ID: 905018541

View in Genome Browser
Species Human (GRCh38)
Location 1:34793304-34793326
Sequence TTGGATAAGGAACAACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905018541_905018548 -2 Left 905018541 1:34793304-34793326 CCCAGAGGTTGTTCCTTATCCAA 0: 1
1: 0
2: 0
3: 16
4: 143
Right 905018548 1:34793325-34793347 AAGGGGCCGCAGTTACTAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 57
905018541_905018551 16 Left 905018541 1:34793304-34793326 CCCAGAGGTTGTTCCTTATCCAA 0: 1
1: 0
2: 0
3: 16
4: 143
Right 905018551 1:34793343-34793365 AAAGGCAAGATTTGAACCCAGGG 0: 1
1: 2
2: 26
3: 103
4: 488
905018541_905018550 15 Left 905018541 1:34793304-34793326 CCCAGAGGTTGTTCCTTATCCAA 0: 1
1: 0
2: 0
3: 16
4: 143
Right 905018550 1:34793342-34793364 AAAAGGCAAGATTTGAACCCAGG 0: 1
1: 1
2: 30
3: 237
4: 1267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905018541 Original CRISPR TTGGATAAGGAACAACCTCT GGG (reversed) Intronic
901142692 1:7045249-7045271 GTGGATAAGGAGCAAGCTTTTGG - Intronic
902766390 1:18618915-18618937 ATGGATGATGAACAATCTCTGGG - Intergenic
903613420 1:24633755-24633777 TTGGATAAGGACCCACCTAATGG + Intronic
903793359 1:25909627-25909649 TTTGGGAAAGAACAACCTCTTGG + Intergenic
905018541 1:34793304-34793326 TTGGATAAGGAACAACCTCTGGG - Intronic
906008382 1:42499966-42499988 TTGGTTAAGGAACAACCTTCTGG - Intronic
910125795 1:83840840-83840862 CTGGACAGGGAACAGCCTCTAGG + Intergenic
910864172 1:91772574-91772596 TTCTATAAGGAACAACTTATAGG + Intronic
912411984 1:109485943-109485965 CTGGAAAGGGGACAACCTCTGGG + Intronic
913080058 1:115375511-115375533 TTGGACAAGTAACAACCTCATGG - Intergenic
915526166 1:156477517-156477539 TTGGGTACAGAAGAACCTCTTGG - Intronic
918138645 1:181701023-181701045 TTTCATAAGGAAGAACCTTTTGG + Intronic
918244943 1:182650776-182650798 TTGGATAAGTCTCAACCTCTAGG - Intronic
1064300299 10:14117368-14117390 TTGTACAAGCAACAACCTGTTGG + Intronic
1065725772 10:28666665-28666687 TAAGATAAGGAAGAACTTCTAGG - Intergenic
1067008970 10:42691762-42691784 TTGGATGAGAGAAAACCTCTAGG + Intergenic
1067405831 10:46022763-46022785 TTGTATAAAAAACAACCTTTAGG - Intronic
1067913173 10:50367842-50367864 ATGGATAAGGATTATCCTCTAGG - Intronic
1070115608 10:73526014-73526036 TTGGATTAGGGACAGCCTCTTGG - Intronic
1071289645 10:84179628-84179650 TTGGCTCAGGAACACCCTCTAGG - Intronic
1072016209 10:91349392-91349414 TAAGAAAAGGAACAAGCTCTGGG + Intergenic
1076514336 10:131034723-131034745 TAGAATAAGGTACACCCTCTGGG - Intergenic
1077470749 11:2759432-2759454 TTGGGGAAGGAACATCCCCTGGG - Intronic
1082990756 11:59205479-59205501 TCGGAGAAGGAAAAGCCTCTGGG + Exonic
1083463438 11:62830718-62830740 GTGAATAAGGAACAAGTTCTAGG - Intronic
1085429047 11:76430702-76430724 ATGAATAAGGAACAAACTTTAGG - Intergenic
1088445602 11:109923895-109923917 CTGGATATGGAACATCCTCCAGG + Intergenic
1089464247 11:118674046-118674068 CTGGATCAGGAACAAGCTCCTGG - Intronic
1091490469 12:927864-927886 TTGGAAAAAAAAAAACCTCTGGG + Intronic
1094668480 12:32545323-32545345 TTGGGCAAGTAAAAACCTCTAGG - Intronic
1095239030 12:39834946-39834968 TTTAAAAAGGAACAACTTCTAGG + Intronic
1096087940 12:48878794-48878816 TTAGATAAGCCACAACCTCTGGG + Intergenic
1098523562 12:71461009-71461031 GTGGATAAGGAACAATTCCTGGG - Intronic
1098552321 12:71776212-71776234 TTGGTCAAGTAACAAGCTCTTGG - Intronic
1099292912 12:80793964-80793986 GTGGATAAGGAACAATGTTTGGG - Exonic
1099333159 12:81317687-81317709 CTGGATAAGGAAAGAACTCTAGG - Intronic
1100341325 12:93682460-93682482 TTAGAGAAGGATCAACGTCTTGG - Intronic
1100521246 12:95378280-95378302 CTGGATAGGGAATAACCTCTAGG - Intronic
1101630080 12:106484710-106484732 TACGATCAGGAACAGCCTCTCGG + Intronic
1104217873 12:126752050-126752072 TTTGATAAGGAATAACTACTAGG + Intergenic
1104347587 12:128015372-128015394 TTGAATAAAGAAAAACTTCTGGG + Intergenic
1105274198 13:18905329-18905351 TTGGATGAGAGAAAACCTCTAGG + Intergenic
1106341311 13:28829804-28829826 TTGGAAAAGGAGCTACCTATGGG + Intronic
1107352546 13:39530883-39530905 TTTGACAATGAACATCCTCTGGG - Intronic
1111720320 13:91935622-91935644 TTGTATCAGGAACAGCCTTTAGG + Intronic
1117252513 14:53951452-53951474 TTGGAAAAGAAACATCCGCTAGG + Intronic
1117398457 14:55335473-55335495 TTAGATAATGAAGAACCACTGGG + Intronic
1118074620 14:62284417-62284439 TTGGAAAAGGCATAACCTTTTGG + Intergenic
1121250264 14:92494066-92494088 CTGCCTAAGGAACCACCTCTGGG - Exonic
1123538639 15:21263118-21263140 TTGGATGAGAAAAAACCTCCAGG - Intergenic
1126191622 15:45884839-45884861 TTGGTCAAGGGACAAACTCTCGG + Intergenic
1131380611 15:91960717-91960739 TTGGATAAGAGACAACCTGTAGG - Intronic
1132324899 15:100960780-100960802 TTGGAAGAGGAACAAAATCTAGG + Intronic
1133624991 16:7562753-7562775 TGGGATGAGGTGCAACCTCTGGG - Intronic
1134818190 16:17223461-17223483 TTGGCTAAAGCACAGCCTCTTGG - Intronic
1138323254 16:56137729-56137751 GGGGATAAGGAAGAACCTCTGGG - Intergenic
1141448858 16:84083036-84083058 TGGGAAAAGGAACAACCCCTCGG + Intronic
1145722845 17:27089328-27089350 TTGGATGAGAAAAAACCTCCAGG + Intergenic
1148156791 17:45429379-45429401 TTGGATTACGAAAAGCCTCTGGG + Intronic
1149217198 17:54370776-54370798 TTGCCTAAGGACCATCCTCTAGG + Intergenic
1150790957 17:68199788-68199810 TTGGATTACGAAAAACTTCTGGG - Intergenic
1151825777 17:76523446-76523468 GTGGGTAAGGAGCAACGTCTCGG - Intergenic
1153332121 18:3884035-3884057 GTGGATAAGGAAGAACCGATAGG + Intronic
1156947884 18:42857118-42857140 TTGGATAATTAAAAACGTCTTGG - Intronic
1157913996 18:51646633-51646655 TAGGCTAAGAAAAAACCTCTTGG + Intergenic
929128311 2:38541030-38541052 CTGGATAAAGAGCAGCCTCTGGG - Intergenic
929876945 2:45804541-45804563 TAGCAGAAGGAACAAGCTCTGGG + Intronic
930450396 2:51528845-51528867 TTGGATAGGCAAAAATCTCTTGG - Intergenic
933263436 2:80155171-80155193 TTAGAAAAGAAACAATCTCTTGG + Intronic
933793465 2:85902139-85902161 TTGGATAAGGAATTCCCTCCTGG - Intergenic
935471470 2:103465493-103465515 TTGAAAAAGTAACAACTTCTAGG - Intergenic
938312200 2:130300762-130300784 TTGGATGAGAAAAAACCTCCAGG + Intergenic
938736120 2:134188314-134188336 GTGGCTAAGGGACAGCCTCTAGG + Intronic
941010643 2:160295882-160295904 TTTGAGAAGGAAAAACATCTAGG - Intronic
941691788 2:168507665-168507687 TTTGATAAGGAACAAGATGTTGG - Intronic
943786846 2:191886671-191886693 TTGGCTGAGGACCAACCACTTGG + Intergenic
944132935 2:196366367-196366389 GTGGACAAGGAAATACCTCTAGG + Intronic
947244160 2:228028489-228028511 TTGCATAATGAACAACATTTTGG + Intronic
948501684 2:238398500-238398522 TTACATACAGAACAACCTCTGGG - Intronic
1169570182 20:6897771-6897793 CTGGACAAGTAACAACCTCTTGG + Intergenic
1174441009 20:50553483-50553505 TTGGATAAAGAACAACTGTTGGG + Intronic
1175037522 20:56014340-56014362 TTGGCTAAATAACTACCTCTTGG + Intergenic
1176007176 20:62872151-62872173 TTGGTTAAGAAACAGCATCTGGG - Intergenic
1177255479 21:18656415-18656437 TTAGTTAAGGAACAAACACTGGG + Intergenic
1178314412 21:31557442-31557464 GGGGATAAGGAATAACCTCTAGG - Intronic
951880400 3:27475730-27475752 ATGGATAAGGAAGTTCCTCTTGG + Intronic
952095507 3:29947169-29947191 TTGGATAATGAACTATTTCTTGG + Intronic
953824319 3:46236784-46236806 TTAGATAAGGTACAGACTCTTGG - Intronic
955109627 3:55935494-55935516 TTAGACAATGAACAAACTCTTGG + Intronic
957837494 3:85616901-85616923 TTGGCTAAGAAACAAAGTCTAGG + Intronic
961091223 3:124114313-124114335 TTGGCTAAAGAAGAACCCCTGGG - Intronic
962832484 3:139156897-139156919 TCAGATAAGTGACAACCTCTTGG - Intronic
966311007 3:178593865-178593887 TTGTATAAAGTCCAACCTCTTGG + Intronic
975926353 4:79459109-79459131 TTGGAGAAGAAACAACCTTCAGG - Intergenic
979768532 4:124492699-124492721 TTTATAAAGGAACAACCTCTCGG + Intergenic
983774117 4:171584626-171584648 TTGGATATGGAACAACAACTTGG - Intergenic
989401205 5:41009431-41009453 GTAGATAAGGCACAACCCCTCGG + Intronic
990672498 5:58148741-58148763 TTGGAAAAGGGAGAACCTCTTGG - Intergenic
994788930 5:104199755-104199777 ATTCCTAAGGAACAACCTCTAGG + Intergenic
996175226 5:120348049-120348071 TTGGGAAAGGCAAAACCTCTTGG - Intergenic
997062363 5:130522261-130522283 TTGCATAAGAAGGAACCTCTGGG + Intergenic
997062415 5:130523143-130523165 TTGCATAAGAAGGAACCTCTAGG + Intergenic
1000542724 5:162560180-162560202 TTGGATAAGGTAGCACCTTTTGG + Intergenic
1001156229 5:169274628-169274650 CTGGAAAAGCAACAATCTCTGGG + Intronic
1001980895 5:176036409-176036431 TTGGATGAGAGAAAACCTCTAGG + Intergenic
1002236566 5:177807656-177807678 TTGGATGAGAGAAAACCTCTAGG - Intergenic
1002381551 5:178832897-178832919 TTGGATGAGAGAAAACCTCTGGG + Intergenic
1003602706 6:7532656-7532678 TTGGAGAAGAAACAATCCCTGGG + Intergenic
1005321034 6:24654447-24654469 TTGGAAAAGGAATAATCTCTTGG + Exonic
1007023443 6:38545394-38545416 TTTAAAAAGGAACAATCTCTGGG + Intronic
1008126618 6:47676246-47676268 CTGGATCAGGAAAGACCTCTTGG + Intronic
1008789315 6:55210687-55210709 CTGGATAAGGAACTGTCTCTAGG + Intronic
1009637872 6:66289710-66289732 TTGTATAAGCAAAAACTTCTAGG - Intergenic
1012877536 6:104745900-104745922 TTGGAAAAGGGAGAACCTCATGG - Intronic
1014154872 6:118098947-118098969 TTTTATAAGGTACATCCTCTAGG + Intronic
1014882199 6:126736961-126736983 TTGGATAAGGCAAAACATTTAGG - Intergenic
1018479707 6:164177940-164177962 TTGGAAAAGGAAAATTCTCTAGG + Intergenic
1024674047 7:51622262-51622284 TAGAGTAAGGAACAAACTCTTGG + Intergenic
1027857132 7:83526439-83526461 TTGGATAAGGTAGAAGATCTGGG + Intronic
1030287731 7:107843777-107843799 TTGGAAAAGGCAAAAGCTCTAGG - Intergenic
1032540798 7:132701379-132701401 TTGGAGAAGGAGCATCCACTTGG - Intronic
1038376235 8:27042859-27042881 TTGGTTCAGGTGCAACCTCTAGG - Intergenic
1038926469 8:32145619-32145641 TTAGAAAAGGCACATCCTCTGGG - Intronic
1039582174 8:38675690-38675712 TTAGATATGAAACCACCTCTGGG - Intergenic
1039596218 8:38792241-38792263 TTGGTGAAGAAACATCCTCTAGG + Intronic
1039834333 8:41244846-41244868 TTGGGCAAAGAACAACCACTGGG - Intergenic
1043111631 8:76191145-76191167 TTGGATAATGATCAGGCTCTTGG + Intergenic
1048915081 8:139175100-139175122 TAGCATAAGGGACAAACTCTTGG + Intergenic
1048918753 8:139208807-139208829 TTGGCTGTGGAACAACCTCTGGG + Intergenic
1054904128 9:70400065-70400087 TTGTATAAGGCACTTCCTCTAGG - Intronic
1055883864 9:81035561-81035583 CTGAAGAAGGAACTACCTCTAGG + Intergenic
1057373100 9:94491713-94491735 TTGGACAAGCAACAACACCTGGG - Intergenic
1061524647 9:131149376-131149398 TTGGAAAAGGACTAGCCTCTAGG - Intronic
1203582602 Un_KI270746v1:25468-25490 TTGTTCAAGGAGCAACCTCTTGG + Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186857911 X:13643249-13643271 TTGTATAATGAACAGCCTCAGGG - Intergenic
1187760421 X:22577631-22577653 TTGTATCAGGAACAAGCTATAGG - Intergenic
1188967236 X:36569313-36569335 TTGCATAAGATACAACCTGTGGG + Intergenic
1189174288 X:38939252-38939274 CTGGAATAGAAACAACCTCTGGG + Intergenic
1191028683 X:55943614-55943636 TTGGGGAAGGAAGAAACTCTAGG + Intergenic
1192844978 X:74897244-74897266 TTGGATAAGGCACCTTCTCTGGG + Intronic
1193414116 X:81201048-81201070 TTGGAGAAGGGAAAACCTGTGGG + Intronic
1197683888 X:129417510-129417532 AGGGATAAGCACCAACCTCTAGG + Intergenic