCAGGGTGCAGGGGCTGCATGG + Intronic
949021141 2:241742123-241742145 CTCTGTGAGCATGGTGTGAACGG + Intronic
1172274058 20:33670271-33670293 CCCTGGGAGCAGGCACGGGAAGG + Intronic
1173614521 20:44394154-44394176 CCCTGGGAGGAGGGGGAGAACGG + Intronic
1174739612 20:52999295-52999317 CCCTGAGAGCAGGGTCCTGATGG - Intronic
1175524413 20:59623753-59623775 CCGTGTGAGCATGGGCTGAACGG + Intronic
1175893034 20:62323669-62323691 ACCTGGGAGCAGGGTGGGGAGGG + Exonic
1176132684 20:63502936-63502958 CCCGGGCAGCAGGGCCTGGAGGG - Intergenic
1176194789 20:63831903-63831925 CCCGGGGTGCGGGGTCTGGAAGG + Intergenic
1178121359 21:29473485-29473507 TCCTGGGAGCAGTGGCTGAGAGG + Intronic
1178978823 21:37244024-37244046 CCCTCGAAGCAGGCTCTGAGTGG - Intronic
1179480279 21:41672471-41672493 CCCCGGGAGCTGGTTCTGTAAGG - Intergenic
1181487633 22:23241561-23241583 CCCTGGGAAGAGGGTGGGAAGGG - Intronic
1181993650 22:26857750-26857772 CCATGGGGTCAGGGTCTGCATGG - Intergenic
1183417196 22:37689193-37689215 CCCCGGAAGCAGGGAATGAAGGG - Intronic
1184037732 22:41926503-41926525 CCCTGTGGGCAGGGCCTGGAGGG - Intronic
950172862 3:10851603-10851625 GCCTTGGAGCAGGGCCTGGAGGG - Intronic
952759758 3:36903616-36903638 CCCTGGGAGCAGGGCCTATAAGG + Intronic
952952032 3:38533114-38533136 CCCTGAGAGCAGGGTTCCAAGGG - Intronic
953055459 3:39383994-39384016 CCCTGGGGGCAGGCGCTGTAGGG + Intronic
953207452 3:40844053-40844075 CCCTGAGGGCATGGTCTGAAAGG - Intergenic
954109226 3:48424930-48424952 CCCAGGAAGCAGGGTCTGGATGG + Intronic
954137444 3:48588515-48588537 CTTTGGGGGCAGGGTCTGAGAGG - Intronic
954377573 3:50203231-50203253 CCCTGGAAGGAGGATCTGAGCGG + Intergenic
956740658 3:72273256-72273278 TCCTGAGAGCAGGGCCTGGATGG - Intergenic
957394024 3:79617062-79617084 CCCTGGGATGAGGGTATGATAGG + Intronic
960160934 3:114350229-114350251 GCCTGGCAGCAGGGGCTGAGGGG - Intronic
961487592 3:127227605-127227627 CTCCAGGAGGAGGGTCTGAAGGG + Intergenic
961509798 3:127393852-127393874 CCCTGGAAGCAGAGTCTTCAGGG + Intergenic
961558582 3:127713415-127713437 ACCTGGGAGCAGCGCCTGCAAGG - Intronic
961656243 3:128443706-128443728 CCCTGGGGGCAGGGTATGTTGGG - Intergenic
962264818 3:133937345-133937367 CAGCAGGAGCAGGGTCTGAAGGG + Intronic
962851698 3:139312957-139312979 CCTTTGGAGCTGGGTCTGGAAGG + Intronic
963065506 3:141260684-141260706 CCCAGGCAGCAGGGGCTGCATGG + Intronic
965222198 3:165940437-165940459 CCCTGTGAGCAGGAACTGGATGG - Intergenic
967153545 3:186671837-186671859 ACCTGGCAGCAGGAACTGAATGG + Intronic
967299917 3:188002797-188002819 CCCAGGGTGCAAGGTCAGAAAGG - Intergenic
968744484 4:2352639-2352661 CCCTGTGAGAAGGATCTGGAGGG - Intronic
968832421 4:2939895-2939917 CCCTGAGAGCACTCTCTGAAAGG + Intronic
969520500 4:7675356-7675378 CCCTGGGGGCACAGTCTGGAGGG - Intronic
969681331 4:8645014-8645036 CCCTTGGTGCAGGGTCAGCATGG - Intergenic
969846667 4:9925039-9925061 CCGTGGGAGGAGGCTCTGCATGG - Intronic
970068766 4:12130279-12130301 GCCTGGGACCTGGGTCTGTAGGG - Intergenic
972820124 4:42691972-42691994 CCCTGGGAGTAGGGTTAGAAGGG + Intergenic
973861880 4:55073613-55073635 CCGTGTTAGCAGGGACTGAATGG - Intergenic
973875485 4:55214336-55214358 CCCTGGGGGCAGGGTAAGAATGG - Intergenic
976154205 4:82125348-82125370 GCCAGTGAGCAGGGTCTCAAAGG - Intergenic
977722461 4:100255492-100255514 CCCTGGGAGAATGATCTGTATGG - Intergenic
979817510 4:125128533-125128555 GCCTGGGTGCACAGTCTGAAGGG + Intergenic
981762578 4:148210063-148210085 TCCTGGGAGGAGGGTCTGGATGG + Intronic
985372703 4:189303130-189303152 CCCTATGAGCAGGTTCTGAATGG - Intergenic
985822674 5:2170605-2170627 CCCTGGGAGGAAGGCCTGGAGGG - Intergenic
985881218 5:2640533-2640555 CCCTGGGTGTAGGGACTGAGTGG + Intergenic
987933299 5:24429997-24430019 CCCTGGGAGACTGGTCTGAGTGG - Intergenic
991949534 5:71933940-71933962 CCCTTGGAGGATGGACTGAAAGG + Intergenic
993326091 5:86538403-86538425 CCTTGGGAGCAGGACCAGAATGG + Intergenic
996332184 5:122342319-122342341 CCCTGGGAGCAGTGACTCCATGG - Intronic
997569083 5:134912059-134912081 CCCTGAGCGCAAGGTCAGAATGG - Intronic
997615569 5:135243948-135243970 CCCAGGGAGCCGGCTCTGACGGG - Intronic
997778286 5:136630861-136630883 CCCTGGGGGCAGGGATCGAACGG + Intergenic
997794578 5:136795895-136795917 CTCTGGAAGCAGGGTCTGCTGGG - Intergenic
999263541 5:150252055-150252077 GTCTGGGAGCAGGGTTTGCAGGG - Exonic
999270113 5:150291878-150291900 TCCTGGGAACAGCGGCTGAATGG - Intergenic
999371085 5:151055774-151055796 GCCTGGGAGGAGAGTCTGCAGGG + Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1001412248 5:171519921-171519943 TCCTGGGAGAAGGTTCTGGAAGG + Intergenic
1003023797 6:2535253-2535275 CTCTGGGAGCAGGCTGGGAAAGG + Intergenic
1003497695 6:6678753-6678775 CCAGGGGTGCAGAGTCTGAAGGG - Intergenic
1004083770 6:12423200-12423222 CTCTGGAAGCAATGTCTGAAGGG + Intergenic
1006910687 6:37561613-37561635 CTCTGGGAGGAGGGACAGAAGGG + Intergenic
1006910963 6:37563397-37563419 CTCTGGGAGGAGGGACAGAAGGG - Intergenic
1007231259 6:40349068-40349090 CCCTAGAAGCAGGGTTTGAGAGG - Intergenic
1007598985 6:43070207-43070229 CCCTGGAGCCAGGGGCTGAAGGG - Intronic
1007599320 6:43071964-43071986 GGCTGGGAGCAGGGACTGGATGG - Intronic
1007656662 6:43455065-43455087 ACCCGGGAGCGGGGTCTGCAAGG + Intronic
1008043793 6:46831101-46831123 CCCTGGGAACACTGTATGAAAGG + Intronic
1008250681 6:49236124-49236146 CCCTGGGAGAAGGGTGAGAGGGG - Intergenic
1012858580 6:104531816-104531838 CCTTGGGAGCAGAGTCATAAGGG - Intergenic
1016645305 6:146400046-146400068 CCCTGGGGGCTGGGTCAGAGAGG + Intronic
1017493488 6:154964462-154964484 TCCTGGGAGGTGGGTCTGAGTGG + Intronic
1017908001 6:158769967-158769989 CCCTGGGCTGAGGGTTTGAATGG - Intronic
1018655047 6:166026607-166026629 CGCTGGGAGCAGGGGCTGAGAGG - Intergenic
1018907407 6:168083570-168083592 CCATGGGAGGAGGGCGTGAAGGG + Intergenic
1019418714 7:939015-939037 CCCAGGGAGCTGGGCCTGGAAGG + Intronic
1019543064 7:1560154-1560176 CCCTGGGATCTGGGGCTGATGGG - Intronic
1019576509 7:1740194-1740216 CCCTGGGAGCAGGTGCAGATGGG + Intronic
1021215760 7:17913328-17913350 TCCAGGGAACGGGGTCTGAAAGG + Intronic
1022034245 7:26518853-26518875 GGCTGGAAGCAGGGCCTGAATGG + Intergenic
1023528487 7:41129800-41129822 CACATGGTGCAGGGTCTGAAAGG + Intergenic
1023940392 7:44765542-44765564 CGCTGGGGGCAGGGACTGAGGGG - Exonic
1024047656 7:45596248-45596270 CTCTGGGAACAGGTGCTGAATGG - Intronic
1024203754 7:47133485-47133507 CCCGGGGAGCAGGTGTTGAAAGG + Intergenic
1024287566 7:47772577-47772599 ACCTGGGAGAAGGTTCTGTAGGG - Intronic
1024354203 7:48397512-48397534 CCCAGGGGTCAGGGTCTGAAAGG + Intronic
1024358869 7:48446785-48446807 CCCTGGAAGCAAGGTGGGAAGGG + Intronic
1026234791 7:68517703-68517725 CTCTGGCAGGAGGGGCTGAAAGG - Intergenic
1028888180 7:95957768-95957790 ACCCGGGAGTAGGCTCTGAAAGG + Intronic
1030113028 7:106042527-106042549 GGCTGGGAGCAGAGTCAGAAGGG + Intergenic
1030574925 7:111273659-111273681 CCGAGGGAGCAAGGTCTGAAGGG + Intronic
1033134453 7:138773275-138773297 GCCTGGGCGAAGGGCCTGAAGGG - Intronic
1034102666 7:148464320-148464342 TCCTGGCAGCAGACTCTGAAGGG + Intergenic
1035170558 7:157015133-157015155 CCCTGGGAGCTGGGCCTTAAAGG + Intergenic
1037734418 8:21555255-21555277 CCCTGGGAGGATGGTCTCAGAGG - Intergenic
1037813585 8:22100540-22100562 CCCTGGGAGCTGGGTGGGGAAGG + Intronic
1038152037 8:24950641-24950663 CCCTGGGAGAAGGGTTAGAGTGG + Intergenic
1040665683 8:49629889-49629911 CCCTGGTGGCAGGGTTTGCAGGG + Intergenic
1042556712 8:70039438-70039460 CCTTGGGACCAGGGTTTGCAGGG + Intergenic
1047254722 8:123206820-123206842 CCCTCGGGGCAGGGACGGAAGGG - Intronic
1047510747 8:125513459-125513481 ACCTGGGAGCGGGGGCTGCAGGG + Intergenic
1048073328 8:131042312-131042334 CCCGGGGTGCAGGGTCTGCAGGG + Exonic
1048313497 8:133344541-133344563 CCATGGGAGCAGGTGCTGAGAGG - Intergenic
1048886946 8:138916322-138916344 CACTGGCAGCAGGCTCTGCAAGG - Intergenic
1049446584 8:142634238-142634260 CCCTGGGAACAAGGACAGAAAGG + Intergenic
1049588976 8:143446971-143446993 CCCTGGGAGCATGGTCCATAGGG + Intronic
1049651129 8:143770548-143770570 CCCAGGGAGCATGGGCAGAATGG - Intergenic
1049812136 8:144580360-144580382 TCCTGAGAGCAGTGTCTGAGGGG - Intronic
1053303870 9:36970333-36970355 CCCTGAGAGAAGGGGGTGAAAGG + Intronic
1053447469 9:38164137-38164159 CCATGGGTGCAGGGACTGAAGGG + Intergenic
1053653786 9:40195454-40195476 CCCTGGGAACACTGTATGAAAGG - Intergenic
1053904170 9:42824616-42824638 CCCTGGGAACACTGTATGAAAGG - Intergenic
1054530814 9:66180897-66180919 CCCTGGGAACACTGTATGAAAGG + Intergenic
1056710844 9:88991197-88991219 GCCTGGGAACAGGGGCCGAAGGG + Exonic
1059155195 9:111983320-111983342 CCCTGTGATCAGGCTCTGAATGG + Intergenic
1059257913 9:112947688-112947710 CCCTGGGAGGCGGGACAGAATGG + Intergenic
1059378940 9:113908587-113908609 CCCTGGGTGCTGTGTCTGATGGG + Intronic
1060190297 9:121588442-121588464 CCCCAGGAGCAGGCTCTGAGAGG + Intronic
1060962690 9:127692246-127692268 GGCGGGGAGCAGGCTCTGAAAGG - Exonic
1061374752 9:130217312-130217334 CCCTGGGAACAGAGACTGAGGGG + Intronic
1061887722 9:133601051-133601073 CTCTGGGAGCAGGGCCTCAGAGG + Intergenic
1062282757 9:135759335-135759357 CTCTGGGAGCAGGGGATGCAGGG - Intronic
1062318868 9:135980854-135980876 CCAGAGGAGCAGGGTCTGAGAGG + Intergenic
1062357448 9:136171524-136171546 CCCTGGGAACAGCATCTGCAGGG - Intergenic
1185957155 X:4503568-4503590 GCCAGAGAGCAGGGTCTTAATGG + Intergenic
1187507119 X:19887198-19887220 CCCCGGGGGCAGGGTCCGGACGG - Intronic
1188065632 X:25656178-25656200 CCCTGGAACCAGGGTCTGTGGGG + Intergenic
1190920003 X:54841825-54841847 CCCTGGGATGAAAGTCTGAATGG + Intergenic
1193399134 X:81021355-81021377 CTCTGGGAGCACAGGCTGAAAGG + Intergenic
1198227546 X:134659438-134659460 TCCTGGGCGAAGGGTTTGAATGG + Intronic
1202080869 Y:21082905-21082927 CCCTGTGAGCAGGATCTAGAAGG - Intergenic