ID: 905018155

View in Genome Browser
Species Human (GRCh38)
Location 1:34791563-34791585
Sequence CTGAGGAAAGGGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 1, 1: 0, 2: 7, 3: 92, 4: 767}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905018155 Original CRISPR CTGAGGAAAGGGAAGGTGGC AGG (reversed) Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900574998 1:3378687-3378709 GAGAGGACAGGAAAGGTGGCAGG + Intronic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
900719597 1:4166730-4166752 CTCAGGAAAGGGAAGGTGCCTGG - Intergenic
900860369 1:5224726-5224748 GTGAGGAAAGCAAAGGGGGCAGG + Intergenic
900914587 1:5627122-5627144 GTGAGGGAAGGGAATGTGGGAGG + Intergenic
900926542 1:5709709-5709731 CTGATGACAGGGAAGATGGGAGG - Intergenic
901343583 1:8518054-8518076 CTGAAGAAAGGGGAAGGGGCAGG + Intronic
901651140 1:10743843-10743865 TTGAGGAAAGGGAGGGAGGGAGG + Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902057766 1:13616659-13616681 CTGAGGGAAGTGGAGGGGGCAGG - Exonic
902094265 1:13929701-13929723 CATAGGAAAGGGATGGGGGCTGG + Intergenic
902536749 1:17123367-17123389 CAGGGGAAAGGGAATGTGACGGG - Intergenic
902746212 1:18476313-18476335 CTCAGACAAGGGAAGGTCGCAGG + Intergenic
903280233 1:22245964-22245986 CTTAGGAGAGGGAGGGAGGCAGG + Intergenic
903654686 1:24942105-24942127 CTGAGGACACGGATGGGGGCAGG - Intronic
903682783 1:25108280-25108302 CTGGGGACAGGGACAGTGGCTGG + Intergenic
903750686 1:25618406-25618428 CTGAGGCAAGGGAAAGGGGTGGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903962782 1:27067274-27067296 CTAATGAAAGGGAATGTGGTGGG - Intergenic
903967203 1:27098392-27098414 CTGAGAAAAGGCCGGGTGGCTGG - Intergenic
903996473 1:27308036-27308058 GGGAGGAAATGGCAGGTGGCTGG - Exonic
904086970 1:27916190-27916212 GGGAGGAAAGGGGAGGGGGCAGG - Intergenic
904696449 1:32334449-32334471 AGGAGGAAAGGGAACGTGGCTGG + Exonic
904697276 1:32337390-32337412 AGGAGGAAAGGGATGGGGGCTGG + Intergenic
904700986 1:32357954-32357976 CTGAGGAATGGGGAGGGGCCAGG - Intronic
904769278 1:32871851-32871873 CTGAGATGAGGGAAGGGGGCTGG - Intronic
904866959 1:33587023-33587045 GGGAAGGAAGGGAAGGTGGCGGG - Intronic
904896692 1:33823157-33823179 CTGAGGAAAGGGGAGGCGGTAGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
905370474 1:37480123-37480145 CTGGGGAAAGGGGAAGGGGCTGG + Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906726526 1:48048455-48048477 CCTGGGAAAAGGAAGGTGGCTGG + Intergenic
906869010 1:49455777-49455799 ATGAGCAAAGGGAAGGTAGCAGG - Intronic
907038883 1:51240248-51240270 ATGAGGACAGGGAAGCTGGAGGG - Intronic
907303705 1:53502731-53502753 GAGAGGAGAGGGAAGGGGGCAGG + Intergenic
907653781 1:56321782-56321804 CTCAAGAAAGGGTAGGTTGCTGG + Intergenic
907741280 1:57168571-57168593 CCAGGGAAAGGGAAGGTGACAGG - Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908961616 1:69704411-69704433 ATGAGGAAATGGAAGCTGGATGG - Intronic
909134492 1:71780856-71780878 CTCAGAAGAGGGAAGGTGGGTGG - Intronic
909206089 1:72759523-72759545 CTCAGGATAGGGAGGGTGGCAGG - Intergenic
909520973 1:76567035-76567057 ATGAGGACAGGGAAGGAGGGAGG + Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910060245 1:83082657-83082679 CTTGGGAAATGGTAGGTGGCCGG - Intergenic
910551803 1:88483364-88483386 TTAAGGAAATGCAAGGTGGCTGG - Intergenic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911002330 1:93179814-93179836 CGGAGGAAAGGGGAGAAGGCGGG + Intronic
911293407 1:96084355-96084377 CTGAGGAAATGGATGGGAGCTGG + Intergenic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
912308513 1:108595569-108595591 GGGAGGAAAGGGAGGGTGGGAGG + Intronic
912642604 1:111361615-111361637 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913221687 1:116665672-116665694 CTGAAGAAAAGGAAGCTGCCTGG - Intronic
913528129 1:119712849-119712871 CGGAGGAAAGGGAGGCGGGCGGG + Intronic
913665979 1:121049225-121049247 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914017377 1:143832501-143832523 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914655988 1:149741033-149741055 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914750494 1:150531839-150531861 CTGAGGAAAGTGAAGGCTTCAGG - Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915446053 1:155975665-155975687 CTGAGGAATGGAGAGGTGGCTGG - Intronic
916652338 1:166843844-166843866 CTGAGGAAAGGGAGGAGGGCAGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
917838729 1:178960734-178960756 CTGAGGGAGGGGTGGGTGGCAGG - Intergenic
917972504 1:180217805-180217827 ATCAGGAAATGGAGGGTGGCAGG - Intergenic
919039674 1:192367714-192367736 CTGATGAAAGGGATTGTGTCTGG - Intergenic
920094656 1:203478328-203478350 CAGAGGATATGGTAGGTGGCGGG + Intronic
920264552 1:204712110-204712132 CTGAGTAGAGGGATGGAGGCCGG - Intergenic
920347966 1:205318839-205318861 CTGAGGGAAGGGCAGGTGGGCGG - Intronic
920569898 1:207008646-207008668 CTGAGGCAAAGGAAGGGGGCTGG + Intronic
920767238 1:208845215-208845237 ATGAGGAAATAGAAGGTGGCAGG - Intergenic
921080861 1:211737499-211737521 ATGAGGAATGGGAAGGAGCCAGG - Intergenic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921782189 1:219177975-219177997 GCGAGGAAAGGGCAGGTGCCAGG - Intronic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922344347 1:224683988-224684010 CTCTGGAAAGGACAGGTGGCTGG - Intronic
922567433 1:226610140-226610162 CTGAGGAAATGGCAGGAGGCAGG - Intergenic
922667136 1:227480277-227480299 CTCTGGAAAGTGATGGTGGCAGG + Intergenic
923183696 1:231549104-231549126 CTGAGAAAAGGGGATGTGGTGGG + Intronic
923823495 1:237473696-237473718 CTGAGGAAAGGAGAAATGGCAGG - Intronic
923823610 1:237474814-237474836 CTGAGGAAAGGAGAAATGGCAGG + Intronic
924064829 1:240210224-240210246 CTGTGGAATGTGTAGGTGGCAGG + Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1063599109 10:7463972-7463994 CTGAGGTCAGGCATGGTGGCGGG - Intergenic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1064263839 10:13808675-13808697 CAGGGGAAAGGGCAGGTGTCAGG - Intronic
1064462834 10:15551461-15551483 ATCAAGAAAGGCAAGGTGGCTGG + Intronic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065931960 10:30487838-30487860 CTTTGGAAAGGAAAGGTGGCAGG - Intergenic
1066334580 10:34463041-34463063 GGGAGGAAAGGGAAGGGGGAGGG + Intronic
1067292126 10:44950977-44950999 GGGAAGAAAGGGAAGGTGACTGG + Intergenic
1067684005 10:48456582-48456604 CTGGGGGAAGGGCAGGAGGCAGG + Intronic
1069081864 10:64097101-64097123 CTGAGGAGAGGCATGGTGCCAGG + Intergenic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069563794 10:69450172-69450194 CTGAGAAAAGGCCAGGTGGGAGG + Intergenic
1069956782 10:72056964-72056986 CTGAGGGAAAGCAAGGTGCCAGG + Intergenic
1070289767 10:75106573-75106595 CAGAGGATCGGGAAGGTGGGGGG - Intronic
1070358027 10:75659339-75659361 GAGAGGAAAGGGAGGGAGGCAGG - Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1071668079 10:87579678-87579700 CTGAAGAAAGTGAACGTGGTAGG + Intergenic
1071754950 10:88527240-88527262 CTGGGGATGGGGAAGGTTGCTGG - Intronic
1071792747 10:88973147-88973169 CAGAAGAAAGGGAAGGTGAGAGG - Intronic
1071795627 10:89002085-89002107 CTGGGGAAAGGGGAGGTGTTTGG - Intronic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073591802 10:104764997-104765019 CAGAGGTCAGGGAAGGTGGTGGG + Intronic
1073768162 10:106706470-106706492 CTTGGGAAAGGGATGGAGGCTGG + Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074596894 10:114876206-114876228 CTGAGGAAAGGGTTGGAGTCAGG - Intronic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1075061291 10:119258775-119258797 GAGAGGAAAAGGAAGGTAGCTGG + Intronic
1075063866 10:119275861-119275883 GTGAGGAAAGGGAGGGCCGCAGG + Intronic
1075129444 10:119725911-119725933 CGGAGGAAAGGGCAGGAAGCGGG + Intergenic
1075240714 10:120775917-120775939 GTGAGGTCAGGGAAGGTGACTGG - Intergenic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076242307 10:128917564-128917586 GTGAGGTAAGGAAAAGTGGCTGG + Intergenic
1076530195 10:131139908-131139930 CTGAGTTCAGGGAATGTGGCTGG + Intronic
1076675125 10:132143730-132143752 CTCAGGATAAGGAAGGGGGCAGG + Intronic
1076886655 10:133266187-133266209 CTGAGGAAAGGCAGAGGGGCCGG + Intronic
1077498475 11:2898089-2898111 CTGAGAAATGGGACTGTGGCTGG - Intronic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1077929979 11:6720965-6720987 CTGATCAATGGGAAAGTGGCAGG + Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078500214 11:11866332-11866354 CTCAGGAGAGGGAAAGTGGTAGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079130012 11:17741791-17741813 CTGAGGCAGGGGAACCTGGCAGG - Intronic
1079311459 11:19370172-19370194 CTCAGCAAAGGAAAGGTCGCAGG - Intronic
1080427879 11:32172976-32172998 CTGAGGAAAGCCAAGTAGGCTGG + Intergenic
1080582846 11:33657814-33657836 ATAATGAAAGGGAAGGTAGCTGG + Intronic
1080890287 11:36403151-36403173 CTGAGGAAATGGAGGATGGATGG + Intronic
1081468145 11:43344353-43344375 CTTAGGAAAGGGAAGGGGAAGGG - Intronic
1081661833 11:44893154-44893176 CAGAGGAAAGGGCTGGTGGCAGG + Intronic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082790053 11:57340883-57340905 CTCTGCAAAGGGAAGGAGGCTGG + Intronic
1082802386 11:57424668-57424690 GGGAGGAAAGGGGAGGTAGCAGG + Intronic
1082850686 11:57761773-57761795 CTTAGGAAAGCGAAGGGGGTAGG + Intronic
1082969598 11:59005503-59005525 CTCAGCAAGGGGAATGTGGCAGG - Intronic
1083243174 11:61404604-61404626 TGGAGGAAAGGGAAGGGGGTGGG + Exonic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083692092 11:64415519-64415541 CTGAGGAGAGGGGAGGAGGTGGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1084913741 11:72412005-72412027 CTGAGCAGAGGCAAGGTGCCTGG + Intronic
1085027619 11:73245803-73245825 CATAGGAAAGGCAAGGTGCCTGG - Intergenic
1085446897 11:76606748-76606770 GTCTGGAGAGGGAAGGTGGCAGG - Intergenic
1086193462 11:84108631-84108653 CTGAGGCAAGAGAAGGTAGCAGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1087191118 11:95255693-95255715 CTGTGGAATGGAGAGGTGGCTGG - Intergenic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087833379 11:102844626-102844648 TTGAGGAGATGGATGGTGGCAGG - Intergenic
1087923226 11:103890669-103890691 CTGAGGAAAGGGAATGAAACAGG - Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088120385 11:106362143-106362165 CAGAGGACAGGGAAAGTGTCTGG + Intergenic
1088190646 11:107224566-107224588 CTGAGGAAAAAGAATGTTGCTGG + Intergenic
1088707545 11:112477428-112477450 CTGAGGAAAGGGAGGAGGACAGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089147043 11:116336679-116336701 CTGAATAAAGGGAAGGGAGCTGG - Intergenic
1089201052 11:116724957-116724979 AGGAGGACAGGGAGGGTGGCTGG - Intergenic
1089352344 11:117828725-117828747 CTGAGGAAAGGGCAGGCCACAGG - Intronic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1089810129 11:121124952-121124974 CAGAGGAAAAGGGAGGTGACTGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090433722 11:126668460-126668482 GTGGGGAAAGGGAAGCTGTCTGG - Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1090898286 11:131000666-131000688 CAAAGGATATGGAAGGTGGCAGG - Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091289158 11:134427667-134427689 CCCACGAAAGGGAAGGTGCCTGG - Intergenic
1091762682 12:3097531-3097553 CTGAGGGAAGGGACTATGGCAGG + Intronic
1091816418 12:3442409-3442431 CAGAGAAAAGGGGAGCTGGCTGG + Intronic
1092204581 12:6607214-6607236 CTGAGGAAGGGGCGGGTGACGGG + Intronic
1093728794 12:22544584-22544606 CCGAGGAAAGATAAGGGGGCGGG + Intergenic
1093806017 12:23434285-23434307 CATAGAAAAGGGTAGGTGGCAGG - Intergenic
1095205542 12:39435680-39435702 CTCACTAAACGGAAGGTGGCTGG - Intronic
1095709891 12:45277120-45277142 GTGAGAGAAGGGAAGGGGGCTGG - Intronic
1096539142 12:52294482-52294504 AGGAGGGGAGGGAAGGTGGCAGG + Intronic
1096865162 12:54558322-54558344 ATGAGGAAAGGGAATGGGGCAGG - Intronic
1097068348 12:56337102-56337124 ATAAGGAAAGGGGAGGGGGCAGG - Intronic
1098106856 12:67076783-67076805 CAGAGGAAAATTAAGGTGGCTGG + Intergenic
1098197294 12:68015419-68015441 CTGAGGTGAGGTAAGGTGTCAGG + Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099058919 12:77881137-77881159 CTAAGTAAAGGAAAGGTGACAGG - Intronic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100324723 12:93530227-93530249 AGGAGGAAAGGGAAGGGGGAAGG - Intergenic
1101051857 12:100872234-100872256 CTTAGGAAAGGGAAGCTGAAGGG - Intronic
1101618613 12:106361883-106361905 CTGTGGAAAGGGAATGTGAGGGG + Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102437440 12:112936343-112936365 ATGAGGAAAGGGGATGTGCCAGG + Intergenic
1102486418 12:113260753-113260775 CTGAGAAGAGGGAGGGTGGCAGG - Intronic
1102514616 12:113437977-113437999 CTGAAGTCAGGGAAGGGGGCAGG - Exonic
1102582181 12:113896659-113896681 GTGAGGAGAGGGAAGGCGGGAGG + Intronic
1102625866 12:114235067-114235089 GTGAGGCGAGGAAAGGTGGCTGG - Intergenic
1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG + Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1104480194 12:129100893-129100915 CTGAGGAAAGGACAGCTGTCTGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104804413 12:131575896-131575918 CTGAGCCCAGGGCAGGTGGCAGG - Intergenic
1104916422 12:132267189-132267211 ATGAGGGCAGGGAAGGAGGCAGG + Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106188781 13:27432089-27432111 TTGAGGAACGTGAGGGTGGCTGG + Intronic
1106684964 13:32049029-32049051 TTGATGAAAGGGAAGGTGTAAGG + Intronic
1106770593 13:32957617-32957639 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1107718911 13:43227923-43227945 CTGAGGAGAGGCAAGGTACCGGG - Intronic
1107853885 13:44595942-44595964 CTGAGGACAAGGAGAGTGGCAGG + Intergenic
1107888437 13:44893754-44893776 ATGAGGACAGAGAAGGGGGCAGG + Intergenic
1108426957 13:50312198-50312220 CTGGGGCTAGGGAAGGTGTCTGG + Intronic
1108696458 13:52906577-52906599 GTGAGGGAAGGGACGGGGGCGGG + Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109486993 13:63038266-63038288 CTGGGGCAAGGGAAAGTGACAGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111791249 13:92858312-92858334 AAGAGCAAAGGGATGGTGGCAGG - Intronic
1112090768 13:96080886-96080908 CGGTGGGAAGGTAAGGTGGCAGG + Intergenic
1112205161 13:97317074-97317096 CAGTGGGAACGGAAGGTGGCAGG + Intronic
1112454148 13:99543033-99543055 CTGAGGAACAGCAAGGTAGCCGG - Intronic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114648419 14:24268421-24268443 CTGGGGAAAGAGTAGGTGGTTGG + Intronic
1114932828 14:27495132-27495154 TTGAGCAAAAGGAACGTGGCTGG + Intergenic
1115378709 14:32708813-32708835 CTGAGGAAAGCTAAGGAGGAAGG - Intronic
1116287905 14:42996418-42996440 CTGAGGAAAGGGAAAGGGAAAGG - Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117528606 14:56636958-56636980 CTCATGAAAGGGAAGCAGGCAGG + Intronic
1117634887 14:57731438-57731460 CAGTGGAAAGGGCAGGTGTCTGG - Intronic
1117758966 14:59006146-59006168 CTGAGGAGACCGAAGTTGGCTGG + Intergenic
1118365447 14:65091521-65091543 ATGAGTGAAGGGATGGTGGCAGG - Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119286332 14:73458137-73458159 CTGAGGAAACGGAAGCGGCCAGG - Intronic
1119458927 14:74781816-74781838 CAGAAGACAGGGAAGGTGGGGGG - Exonic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121511265 14:94514955-94514977 CTGAGGAAACCCACGGTGGCCGG + Intronic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1122552241 14:102556339-102556361 CTGAGGACAGCGAACCTGGCAGG + Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122774926 14:104112917-104112939 CTGGGCAAAGGCAGGGTGGCAGG - Exonic
1122994925 14:105257882-105257904 CTGGGGAAAGGCAGGGTGGGTGG + Intronic
1123080607 14:105691927-105691949 CTGAGGACAGGGATGGACGCTGG + Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1123983757 15:25625912-25625934 CTGAAGACAAGGAGGGTGGCTGG + Intergenic
1124345533 15:28919241-28919263 CCGAGTCAAGGGAAGGAGGCAGG + Intronic
1124516016 15:30367941-30367963 CTGAGGAAGGGGTCAGTGGCAGG + Intronic
1124726904 15:32162790-32162812 CTGAGGAAGGGGTCAGTGGCAGG - Intronic
1125724238 15:41860280-41860302 CTCACGAAACGGAAGGTCGCAGG - Intronic
1125757766 15:42075880-42075902 CTGAGGAAAGGAAGGGAGGGAGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126222901 15:46235475-46235497 CTGAGGATAGTGAGGTTGGCTGG - Intergenic
1127686906 15:61354749-61354771 TGGAGGGCAGGGAAGGTGGCAGG + Intergenic
1127857332 15:62963245-62963267 CTCAGGAAAGGGAAGGTAGAGGG - Intergenic
1127877174 15:63121787-63121809 CGGAGGGAAGGGCAGGGGGCGGG - Exonic
1128302744 15:66577126-66577148 CCCAGGAAAGGGAAAGTAGCTGG - Intergenic
1128506377 15:68275926-68275948 CAGAGGAGAGGGAGGGTGGTAGG + Intergenic
1128543535 15:68552781-68552803 TTGAGGAAAGGTCTGGTGGCAGG - Intergenic
1128619103 15:69133754-69133776 CTGAGGACAGGGAAGGAGTGTGG + Intergenic
1128647989 15:69391055-69391077 GTCAGGAAAGGTAAGCTGGCAGG + Intronic
1130972056 15:88741339-88741361 CTGGTGAAAGGGGAGGTGGTGGG + Intergenic
1131901275 15:97090296-97090318 CTTTGAGAAGGGAAGGTGGCTGG - Intergenic
1132698997 16:1214279-1214301 CTGAGGAAAGGAGAGGATGCAGG - Intronic
1133087433 16:3375854-3375876 AGGAGGAAAGGGAAGGAGGGAGG - Intronic
1133547878 16:6825708-6825730 AAGAGGAAAGGGAGGGAGGCAGG + Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134596575 16:15500527-15500549 TTGAGGAAGGGGAAGGTATCAGG + Intronic
1134667290 16:16028094-16028116 CAAAGGAAAAGGAAGGCGGCAGG - Intronic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135121879 16:19773235-19773257 CTGGGGAAAGGGGAGATGGCAGG + Intronic
1135274502 16:21100366-21100388 CTGAGAAAAGGAATGGAGGCCGG - Intronic
1136056320 16:27692543-27692565 CTGAGGAGTGGCAAGGGGGCTGG - Intronic
1136463998 16:30429679-30429701 CTGAGGCAAGGGAAATTGGGTGG - Intronic
1136610567 16:31362783-31362805 ATGAGGGTAGGGGAGGTGGCTGG + Intronic
1137617530 16:49856334-49856356 CTGAGGAGGGGGAACGGGGCTGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1138630086 16:58286793-58286815 CTGATGAAAGGAAGGATGGCAGG + Intronic
1139250280 16:65488834-65488856 CAGAGGAAAGGACAGGTGGGAGG - Intergenic
1139352015 16:66342832-66342854 AAGAGGAACGGGGAGGTGGCGGG - Intergenic
1139529868 16:67537773-67537795 CTCAGGAAAGAGGAGGGGGCGGG + Intronic
1139616451 16:68097107-68097129 GTAAGGAAAGGGAAGGAGGCAGG + Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1141112937 16:81285134-81285156 ATGAGAAATGGGAAGCTGGCTGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142656632 17:1399267-1399289 CTGAGGAAAGGGAGGGAGTGAGG + Intronic
1142665558 17:1461392-1461414 GAGAGGAAAGGGAAGAAGGCTGG - Intronic
1142764216 17:2056575-2056597 CTGAGGGAAGGGGAAGTGGAGGG + Intronic
1142966563 17:3585548-3585570 CTGAGAAGCGGGAAGGGGGCGGG + Intronic
1143470813 17:7174068-7174090 CTGAGGAGAGAGAAGGCGGGTGG + Intronic
1143529879 17:7496599-7496621 CTGACCAAAGAAAAGGTGGCTGG + Exonic
1144632603 17:16881739-16881761 CTGAGGTGAGGGCAGGAGGCAGG - Intergenic
1144888178 17:18477893-18477915 CTGAGGGCAGGGAAGCTGCCAGG + Intronic
1145144028 17:20466410-20466432 CTGAGGGCAGGGAAGCTGCCAGG - Intronic
1145355819 17:22148661-22148683 CTGGGGCAAGGGAAAGTGACAGG + Intergenic
1145709109 17:26952523-26952545 ATGAGGAAAGGAAGGGAGGCTGG + Intergenic
1145736962 17:27239906-27239928 CTGAAGGAAGGGCAGGGGGCGGG - Intergenic
1146432617 17:32811919-32811941 CTGAGGAAATGGAAGGCACCTGG + Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147432817 17:40384108-40384130 CTGAGGAAAGGGTACGGGACAGG + Intergenic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147888632 17:43701514-43701536 CTGACAAACAGGAAGGTGGCAGG - Intergenic
1147988520 17:44319918-44319940 CTGAGGAAAAGGCACTTGGCTGG + Exonic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148534505 17:48428441-48428463 CTAAGCTAAAGGAAGGTGGCAGG + Intronic
1148718046 17:49729854-49729876 AAGAGGGAAGGGAGGGTGGCAGG - Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149515813 17:57280125-57280147 CTGAGGGAAGAGAGGGTGGCTGG + Intronic
1149809622 17:59655257-59655279 CTGAGGAAAGGGAAAGAAACGGG + Intronic
1150293197 17:63993357-63993379 GGGAGGGAAGGGAAGGTGGGAGG + Intergenic
1150293213 17:63993395-63993417 GGGAGGGAAGGGAAGGTGGGAGG + Intergenic
1150514946 17:65798345-65798367 CTGGGGAAAGGCTAGCTGGCTGG + Intronic
1150830207 17:68512193-68512215 CTGCGGAAAGGAGAAGTGGCGGG + Intronic
1151218069 17:72591542-72591564 CGCCGGAAAGGGGAGGTGGCGGG + Intergenic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151430497 17:74059325-74059347 ATAAAGAAAGGGAAGGGGGCTGG + Intergenic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151826585 17:76527308-76527330 CAGAGGTGAGGGAAGGTGGCAGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152260929 17:79266701-79266723 CTCAGGAGAGGGGAGGGGGCTGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152496652 17:80677569-80677591 CTGGTGAGAGGGAAGGTGGGAGG - Intronic
1152623331 17:81377101-81377123 CTGAGGAAGGCGAAGCTGCCAGG + Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153973698 18:10248258-10248280 CTGAAGAAAAAGAAGTTGGCTGG + Intergenic
1155226958 18:23737386-23737408 ATGGGGTGAGGGAAGGTGGCTGG - Intronic
1155611118 18:27668945-27668967 ATGACGAAAGGGTAGGAGGCTGG + Intergenic
1156217440 18:35014204-35014226 CTAAGGGAAGAGAAGGTGGTAGG + Intronic
1156381606 18:36566805-36566827 ATGAGGAAAGGGAAGGAGTCTGG + Intronic
1156451133 18:37266978-37267000 GTGGGGAAAGGGGAGGGGGCTGG + Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156490334 18:37492196-37492218 GTGGGGAATGGGAAGGTAGCAGG + Intronic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1158198792 18:54917118-54917140 CTGAGGAAAGGGGAAGTGAATGG + Intronic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1158669868 18:59464944-59464966 CCTCGGGAAGGGAAGGTGGCTGG - Intronic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1159069436 18:63606751-63606773 CTGAGGAAAGACAGAGTGGCTGG + Intergenic
1159091393 18:63853113-63853135 TTTAGTAAAGGGAATGTGGCAGG - Intergenic
1159885257 18:73897566-73897588 TTTAGGAAAGGGAAGATGACTGG - Intergenic
1160123631 18:76151451-76151473 ATGGGGAAAGGGAAGGTGTGAGG - Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160210110 18:76870799-76870821 CTGAGAAGCAGGAAGGTGGCTGG + Intronic
1160701256 19:508498-508520 CTGAGCCCAGGGAAGGTGGTTGG + Intronic
1160833480 19:1113812-1113834 CTGAGGGACGGCAGGGTGGCGGG + Intronic
1161656334 19:5517799-5517821 CTGTACAAAGGAAAGGTGGCCGG + Intergenic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162720075 19:12657100-12657122 CTGAGGAGAGGGGAGGAGTCAGG - Intronic
1163229297 19:15989303-15989325 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
1163271986 19:16259976-16259998 CTGGGGAGAGGCAAGGGGGCAGG + Intergenic
1163675639 19:18654071-18654093 CTGATGAAAGGGTGGGTGGATGG - Intronic
1163696980 19:18768990-18769012 CTGAGGCACGAGCAGGTGGCTGG + Intronic
1163878976 19:19901143-19901165 CGGTGGAAAGTGACGGTGGCGGG + Intronic
1164435500 19:28225056-28225078 GTGAGGAAAGGAGAGCTGGCTGG - Intergenic
1164908363 19:31985695-31985717 CTGGGGACAGTGATGGTGGCAGG + Intergenic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1165427208 19:35752824-35752846 CTGGCAAAAGGTAAGGTGGCAGG + Exonic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166752573 19:45171453-45171475 CGGATGAAAGGAAAGGTGGAAGG + Intronic
1167119897 19:47510621-47510643 TTGGGGACAGGGGAGGTGGCTGG + Intronic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167504435 19:49863648-49863670 GTGAGGAAAAGGAGGGGGGCCGG + Intronic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1168051035 19:53830153-53830175 CTGATGAAAGTGACTGTGGCTGG - Intergenic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
1168247340 19:55119022-55119044 CTCAAGATTGGGAAGGTGGCTGG + Intergenic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168448373 19:56443956-56443978 CTGAGGAATTGAAATGTGGCTGG + Intronic
1168663321 19:58183898-58183920 CTGAGGAAACCGAAGTTGGGAGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925574211 2:5343824-5343846 CTGAGGAACGGCCAGGTGGGTGG - Intergenic
925773442 2:7307394-7307416 CTGAGAAATTGGAAGGTGACTGG - Intergenic
926288790 2:11511927-11511949 CAGAGGAAAGGGGCGGTGGGTGG - Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927717248 2:25360759-25360781 CTTGAGAAAGGAAAGGTGGCGGG - Intergenic
928179262 2:29056500-29056522 GTGAGGTAAGGGGAGCTGGCAGG - Exonic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
929526845 2:42712230-42712252 CTGAGGTAAGGGAACCTGGGAGG + Intronic
929670321 2:43872129-43872151 GTGTGGAAAGGTAAGGTGGCAGG + Exonic
929831700 2:45352113-45352135 ATGAGGCAAGGGAAGGCGGGAGG + Intergenic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG + Intronic
930607160 2:53504612-53504634 GTGAGGAATGGGAGGGAGGCAGG + Intergenic
930826374 2:55700413-55700435 AGGAAGAAAGGGAAGGTGGGAGG - Intergenic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
932335879 2:70931151-70931173 ATGAGGAAAGGGAACTGGGCAGG - Intronic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
933831185 2:86210307-86210329 CCGGGGGAAGGGAGGGTGGCGGG - Intronic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934592002 2:95561993-95562015 CAGTAGAGAGGGAAGGTGGCTGG - Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935103612 2:100019780-100019802 CTGAGGTGAGGGAAGGTTGGAGG - Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
936715362 2:115180920-115180942 CTTAAGAAAGGGAGGGAGGCAGG - Intronic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
938316069 2:130328972-130328994 CTGAGAGAAGGGCTGGTGGCTGG - Intergenic
938480682 2:131658981-131659003 CTGAGGCCAGGGAGGGTCGCGGG + Intergenic
941080463 2:161054913-161054935 CTGAGGAAAGGGGAGGTGATGGG + Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
943060387 2:183037636-183037658 CATAGGAAAGGGAGGGTGGTGGG - Intronic
943952508 2:194148303-194148325 CTGAGGAAAGGGAGAGGGACAGG + Intergenic
945022877 2:205591791-205591813 CTGAAGAAAAGGAAGCTGTCCGG + Intronic
946273830 2:218615806-218615828 CTCAGGGAAGGGAAGGAGGTTGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301606 2:218827688-218827710 CTGACGGAAGGGAAGCTGCCTGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947206779 2:227667986-227668008 ATGGAGAAAGGGCAGGTGGCAGG - Intergenic
947637377 2:231686903-231686925 CTGAGGCCAGGGGAGGTTGCAGG - Intergenic
947744297 2:232499761-232499783 CTGAAGAGAGGGAGGCTGGCAGG - Intergenic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948388979 2:237598574-237598596 ATGAGGGTAGGGAAGGGGGCGGG - Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948787380 2:240359563-240359585 CGGAGGGGAGGGCAGGTGGCTGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948889879 2:240902372-240902394 CTGAGGGCAGGGGTGGTGGCTGG - Intergenic
948923370 2:241078086-241078108 CTAACGAAAGGAAAAGTGGCCGG + Intronic
948935056 2:241158535-241158557 CTGAAGAAAGTGAAGGTGAGAGG + Exonic
1168803719 20:660905-660927 CTGAGTTGAGGGTAGGTGGCAGG + Intronic
1168997781 20:2145762-2145784 CCAAGGAAAGGCAGGGTGGCGGG - Exonic
1169280961 20:4266576-4266598 CTGAGGGAATGGAAGGTGTCAGG + Intergenic
1169305223 20:4483703-4483725 CTCAGGAAAGGGAGGGAGGGAGG - Intergenic
1169665769 20:8033716-8033738 CTGAGGTTCTGGAAGGTGGCTGG + Intergenic
1169763446 20:9121943-9121965 CTGAGGAAAGCAAAGTTGACAGG - Intronic
1170237780 20:14126871-14126893 CTGAGGACAGGGAAAGAGGCTGG - Intronic
1170429562 20:16263904-16263926 CTGAGGAAAAGGAAGCAAGCAGG - Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170929187 20:20753562-20753584 AAGAGGAAAGGGAAGATGTCGGG - Intergenic
1171400761 20:24871857-24871879 CAGAGGGAAGGGAGTGTGGCTGG + Intergenic
1171448280 20:25219710-25219732 CTGAGGTAAGGGCATTTGGCTGG - Intronic
1171470231 20:25364453-25364475 CAGAGGGGAGGGAAGGTGCCAGG + Intronic
1172053416 20:32137251-32137273 CCGGGGAGAGGCAAGGTGGCTGG - Intronic
1172228235 20:33319673-33319695 GTCAGGGAAGGCAAGGTGGCAGG - Intergenic
1172293216 20:33790802-33790824 CTGAGGAGAGCGAGTGTGGCTGG + Intronic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172337354 20:34128311-34128333 CTCAGCAAGGGGAATGTGGCGGG - Intergenic
1172579679 20:36037024-36037046 CTCAGGAAAGGGATGGAGCCTGG - Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172658044 20:36548920-36548942 CTGAGGAATGAGGACGTGGCAGG - Intronic
1172692930 20:36803079-36803101 CTGAAGACAGGGAAGGGGGCCGG - Exonic
1172881720 20:38204433-38204455 CTGGGGATAGGGGAGGTGGGAGG - Intergenic
1172963225 20:38813454-38813476 CTGATGGAAGGGAAGGTGGGAGG + Intronic
1173210369 20:41027805-41027827 ATGAGGGAAAGGAAGGTGTCAGG + Intergenic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173431068 20:42987560-42987582 CTGAAGACAGGGTGGGTGGCTGG - Intronic
1173745526 20:45433985-45434007 CTGAGTAAAGTGCAGATGGCAGG - Intergenic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174089838 20:48038051-48038073 CTGGGGAAAGGTCAGGGGGCGGG + Intergenic
1174276796 20:49409857-49409879 CTGAGCAAAGGTAGGGAGGCAGG - Intronic
1174735585 20:52962730-52962752 GTAAAGAAAGGGAAGGTGGCTGG - Intergenic
1175261630 20:57678196-57678218 CTGGGGAAAGGTAAGGTTGATGG + Intronic
1175302054 20:57949679-57949701 CTGAGAAGAGGGAAGGGGACAGG + Intergenic
1175305792 20:57974634-57974656 CTGAGGACTGGCAAGGAGGCTGG - Intergenic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175745171 20:61451580-61451602 CTGGGTAAAGGGAAGATCGCCGG + Intronic
1175828862 20:61951178-61951200 CCCAGGAAAAGGAAGGTGGGGGG - Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176515278 21:7779213-7779235 CTGGGGATATGGAAGCTGGCAGG - Intergenic
1176938557 21:14896296-14896318 CTGAGTACAGGGAAGGTGTGAGG - Intergenic
1177197421 21:17918087-17918109 CTGAGGATAAGGAAGGTGTTAGG + Intronic
1177250163 21:18582322-18582344 CAGAGGGAAGTGATGGTGGCTGG - Intergenic
1177412555 21:20749245-20749267 CTGAGGGAAGGGTAGGAGACAGG - Intergenic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1177817808 21:25997321-25997343 CTGAGGGAAGGGAAGAGGGGAGG - Intronic
1178405288 21:32318245-32318267 GTGAGGCAAGGGAAACTGGCAGG - Intronic
1178436942 21:32567929-32567951 CTGAGGAAAGGGTAAGTGAAGGG - Intergenic
1178649306 21:34409225-34409247 CTGGGGATATGGAAGCTGGCAGG - Intergenic
1178920643 21:36736089-36736111 CAGATGGAAGGGAAGCTGGCAGG - Intronic
1179348670 21:40585832-40585854 ATGAGCACAGGGAAGGTGCCAGG - Intronic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180980755 22:19876993-19877015 TTGAGGACAGGGCATGTGGCAGG - Intronic
1181171735 22:21013920-21013942 CCGAGGAGAGGGCAGGGGGCTGG + Intronic
1181528211 22:23502050-23502072 CAGAGGAAAGGGCAGGTGGTGGG - Intergenic
1181867979 22:25874263-25874285 CTGGGGAGAGGGAAGGTTTCAGG - Intronic
1182227267 22:28808644-28808666 CTAAGGAAGGGCAATGTGGCAGG - Intergenic
1182336801 22:29589002-29589024 CTGAGGGAATGGATGATGGCAGG - Intergenic
1182455251 22:30446334-30446356 CTGAGCAAAGGCAGGGAGGCAGG - Intergenic
1182831284 22:33306537-33306559 CTTAGGAGAGGGACTGTGGCAGG - Intronic
1183228007 22:36563482-36563504 TTGAGGAAAGGGAAGGAGAGGGG - Intergenic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184523748 22:45009688-45009710 CGGCCGAAAGGGAAGGGGGCTGG + Exonic
1185088077 22:48751397-48751419 CTCAGGAAAATGAAGGAGGCTGG - Intronic
1185148008 22:49149767-49149789 AGGAGGGAAGGGAAGGAGGCTGG + Intergenic
949626419 3:5871819-5871841 CTGAGAAAAGGGAAAGAGACAGG - Intergenic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950032174 3:9860490-9860512 GGGAGGAAGGGGGAGGTGGCAGG - Intergenic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950753908 3:15156064-15156086 AGGAGGAAAGGGAAGGAGGCAGG + Intergenic
950845511 3:16011870-16011892 CTTAGAAAAGGGGAGGGGGCTGG + Intergenic
951324862 3:21289196-21289218 ATGAGGCCAGTGAAGGTGGCAGG - Intergenic
951622356 3:24617000-24617022 GTGAGGAAAGGGAAGGAATCAGG + Intergenic
951990489 3:28671175-28671197 TGGAGGAAAGGGAAGGAAGCGGG - Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
953195400 3:40727511-40727533 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
953347068 3:42185096-42185118 CTGAGGACAAGGACTGTGGCTGG - Intronic
953820472 3:46203747-46203769 GTGAGGAAAGTGAAGGCTGCAGG + Exonic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953978035 3:47397053-47397075 CTGAGGAGAGGGAGAGAGGCAGG + Intronic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954479853 3:50788751-50788773 CTGAGGGCAAGGAGGGTGGCAGG + Intronic
954743772 3:52775066-52775088 AAGAGGGTAGGGAAGGTGGCTGG - Intergenic
954757516 3:52849566-52849588 CTTATGGCAGGGAAGGTGGCAGG - Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954984622 3:54778637-54778659 TTGAGGAGAGGGATGGTGTCTGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955528920 3:59852136-59852158 CTAAGGAGATGGAATGTGGCTGG - Intronic
955947057 3:64205493-64205515 CTGGGGACAGGGTTGGTGGCAGG + Intronic
956107539 3:65836522-65836544 CTAAAGAAAGGGAAAGAGGCCGG + Intronic
956840539 3:73135819-73135841 CTGTGGAAAGGGAATGTAGTGGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958761641 3:98316333-98316355 CTCAGCAAGGGGAAAGTGGCAGG + Intergenic
959145183 3:102535493-102535515 ATGAGGAAAGGTAATGTGGGTGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959721693 3:109498020-109498042 CTGAGGAAAGGGAGAGAGACGGG + Intergenic
960168947 3:114436263-114436285 CAGAAGAAAGGAAAGCTGGCTGG + Intronic
961090038 3:124103136-124103158 CTGCTGACAGGGAAGGTGGCTGG - Intronic
961404049 3:126666498-126666520 CTGAGGTGTGGGAAGGTGACAGG - Intergenic
961462786 3:127063226-127063248 GCGAGGACAGGGAAGGAGGCCGG - Intergenic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
962203127 3:133416068-133416090 GTGAGTAGAGGGAAGATGGCAGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964352285 3:155815072-155815094 ATATGGAAAGGGAAGGTGGTTGG + Intergenic
966165908 3:177016056-177016078 TTGAGGAGACGGATGGTGGCTGG + Intergenic
966863083 3:184241467-184241489 CTGAGGAGAGAGGAGGTGGGGGG - Intronic
966933563 3:184691309-184691331 CTGAGCATAGGGCAGGCGGCAGG - Intergenic
966970210 3:185038715-185038737 CTGAGGATAGGGACAATGGCAGG + Intronic
967042660 3:185707821-185707843 TTGAGGAGAGGGATGGTGGAAGG - Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
968396324 4:241975-241997 CTCAGCAAGGGGAATGTGGCAGG - Intergenic
968481928 4:837092-837114 CAGAGGGAAGGGAGGATGGCTGG - Intergenic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
968939830 4:3631993-3632015 CTGAAGAAAGGCAAGGGGGCTGG - Intergenic
969258766 4:6020948-6020970 CTAAGGACAGGGAAGCAGGCAGG + Intergenic
969720629 4:8891539-8891561 CTGAGGTCAGGGAAGGGGACTGG - Intergenic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
974592546 4:63972577-63972599 ATGAAGAAAGCAAAGGTGGCTGG - Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975531115 4:75400317-75400339 CTGAGAACAGGGAAAGTGGTGGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976954415 4:90877967-90877989 CTGAGAAAATGGAAGCTTGCTGG - Intronic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
978411778 4:108433927-108433949 CGGAGGAAAAGGAAGGAAGCAGG + Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
982257733 4:153466612-153466634 GGGAGGAAAGGGAAAGGGGCAGG + Intronic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982483713 4:155941479-155941501 CTGAGGACATGGGAGTTGGCAGG - Intronic
983027421 4:162755545-162755567 GTGAGGGAAGGCAGGGTGGCAGG - Intergenic
984159844 4:176238427-176238449 CAGAGGAAAGGGTAGTTGGCAGG + Intronic
985510476 5:310529-310551 GGGAGGGAAGGGAAGGCGGCAGG + Intronic
985658538 5:1144198-1144220 CTCAGGGAGGGGAAGTTGGCCGG + Intergenic
986970734 5:13332949-13332971 CTGAGTATATGGAATGTGGCTGG + Intergenic
987058637 5:14220344-14220366 CTGAGGAGAGGGAGAGAGGCGGG - Intronic
988297932 5:29390527-29390549 TTCAGGAAGGGGAGGGTGGCCGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988556689 5:32242674-32242696 GTGTGGGAAGGGAAGGTGGCTGG - Intronic
988741389 5:34076969-34076991 CTTAAACAAGGGAAGGTGGCTGG + Intronic
988992634 5:36686361-36686383 GGGAGGAAAGGGAAGATGACGGG - Exonic
989060071 5:37401699-37401721 CTTTGGAAAGTCAAGGTGGCAGG - Intronic
989158747 5:38370229-38370251 CAGAGGGAAGGGAAGCTAGCTGG - Intronic
989181329 5:38580389-38580411 ATAAGGGAAAGGAAGGTGGCAGG - Intronic
990039155 5:51358166-51358188 CTTTGGAAAGGAAAGGAGGCAGG - Intergenic
990797197 5:59556888-59556910 AGGAAGAAAGGGAGGGTGGCAGG + Intronic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
991601344 5:68354459-68354481 CAGAGGGATGTGAAGGTGGCGGG - Intergenic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
993499756 5:88651989-88652011 CTGAGCAAAGGGAAGGGGTCAGG - Intergenic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
993552893 5:89296693-89296715 ATGAGCAAAGGAAAGGTGTCAGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
996723253 5:126650203-126650225 ATGAGGAATGGGAATGTTGCAGG + Intergenic
996793830 5:127322330-127322352 CAGAGGAAAGGCAAAGAGGCAGG - Intronic
998382545 5:141735966-141735988 AGGAGGAAAGGGAAGTTGGAGGG - Intergenic
998475135 5:142414069-142414091 ATGAGCAAAGGGCAGGTGACAGG - Intergenic
998565812 5:143214967-143214989 CTGTGGACAGGAGAGGTGGCTGG - Intronic
998761141 5:145433612-145433634 CTGAGGAGAGGGTACCTGGCTGG - Intergenic
999042982 5:148435896-148435918 CTGAGGAAAGGGAGAGAGACAGG + Intronic
999274975 5:150324176-150324198 CTGAGGATAGGCACGGTGGCAGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG + Intergenic
1000495138 5:161972936-161972958 CTGAGGAAAAGAAAGGAGGCTGG + Intergenic
1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG + Intergenic
1000797428 5:165682415-165682437 TTGTGGAAAGGGAATGTGGGAGG + Intergenic
1000932189 5:167265029-167265051 TAAAGGAAAGGAAAGGTGGCCGG + Intergenic
1001147817 5:169200156-169200178 CTCAGGAAAGGGAAGGGGTGAGG + Intronic
1001155166 5:169266407-169266429 CTGAAGAAAAGGAATGTGGGTGG + Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1002077823 5:176719638-176719660 CTGAGGGAAGGGATGGTGGTGGG - Intergenic
1003619960 6:7691217-7691239 CTGAGGCCAGGGAAGCTGCCGGG + Intergenic
1003724776 6:8748582-8748604 CTGAGGAAAGGCATGTGGGCTGG + Intergenic
1005429151 6:25736096-25736118 CTGTTGAAAGAGAAGGTGGTGGG + Intergenic
1005939013 6:30547014-30547036 CTGAGGAGAGGAAAGGAGACAGG + Intronic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006313183 6:33275884-33275906 GTGAGGACAAGGAAGGGGGCTGG + Intronic
1006662891 6:35663624-35663646 CTGAGGAAAGGGCACATGGGAGG - Intronic
1006904112 6:37521587-37521609 CTGGGGAAAGGTGAGGTGTCAGG - Intergenic
1007709536 6:43813394-43813416 CTGAGGAACTGACAGGTGGCGGG + Intergenic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1007959622 6:45947012-45947034 CTCAGGACAGGGAAGGTAGGTGG + Intronic
1008313782 6:50013252-50013274 CTGAGGAGATGACAGGTGGCTGG + Intronic
1008489833 6:52074879-52074901 CTGGGGAAAGGATTGGTGGCGGG - Intronic
1008674552 6:53805928-53805950 CTGAGGGAAGGTGAGGTGGTGGG - Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1009807102 6:68614087-68614109 CTGAGATAAGGGGAAGTGGCTGG - Intergenic
1011735010 6:90301887-90301909 CAGAGAGGAGGGAAGGTGGCTGG + Intergenic
1011948742 6:92937938-92937960 CTGAGGAAAAGTAAGATGTCTGG - Intergenic
1012407732 6:98919525-98919547 ATGAGGAAAGAGAAGCAGGCTGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013618034 6:111862873-111862895 CTAAGGAAAGGGAAGGACGGGGG + Intronic
1013747435 6:113362539-113362561 CTGGGGAAAGACAACGTGGCAGG + Intergenic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016262287 6:142186638-142186660 CAGAGGAAAGGAGAGGTGGTAGG + Intronic
1017716764 6:157218440-157218462 ATGAGGAGAGGCAAGGTCGCTGG - Intergenic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018798190 6:167203314-167203336 CTAAGGAAAGGGAGGGAGTCAGG + Intergenic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1021315559 7:19144268-19144290 CTGAGGAAAGGAAAAATGGAAGG - Intergenic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022470484 7:30679091-30679113 CTGAGCAAAGGCAAGGAGACAGG - Intronic
1022556882 7:31306858-31306880 CTGTGGGAAGTGAATGTGGCTGG + Intergenic
1022974864 7:35547711-35547733 CTGTGGAGAGGGAAGCCGGCAGG + Intergenic
1023069457 7:36414539-36414561 CTTAGGAAAGGGAAGGTGACAGG + Intronic
1023169529 7:37377322-37377344 TTCAGGAAAGTGAAGGTGCCAGG + Intronic
1023822901 7:43989973-43989995 CTCAGGGAAAGGAAGGAGGCAGG + Intergenic
1023842182 7:44104084-44104106 CTGAGGGAAGGAAAGGTGGTGGG - Intergenic
1023981141 7:45070870-45070892 CTGGGGAAAGGGCAGAGGGCTGG - Intronic
1024017764 7:45333374-45333396 CTGAGGGAAGGGGAGGTTGTGGG + Intergenic
1024570835 7:50721875-50721897 CTGTGGGAAGGGAAGGTGTCTGG + Intronic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025139076 7:56447950-56447972 CTGAGGAAATGCATGGTTGCGGG + Intergenic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026738054 7:72961294-72961316 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1026789091 7:73320091-73320113 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1027005987 7:74693503-74693525 CTGAGGAAAGGGAATGATGGGGG - Intronic
1027105680 7:75403774-75403796 TACAGGAAAGTGAAGGTGGCCGG - Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028763978 7:94529644-94529666 CTGAGTAATAGGAATGTGGCTGG + Intronic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1029422434 7:100478219-100478241 AAGAGGAGAGGGGAGGTGGCGGG + Exonic
1029751166 7:102543403-102543425 CTCAGGGAAAGGAAGGAGGCAGG + Intronic
1029769118 7:102642508-102642530 CTCAGGGAAAGGAAGGAGGCAGG + Intronic
1030012886 7:105189048-105189070 CTGAGGAAAGGGCTGGAGTCTGG - Intronic
1030644527 7:112045115-112045137 ATGAGGAAGGGGAAAATGGCAGG - Intronic
1031088465 7:117324908-117324930 CTTAGGAAAGAAAAGGTGGTTGG + Intergenic
1031870294 7:127083596-127083618 CTTAGGAAAGGGATGATGGGGGG - Intronic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1032054495 7:128673511-128673533 CTAAGGAAAGGCAGGGAGGCTGG + Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032646867 7:133834438-133834460 ATGAGGAAAGGGTATGGGGCAGG + Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1032836531 7:135680457-135680479 CAAAGGAAAGGGAAGTCGGCCGG - Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033499696 7:141935695-141935717 GTGAGGAATGGAGAGGTGGCTGG - Intronic
1033770311 7:144543825-144543847 GAGAGGAAAGGGAAGGGAGCAGG - Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1034289037 7:149913387-149913409 CTGAGGATAGGGGAGGCGGGTGG + Intergenic
1034452617 7:151145303-151145325 GTGAGGAAAGGGGAGGAGGTAGG + Intergenic
1034576611 7:152005343-152005365 CTTAGAAAAGGGCAGGTGGCTGG - Intronic
1034662034 7:152779462-152779484 CTGAGGATAGGGGAGGCGGGTGG - Intronic
1034899208 7:154897142-154897164 CTGAGGCCAGGGAAGGAGGGAGG + Intergenic
1034952621 7:155310656-155310678 GTGAGGAGGGGTAAGGTGGCAGG - Intergenic
1035352466 7:158256289-158256311 CTGAGGAAAGTGGACGTGGCAGG + Intronic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035518070 8:253560-253582 CTCAGCAAAAGGAATGTGGCAGG - Intergenic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG + Intronic
1036786584 8:11692075-11692097 CCGTAGAAAGGGAAGGTGACAGG + Intronic
1036977611 8:13431759-13431781 CTTGGGAAAGGGAACGTGGGTGG + Intronic
1037236961 8:16731401-16731423 ATGAAGTAAGGGAAGGTGGCAGG - Intergenic
1037727666 8:21496391-21496413 CTGTGGAAAGGGAAGTGTGCAGG + Intergenic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038124907 8:24662745-24662767 CTAATGAAAGGCAAGGTGACCGG + Intergenic
1038158279 8:25011889-25011911 CTGAGGGACGGGAAGGTAGTTGG - Intergenic
1038395750 8:27244306-27244328 CTTGGGAAAGGGAAGGTGAGAGG - Intronic
1039081617 8:33739359-33739381 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039474294 8:37831357-37831379 CTGAGGGAGGGCAACGTGGCTGG + Intronic
1039895516 8:41714089-41714111 CTGAGGGACTGGAAGGTAGCAGG + Intronic
1039900902 8:41751937-41751959 GTGATGGAAGGGAAGGTGGTAGG - Intronic
1040796957 8:51297753-51297775 AAGAGGAAAGGCAAGGGGGCAGG - Intergenic
1042209620 8:66366742-66366764 GTAAGGAAGGGGAGGGTGGCAGG - Intergenic
1042781908 8:72500556-72500578 GAGAGGAAAGGGAAAGTGGGGGG + Intergenic
1043332174 8:79130952-79130974 CTGAGGAAAGGGAAGTTCTGAGG - Intergenic
1043775676 8:84265431-84265453 CTGAGGCAAGGAATGGTGGGTGG + Intronic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044529933 8:93295799-93295821 TTCAGGAAAGGGAAGGTGTTTGG - Intergenic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1045280002 8:100741941-100741963 CTGAGGATAAGGTAGGTGGGTGG + Intergenic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1046922695 8:119749798-119749820 ATGGGGAAAGGGGAGGTAGCTGG - Intronic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047526302 8:125637313-125637335 CATATGAAAGGCAAGGTGGCAGG + Intergenic
1047904040 8:129453793-129453815 CTGAGGATAGGGCAGGATGCTGG - Intergenic
1048122616 8:131598802-131598824 CTGGGGACAGGGAAAGTGGTAGG - Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048846285 8:138606288-138606310 CTGAGGACACAGGAGGTGGCAGG + Intronic
1048925096 8:139264449-139264471 CTCAGGACAGGGACAGTGGCAGG + Intergenic
1049002203 8:139833279-139833301 CTAAGGAAGGGGAAGTCGGCTGG - Intronic
1049282701 8:141758616-141758638 TGAAGGAAAGGGAAGATGGCAGG - Intergenic
1049298994 8:141859815-141859837 CAGGGGAGAGGAAAGGTGGCTGG - Intergenic
1050488210 9:6158342-6158364 CTAAGGAAAGGGCGGGGGGCAGG - Intergenic
1051287732 9:15513388-15513410 CTGAAGCAAGGGGAGGGGGCAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051764993 9:20513738-20513760 CTGAGGAACCGGGAGGAGGCAGG + Intronic
1051899117 9:22019466-22019488 ATGAGGGAAGGGAAGGTGTTAGG + Intronic
1052252393 9:26413825-26413847 TTAAGGCAAGGGAAGCTGGCAGG + Intergenic
1053037406 9:34836968-34836990 CTGAGGAGATGGAAAATGGCTGG - Intergenic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053250325 9:36568777-36568799 CTGAGGAGAGGGAAAGAGACGGG - Intergenic
1053269486 9:36740269-36740291 CTGAAGCAAGGGCAGGGGGCAGG - Intergenic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053505600 9:38640913-38640935 CTGAGGAAAGGGAAGCTGAGAGG + Intergenic
1054450930 9:65403317-65403339 CTGAAGAAAGGCAAGGGGGCTGG + Intergenic
1054840483 9:69733201-69733223 GTTTGGAAAGGGATGGTGGCAGG - Intronic
1055015593 9:71614451-71614473 GTGAGGAAAGGGCAGGTGGGAGG + Intergenic
1055656266 9:78453035-78453057 GTGAGGAAAGGGATGGGGGCAGG - Intergenic
1056836989 9:89963298-89963320 GGGAGGAAAGGGAGGGTGCCTGG - Intergenic
1057030823 9:91773941-91773963 CTGGGGAAAGGCAAGCTGTCAGG - Intronic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057109000 9:92448937-92448959 TTAAGGAAAGGGAAGATGGAGGG + Intronic
1057292435 9:93815255-93815277 CAGTGGAAAGGGGAAGTGGCAGG - Intergenic
1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG + Intergenic
1058037898 9:100273205-100273227 CTGAGAAGAGGGAAGATGACCGG - Intronic
1058110541 9:101027847-101027869 CTGAGGCCAGGGGAGATGGCAGG - Intergenic
1058522742 9:105828367-105828389 TTGAGGAAAGGGGAGGGGGAAGG - Intergenic
1058530584 9:105901710-105901732 CTCAGGAAAGAGAGGGAGGCAGG - Intergenic
1058835035 9:108853187-108853209 GTGAGGGTAGGGAAGGGGGCAGG + Intergenic
1058912884 9:109536993-109537015 TTGAGGGAAGGGAAGGGTGCAGG + Intergenic
1059131840 9:111760132-111760154 CTGTAGATAGGGAAGATGGCTGG - Intronic
1059427666 9:114231226-114231248 CTGGGGGAAGGGAGGATGGCAGG + Intronic
1059553856 9:115258720-115258742 CTGAAGGAAGGTAAGGTTGCTGG - Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060031597 9:120219035-120219057 CTGATGAGAGGGAAGGAAGCAGG + Intergenic
1060066448 9:120505385-120505407 ATGAGGAGAGGGAAGGAGACAGG - Intronic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060690889 9:125659004-125659026 CTTTGGAAAGGCAAGGTGGGAGG + Intronic
1060891552 9:127192430-127192452 CTTAGGAAAGGGCAGATGGAGGG + Intronic
1061255876 9:129454032-129454054 CAGAGGAAAGGGCAGGTGGTTGG + Intergenic
1061680624 9:132241076-132241098 CTGCGGAAAGGGGACGGGGCAGG + Intronic
1061806250 9:133139290-133139312 CTGCGGAGAGGGGAGGAGGCAGG + Intronic
1061811717 9:133166190-133166212 CTCAGGACAGGGATGGTGTCTGG + Intergenic
1061867165 9:133498839-133498861 CTGATGAAAGACAAGGTGGGAGG + Intergenic
1061947392 9:133916386-133916408 TTGTAGAAAGGGAAGGTGGTGGG + Intronic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062135499 9:134925273-134925295 GGGAGAAAAGGGAGGGTGGCAGG - Intergenic
1062395591 9:136351368-136351390 CTGTGGACAGGGCAGGTGTCTGG - Intronic
1203446636 Un_GL000219v1:63216-63238 GTAAGGAAAGGGAAGGAGGGAGG - Intergenic
1185581350 X:1213202-1213224 GGGAGGAAAGGGAAGGGGGAGGG - Intergenic
1185582024 X:1217111-1217133 CTGGGAAAAGGGGAAGTGGCCGG + Intergenic
1185640650 X:1588143-1588165 CAGAGGAAAGGGGAGGGGGGAGG - Intergenic
1185641045 X:1588973-1588995 CGGAGGAAAGGGGAGGGGGGAGG - Intergenic
1185671220 X:1811608-1811630 CAGCAGAAAAGGAAGGTGGCAGG + Intergenic
1187323011 X:18257952-18257974 GAGAGGAAAGGGAAGGGGGAAGG + Intronic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1187913208 X:24129484-24129506 CTGAGGAAGGGGAGGGGTGCTGG + Intergenic
1187960145 X:24560287-24560309 GCCAGGCAAGGGAAGGTGGCGGG - Intronic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188504936 X:30872389-30872411 TTGAGAAAAGGTAGGGTGGCAGG - Intronic
1188574592 X:31631614-31631636 CGGAGGAAAGGAAAGGGAGCAGG - Intronic
1189123858 X:38425047-38425069 ATGGGGAACGGGAAGCTGGCTGG + Intronic
1189318793 X:40074723-40074745 TCGAGGAAAGGGTAGATGGCTGG + Exonic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190789502 X:53686158-53686180 CAGAGGAGAGGGAAGGTGAGGGG - Intronic
1191018443 X:55835411-55835433 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
1191880910 X:65843128-65843150 CTGAGGAAATTGAAGAGGGCAGG - Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1195045649 X:101052130-101052152 GTGAGGAAAGAGCAGGTGGTGGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195310055 X:103624143-103624165 CTGAGGCCTGGGAAGGAGGCTGG - Intronic
1195853025 X:109303734-109303756 TTGTGGAAAGGGAAGTAGGCAGG + Intergenic
1196184082 X:112726720-112726742 TTGAGGAAAGGGAAAATGGAAGG - Intergenic
1196477393 X:116104520-116104542 CTTAGGAAAGGGAAGGGGAAGGG + Intergenic
1196862289 X:120039673-120039695 CTGAGGAAAGAGATGGTCGTTGG + Intergenic
1196880813 X:120196671-120196693 CTGAGGAAAGAGATGGTCGTTGG - Intergenic
1197702324 X:129608615-129608637 CTGAGGAAAGCGCACATGGCTGG + Intergenic
1199798659 X:151227862-151227884 AGGAGGGAAGGGAAGGTGGTGGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200102866 X:153696721-153696743 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200129150 X:153831496-153831518 CTGAGGAACAGGTAGGCGGCGGG - Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200226704 X:154421472-154421494 CTGAGGAAAGGGCCTGTGGTGGG - Exonic
1200243331 X:154508926-154508948 CTGAGCAAAGGCAGTGTGGCAGG + Intronic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic
1200267872 X:154655501-154655523 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200277489 X:154748391-154748413 GAGAGCAAAGGGAAGGTAGCGGG + Intronic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1201235666 Y:11908470-11908492 CTGCAGAGAAGGAAGGTGGCAGG + Intergenic
1201341104 Y:12935510-12935532 AGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1201901440 Y:19048603-19048625 CTGGGCAAAGGTAAGATGGCGGG - Intergenic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic