ID: 905022510

View in Genome Browser
Species Human (GRCh38)
Location 1:34827620-34827642
Sequence TCTACCATCTGCACGTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905022503_905022510 29 Left 905022503 1:34827568-34827590 CCTGCCCCTGGAGGCTTATAACA 0: 1
1: 0
2: 0
3: 15
4: 116
Right 905022510 1:34827620-34827642 TCTACCATCTGCACGTGTACAGG 0: 1
1: 0
2: 0
3: 1
4: 39
905022505_905022510 24 Left 905022505 1:34827573-34827595 CCCTGGAGGCTTATAACAGATGC 0: 1
1: 0
2: 1
3: 12
4: 99
Right 905022510 1:34827620-34827642 TCTACCATCTGCACGTGTACAGG 0: 1
1: 0
2: 0
3: 1
4: 39
905022506_905022510 23 Left 905022506 1:34827574-34827596 CCTGGAGGCTTATAACAGATGCT 0: 1
1: 0
2: 0
3: 10
4: 139
Right 905022510 1:34827620-34827642 TCTACCATCTGCACGTGTACAGG 0: 1
1: 0
2: 0
3: 1
4: 39
905022504_905022510 25 Left 905022504 1:34827572-34827594 CCCCTGGAGGCTTATAACAGATG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 905022510 1:34827620-34827642 TCTACCATCTGCACGTGTACAGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905022510 Original CRISPR TCTACCATCTGCACGTGTAC AGG Intronic
904991492 1:34597140-34597162 TCTGGCATCTGCAGGTCTACTGG + Intergenic
905022510 1:34827620-34827642 TCTACCATCTGCACGTGTACAGG + Intronic
905282456 1:36857880-36857902 TCTAGGATCTGCATGTGCACAGG + Intronic
913773964 1:122293001-122293023 TCTAGCATCTGCAAATGGACAGG + Intergenic
913775631 1:122315393-122315415 TCTACCATCTGCAAATGGATAGG + Intergenic
920719475 1:208373702-208373724 TTTACCTTCTGCACATTTACAGG - Intergenic
1075177715 10:120181426-120181448 TCTGCCATCTCCAGGTGTCCTGG - Intergenic
1090062354 11:123475143-123475165 TGTACTTTCTGCACGTGTCCTGG + Intergenic
1094870551 12:34597052-34597074 TCTCCCAACTGCACATGTGCAGG + Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1106451951 13:29890154-29890176 TCTACCATCCTAACGTGTGCTGG + Intergenic
1110238618 13:73242618-73242640 TGTACCATCTGCACGTGGCCTGG - Intergenic
1111479518 13:88805620-88805642 TCTAGAATCTGCTAGTGTACAGG - Intergenic
1113042121 13:106115828-106115850 TCCACATCCTGCACGTGTACCGG - Intergenic
1113600799 13:111566847-111566869 TCTACCATCTCCCCGTATTCTGG + Intergenic
1115403658 14:32992116-32992138 GCTGCCATCTGCACATGGACTGG + Intronic
1131667526 15:94586171-94586193 TCCACCTGCTGCCCGTGTACAGG - Intergenic
1131686647 15:94775018-94775040 TCTACCATCAGGAAGTGAACAGG + Intergenic
1138496436 16:57411940-57411962 TCTTCCATTTGCACGTGCAGAGG - Intronic
1155280292 18:24232497-24232519 TGTAACATCTGCACATGTAATGG + Intronic
1166063565 19:40342947-40342969 TCTACCATCTGCTAATGTAAGGG - Intronic
928751991 2:34481524-34481546 TCTACCAGCTGCAAGTGAAGTGG - Intergenic
932732790 2:74232615-74232637 GCTACCATCTGGACCTGTTCTGG - Exonic
940718923 2:157260075-157260097 TCTACCATCTCCACCTATAAAGG - Intronic
945374009 2:209057841-209057863 TTTCTCTTCTGCACGTGTACTGG + Intergenic
945418163 2:209600504-209600526 TCTACCATCAGCACATATTCGGG + Intronic
947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG + Intronic
1172888346 20:38246592-38246614 TCTCCCATCTGCATGTGGAGTGG - Intronic
1176139606 20:63539207-63539229 TCCACCATCTGCAGGGGTCCTGG + Intergenic
949294413 3:2504311-2504333 TCTACCATCTTCATGTTTTCTGG + Intronic
952783749 3:37131168-37131190 TCTACTTGCTCCACGTGTACTGG + Intronic
1000595357 5:163209197-163209219 TCTACCAGCTGCACTTGTTGAGG + Intergenic
1002580783 5:180208612-180208634 TTTCCCTTCTGCACGTGCACCGG + Intronic
1005430913 6:25756019-25756041 TCCACCATCAACACTTGTACAGG + Intronic
1019015617 6:168877783-168877805 TCTGCCAGCTGCACGTCCACAGG - Intergenic
1021829423 7:24589186-24589208 TCTTCCATTTTCACCTGTACAGG + Intronic
1026481749 7:70785503-70785525 GATCCCATCTGCAAGTGTACAGG + Intronic
1040778036 8:51070954-51070976 TCTGCCATGTGCCTGTGTACTGG - Intergenic
1196473349 X:116053680-116053702 TCTATCTTCTGCACATGTCCAGG + Intergenic