ID: 905018504

View in Genome Browser
Species Human (GRCh38)
Location 1:34793135-34793157
Sequence GTCCTCCGATGCCGGGACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905018487_905018504 20 Left 905018487 1:34793092-34793114 CCAGGGGCGCCACCTGCTCGCGG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 905018504 1:34793135-34793157 GTCCTCCGATGCCGGGACGGGGG 0: 1
1: 0
2: 0
3: 2
4: 43
905018492_905018504 11 Left 905018492 1:34793101-34793123 CCACCTGCTCGCGGGAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 190
Right 905018504 1:34793135-34793157 GTCCTCCGATGCCGGGACGGGGG 0: 1
1: 0
2: 0
3: 2
4: 43
905018498_905018504 -7 Left 905018498 1:34793119-34793141 CCGGGAGGAGTCTTGGGTCCTCC 0: 1
1: 0
2: 4
3: 38
4: 197
Right 905018504 1:34793135-34793157 GTCCTCCGATGCCGGGACGGGGG 0: 1
1: 0
2: 0
3: 2
4: 43
905018494_905018504 8 Left 905018494 1:34793104-34793126 CCTGCTCGCGGGAGGCCGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 190
Right 905018504 1:34793135-34793157 GTCCTCCGATGCCGGGACGGGGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905018504 Original CRISPR GTCCTCCGATGCCGGGACGG GGG Intronic