ID: 905019076

View in Genome Browser
Species Human (GRCh38)
Location 1:34796037-34796059
Sequence CAGTGTGGCCAGGGCGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905019076_905019085 7 Left 905019076 1:34796037-34796059 CCATCGTCGCCCTGGCCACACTG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 905019085 1:34796067-34796089 CAAAGTGCTTCCTTACTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 159
905019076_905019084 3 Left 905019076 1:34796037-34796059 CCATCGTCGCCCTGGCCACACTG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 905019084 1:34796063-34796085 CCTGCAAAGTGCTTCCTTACTGG 0: 1
1: 0
2: 1
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905019076 Original CRISPR CAGTGTGGCCAGGGCGACGA TGG (reversed) Intronic
900242826 1:1625052-1625074 GAGTGTGGCCAGCGTGACGTGGG + Exonic
900623045 1:3596161-3596183 CAGTGTGGCCAGGGCAGCCTTGG + Intronic
900671505 1:3857517-3857539 CCCTGCGGCCAGGGCGAGGACGG + Exonic
900938846 1:5784800-5784822 CTGTGGGGCCAGGGGGACCAGGG - Intergenic
901049401 1:6418901-6418923 CAGGGAGGCGAGGGCGGCGAGGG + Exonic
901060710 1:6470726-6470748 CAGGGTTACCATGGCGACGACGG + Exonic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903351232 1:22717718-22717740 CATTCTGGCCAGGGGCACGAGGG - Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
912715597 1:111981623-111981645 CAGTGTGGTCATGGTGACAATGG + Exonic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
918448891 1:184640575-184640597 CAGGGTGGCCCTGGCGACAAGGG + Intergenic
919097864 1:193059254-193059276 GTGTGTGGCCAGGGCCATGACGG - Exonic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
1064230002 10:13521549-13521571 CAGTGGGGCCAGGGTGCTGAAGG + Intronic
1065373781 10:25016497-25016519 CAGCGCCGCCAGGGAGACGAGGG + Intronic
1067276342 10:44838441-44838463 CAGGATGGCCAGGGCTAAGAAGG + Intergenic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1073084024 10:100876942-100876964 CAGTGTGGCAAGGGTCACAAGGG + Intergenic
1074112468 10:110432217-110432239 CTGTCTGGCCTGGGAGACGAGGG + Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077229709 11:1453260-1453282 CAGGGAGGCCAGGCCGACGAGGG - Intronic
1077368902 11:2172498-2172520 CAGGGTTGCCAGGGCGACCAGGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1084284291 11:68121481-68121503 CGGTGTGGCGAGGGCGGCGGCGG - Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1090459601 11:126878858-126878880 AAGTGTGGCCAGGTCCACAAGGG - Intronic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1090863172 11:130672582-130672604 CAGTGTTGCCATGGCGACTCTGG + Intergenic
1090868565 11:130723345-130723367 CTGTGTGGGAAGGGCCACGATGG + Intergenic
1091622647 12:2100966-2100988 CAGTCTAGCCTGGGCGACAAGGG + Intronic
1091759525 12:3077596-3077618 CAGTGTGGGCAGGGCGGCGGTGG + Intronic
1096094526 12:48925499-48925521 CAGTCTGGCCTGGGCGCCGCGGG - Exonic
1096216559 12:49801029-49801051 CAGAGTGGCCATGGTGACAAGGG + Intronic
1096309219 12:50505327-50505349 CCGTGCGGCGAGGGGGACGAGGG + Intronic
1096690922 12:53321324-53321346 CCAGGTGGCCAGGGCGAGGAGGG - Exonic
1096783860 12:54006164-54006186 CAGTGCGGCCAGGGCGGCCCGGG - Intronic
1097899518 12:64858840-64858862 CAGTGTGGGGAGTGCGTCGAGGG + Intronic
1098006572 12:66003684-66003706 CGGTGGGGCCAGTGCGACGCTGG - Intergenic
1101937482 12:109069962-109069984 CAGGGAGGCCAGGGCGGGGAGGG + Intronic
1104255478 12:127133376-127133398 CACTGTAGCCTGGGCGAAGACGG - Intergenic
1107655197 13:42585727-42585749 CAGTCTGGCCAGGGGGTCTATGG - Intronic
1119609709 14:76051445-76051467 CAGTGTGGCCAAGATGACAATGG + Intronic
1125146531 15:36475861-36475883 GAGTGTGGCCGTGGCGAGGAGGG - Intergenic
1125310650 15:38374892-38374914 CAGTGTGGCCAGAGCTCTGAAGG - Intergenic
1125727038 15:41873445-41873467 CAGTGTGGTCTGGGTGATGATGG - Intronic
1126881694 15:53105823-53105845 CAGTGTGACCAGGGACACCATGG + Intergenic
1127384533 15:58456644-58456666 CAGTGTGGACAGGGCTACTTAGG - Intronic
1128791234 15:70435416-70435438 GACTGAGGCCAGGGTGACGAGGG + Intergenic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1137236553 16:46623183-46623205 CGGTGGGGCCAGTGCGACGCTGG - Intergenic
1137273522 16:46918544-46918566 CAGTGTGGCCAAGGCAAGGGAGG - Intronic
1139506061 16:67398640-67398662 CAGGGCGGCCAGGGCCAGGATGG + Exonic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142154257 16:88526050-88526072 CAGTGAGGCCAGGGGGGCCAGGG + Intronic
1143174249 17:4947545-4947567 CAGTGTGGACAGGGAGATGGTGG + Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143736018 17:8912552-8912574 CCCTGAGGCCAGGGCGATGATGG - Intronic
1148863206 17:50615217-50615239 CAGCGTGGGGAGGGCGAGGATGG + Intronic
1149038276 17:52158527-52158549 CAGTGCGTCCAGGGCGCCGAGGG + Exonic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1161227916 19:3155891-3155913 CAGTGAGGCCAGGTAGATGAGGG - Exonic
1161233546 19:3187214-3187236 CACTGGGGTCAGGGCCACGACGG - Intronic
1161486239 19:4537342-4537364 CAGTGTGGCCAGGGCTCAGCTGG + Exonic
1161707463 19:5828930-5828952 CAGTGCGGACAGGGAGACGCTGG - Intergenic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1162433972 19:10645598-10645620 CACTGTGGCCTGGGCCACAAAGG - Intergenic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163849525 19:19655317-19655339 GAGCTTGGCCAGGGCGATGAGGG + Exonic
1166003020 19:39889532-39889554 CAGTGTGACCAGGGTGATCACGG - Exonic
1166005807 19:39905784-39905806 CAGTGTGACCAGGGTGATCACGG - Exonic
1166194203 19:41195467-41195489 CAGAGTGGTCAGGGCCAAGATGG + Intronic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166868177 19:45853772-45853794 CAGTGTGGGCAGGGCTGGGATGG - Intronic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1168354892 19:55694900-55694922 CAGCGAGTCCAGGTCGACGAGGG - Exonic
926012193 2:9417208-9417230 CAGCGTGGCCTGGGCGAGGCAGG - Intronic
926766681 2:16328368-16328390 CAGGGTGGGCTGGGCTACGAAGG - Intergenic
928040646 2:27873027-27873049 CAGTGGGGCCAGGGTAATGATGG + Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929780252 2:44952669-44952691 CAGTGTGTCCCGGGCGAGGTAGG - Intergenic
937421061 2:121755733-121755755 CAGTGTAGCAAGGGCGGCCAAGG - Exonic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
1170859680 20:20091070-20091092 CGGGGTGGCCAGGGAGACAATGG - Intronic
1173973187 20:47168119-47168141 CACTGTGGCCAGGGGGACCTTGG + Intronic
1174343016 20:49909715-49909737 CAGTGAGGCCGAGGCCACGAGGG + Intronic
1174402924 20:50285539-50285561 AAGTGAGGCCAGGGTGAGGAAGG - Intergenic
1176146350 20:63567224-63567246 CAGTGTGGCCAGGGCCCGGGCGG - Exonic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184489734 22:44801656-44801678 CAGGGTGGCCTGGGGGACAATGG - Intronic
1185037484 22:48487309-48487331 CAGTGTGGCAAGCGTCACGATGG - Intergenic
1185173616 22:49307112-49307134 CAGTGAGGCCAGGGCCAAGGGGG + Intergenic
949929736 3:9069354-9069376 CAGTGTGCCCAGGGCTGGGAAGG + Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
954395959 3:50293437-50293459 CAATGTGACCAGGGCAGCGATGG - Exonic
954838920 3:53494596-53494618 CAGCGTCGCCAGGGCGAAGCCGG + Intergenic
959579438 3:107968655-107968677 CAATGTGGCAAGGGAGACCAGGG - Intergenic
961749673 3:129087881-129087903 CGGTGGGGCCAGTGCGACGCTGG - Exonic
965470526 3:169084944-169084966 CAGTATGGCCAGGGCTGCGGCGG - Exonic
969315735 4:6380523-6380545 CAGTCTGGCCAGGACAACGCAGG + Intronic
969407463 4:7003315-7003337 CTGTGTGGCCATGGCCACTAGGG - Intronic
969422376 4:7104831-7104853 CACTGTGGCCAGGACCCCGATGG - Intergenic
973337288 4:48969683-48969705 CCCTGTGGCCAGGGCCAAGAGGG - Intergenic
979765890 4:124463563-124463585 GAGTGTGGCCATGGCGCCCACGG + Intergenic
981748852 4:148074598-148074620 CAGTGTGGCCAGGACTGCCAAGG + Intergenic
985021020 4:185690931-185690953 CACTGTGGCCTGGGCGACAGTGG - Intronic
989190658 5:38666829-38666851 CAGTGGGGCCTGGGCCAGGAGGG + Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
996876696 5:128248617-128248639 TAGTGTGGCCAAGGAGACAAGGG + Intergenic
998380049 5:141717852-141717874 CAGTATGGCCAGGGTGGTGATGG + Intergenic
1000494764 5:161967975-161967997 CAGTGTGGCAAGAACGAGGATGG - Intergenic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1005016578 6:21380227-21380249 CAATGTGACCAGGGCTATGAAGG - Intergenic
1006190453 6:32204370-32204392 CAGTGTGCCCCAGGCTACGATGG - Exonic
1008001175 6:46361340-46361362 CAGTGTGGCCTGGGAGTCAAAGG - Intronic
1008249843 6:49226538-49226560 CAGTCCGGCCTGGGCGACAAAGG - Intergenic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010842235 6:80659737-80659759 CAGTGTGGCTGGGGCCAGGAGGG + Intergenic
1010953530 6:82064815-82064837 CAGTGTGTCCAGGGTAACAAAGG + Intergenic
1019577622 7:1745120-1745142 CAGCTTGGCCAGGCCGGCGAAGG - Exonic
1022804107 7:33804633-33804655 CAGGGTGGCCAAAGCAACGAAGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1027226015 7:76244076-76244098 CAGGGTGGCCTGAGCCACGAGGG + Intronic
1028908213 7:96178250-96178272 CAGAGTGGCCAGGGTGCCAAAGG + Intronic
1033518752 7:142138239-142138261 CAGTGTGGCAAGGGCTAATATGG - Intronic
1034285049 7:149878908-149878930 CTGTGTTCCCAGGGTGACGAAGG + Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035390015 7:158497446-158497468 GAGTGTGGCCAAGGCAAGGAAGG - Intronic
1036168840 8:6463634-6463656 CAGTGTGGCCAGGCCAGCTAGGG + Intronic
1042271756 8:66962396-66962418 CTGTGTGGCCAGGGCCGCGCTGG + Exonic
1043389458 8:79778033-79778055 CAGTGTGGCCTGGGCAACAAAGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1047200009 8:122757232-122757254 CAGTGTGGCCAGGGCCAGCTTGG - Intergenic
1049493182 8:142915677-142915699 CACTGTGCCCAGGGCGGGGAAGG - Intronic
1052192860 9:25678390-25678412 CAGGGCGGCCGGGGTGACGACGG + Exonic
1060966529 9:127715048-127715070 CAGCGGGGCCAGGGCGAGGTCGG + Exonic
1061456354 9:130700848-130700870 CAGCCTGGCCAGGGTGATGAAGG - Exonic
1062105498 9:134752781-134752803 GAGGGTGGCCAGGGGGACCAGGG + Intronic
1062363182 9:136197221-136197243 AAGTGGGGCCAGGGCGTCAAGGG - Exonic
1185836011 X:3346483-3346505 CAGGGTGGCCAGGGCGCCCCAGG - Intronic
1187809162 X:23156716-23156738 CACTGTGGCCTGGGCGACAGAGG - Intergenic
1189065132 X:37799643-37799665 AAGTGTGGCAAGGGTGACCAAGG + Intronic
1198330392 X:135617394-135617416 CAGAGTGGCCAAGGTGACCAAGG - Intergenic
1198336535 X:135671605-135671627 CAGAGTGGCCAAGGTGACCAAGG + Intergenic