ID: 905028222

View in Genome Browser
Species Human (GRCh38)
Location 1:34865591-34865613
Sequence CCCTGGGCCCAGTGGGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 448}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905028210_905028222 9 Left 905028210 1:34865559-34865581 CCCTGGTCCTGGGTTGGTCCAGC 0: 1
1: 0
2: 2
3: 32
4: 249
Right 905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG 0: 1
1: 0
2: 3
3: 56
4: 448
905028216_905028222 -9 Left 905028216 1:34865577-34865599 CCAGCCACTGTGGTCCCTGGGCC 0: 1
1: 1
2: 6
3: 50
4: 373
Right 905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG 0: 1
1: 0
2: 3
3: 56
4: 448
905028211_905028222 8 Left 905028211 1:34865560-34865582 CCTGGTCCTGGGTTGGTCCAGCC 0: 1
1: 0
2: 1
3: 20
4: 244
Right 905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG 0: 1
1: 0
2: 3
3: 56
4: 448
905028207_905028222 17 Left 905028207 1:34865551-34865573 CCCAGGCGCCCTGGTCCTGGGTT 0: 1
1: 0
2: 2
3: 12
4: 155
Right 905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG 0: 1
1: 0
2: 3
3: 56
4: 448
905028208_905028222 16 Left 905028208 1:34865552-34865574 CCAGGCGCCCTGGTCCTGGGTTG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG 0: 1
1: 0
2: 3
3: 56
4: 448
905028212_905028222 2 Left 905028212 1:34865566-34865588 CCTGGGTTGGTCCAGCCACTGTG 0: 1
1: 0
2: 0
3: 19
4: 157
Right 905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG 0: 1
1: 0
2: 3
3: 56
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905028222 Original CRISPR CCCTGGGCCCAGTGGGCAGA GGG Exonic
900147834 1:1166147-1166169 CTCTGGGCCCAGTTGGCACCAGG + Intergenic
900338519 1:2176707-2176729 CCCTGGCCCCTGTGGTCAGTGGG + Intronic
900596099 1:3480867-3480889 CCCTGGGTGCAGTGGGGAGGTGG - Exonic
900934312 1:5755718-5755740 CCCTGGGCACAGGTGGCAGCTGG + Intergenic
900974958 1:6011233-6011255 CCCAGGGCCAAGTGTGCAGGAGG + Intronic
901067591 1:6501819-6501841 GCCTGGGACCAGTGGGGAAAGGG - Intronic
901095510 1:6676145-6676167 TCCTGGCTCCAGTGGGCAGTTGG - Intronic
901323762 1:8355311-8355333 TCCAGGGCCCAGCAGGCAGAGGG + Intronic
901359080 1:8680283-8680305 ACCTGGACTCAGAGGGCAGAAGG - Intronic
901494941 1:9615490-9615512 CCCAGTGCCCAGCGGGCAGGAGG + Intergenic
901769650 1:11523871-11523893 GCCTGGGCCCGATGGGCAGAGGG - Intronic
902127132 1:14224262-14224284 GCCTGGAACCAGTGGGAAGAAGG + Intergenic
902213533 1:14920715-14920737 CACTGGGCCCCGTGCTCAGAAGG - Intronic
902378963 1:16043757-16043779 CCCTGGGCCCAGGCGGGAAAGGG + Exonic
903009236 1:20318631-20318653 CTCTTGGCCGAGCGGGCAGATGG - Exonic
903221583 1:21872540-21872562 CGCTGGGCTCAGTGCTCAGATGG + Intronic
903291329 1:22316036-22316058 CCCTGGGCACAGGAGTCAGAGGG + Intergenic
903360053 1:22771443-22771465 GGCTGTGTCCAGTGGGCAGAGGG + Intronic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904342274 1:29844450-29844472 CCCTGGGATCAGTGGGGTGAAGG - Intergenic
904359046 1:29960519-29960541 GCCTTGGCCATGTGGGCAGATGG + Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904604562 1:31691597-31691619 CATTGGGCCCAAAGGGCAGAAGG - Exonic
904684535 1:32250962-32250984 CTTTGGGCCCAGTGAGCAGGGGG - Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905245904 1:36613156-36613178 CTCTGGGGCCAGTGGGCAATGGG - Intergenic
905408819 1:37754309-37754331 CTCTGGGCACGGTGAGCAGAGGG + Exonic
906216169 1:44042044-44042066 CCAGGGGCCGTGTGGGCAGAAGG - Intergenic
906607761 1:47183488-47183510 CCCTGTGCCCACAGGGCAGCTGG - Intergenic
907071003 1:51534826-51534848 CCCTGGGTCCAGAGGAGAGAAGG - Intergenic
912203842 1:107488876-107488898 TCCTGGGGCCAGTGTGAAGATGG - Intergenic
912338971 1:108891575-108891597 GCTTGAGCCCAGTAGGCAGAGGG - Intronic
912509132 1:110176491-110176513 CCCTGGAACCCCTGGGCAGAGGG - Intronic
913970311 1:143410136-143410158 ACTTGGGCCCAGGAGGCAGAGGG - Intergenic
914020465 1:143861965-143861987 CTCTGGGGTCAGTGGCCAGAAGG + Intergenic
914064686 1:144235750-144235772 ACTTGGGCCCAGGAGGCAGAGGG - Intergenic
914114464 1:144730604-144730626 ACTTGGGCCCAGGAGGCAGAGGG + Intergenic
914658964 1:149769877-149769899 CTCTGGGGTCAGTGGCCAGAAGG + Intergenic
914827411 1:151145859-151145881 CCCCGGGCCGAGCGGGCTGAAGG + Intronic
915339329 1:155167619-155167641 CCGTGGGAGCACTGGGCAGAGGG - Intergenic
915351954 1:155232513-155232535 TCCTGGGCCCATTGAGAAGAAGG - Intergenic
915980172 1:160415488-160415510 AACTGGGCCCAGTGGACAGCAGG + Intronic
916039589 1:160950800-160950822 CTCTGGGATCAGTAGGCAGATGG + Intronic
916856866 1:168759056-168759078 CACTGGGTTGAGTGGGCAGAAGG + Intergenic
917930245 1:179817827-179817849 CCCTCGGCCCAGGGAGCAGTTGG + Intergenic
919930334 1:202217143-202217165 CCCTGGGCAGAGTGAGGAGATGG - Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921599411 1:217090419-217090441 GCCTGGGCCCGGTGGGTAGAAGG - Intronic
922481565 1:225943034-225943056 CCCTGGGCCAAGGGGGCTGCCGG + Intergenic
923503035 1:234582217-234582239 CACTGGGCTCAGAGGCCAGATGG - Intergenic
923549955 1:234955598-234955620 CCCTGGGGGCAGGGGGCAGAGGG + Intergenic
1062898203 10:1121097-1121119 CCATGGGACCTGTGGGCTGAGGG + Intronic
1066454851 10:35564326-35564348 CACTGGGACCTGTGGGCAGGCGG - Intronic
1067051872 10:43026264-43026286 CCCTGGGCCCTCTGAGCAGAAGG - Intergenic
1067852046 10:49760461-49760483 TCCTGGGCCTAGTGGCCAGCTGG - Intronic
1069680748 10:70283730-70283752 CCTTCGGGCCAGCGGGCAGAGGG + Intergenic
1069751282 10:70746837-70746859 CCCGGTGGCAAGTGGGCAGAAGG + Intronic
1069917730 10:71797725-71797747 GCCTGGGCCCGATTGGCAGAAGG - Intronic
1069942182 10:71963858-71963880 CCCTGGGGCAAGTGGGCTGGAGG - Intergenic
1070734616 10:78854908-78854930 CCCTGGGCCCAGTGGCCTATTGG + Intergenic
1071576360 10:86729636-86729658 CCCTGTGCTGGGTGGGCAGAAGG + Intronic
1072615458 10:97046540-97046562 CCCTGGGCCCAGCTTGCAGGAGG - Intronic
1072899409 10:99394060-99394082 CCCCGGGGCCAGTGGTCAGCTGG - Exonic
1073438281 10:103535701-103535723 CTCTGGCCCAAGGGGGCAGAAGG + Intronic
1074824149 10:117202511-117202533 CTTGTGGCCCAGTGGGCAGAAGG - Intronic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075087296 10:119422160-119422182 CCCTGGGAACAGCTGGCAGAGGG + Intronic
1075466454 10:122655120-122655142 CCCTGGGCACATTGGGCGCATGG + Intergenic
1075589422 10:123680524-123680546 TCCAGGGCCCCCTGGGCAGAAGG + Intronic
1075673113 10:124277645-124277667 CCCTGCACCGAGTGGGCTGAAGG - Intergenic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076402476 10:130193091-130193113 CCATGGGGACTGTGGGCAGATGG - Intergenic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076664478 10:132078582-132078604 CCCTGGGCTCAGTGGGAAAGGGG - Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1076775740 10:132697126-132697148 TGCTGGGTCCAGTGGGCAGGTGG - Intronic
1076892275 10:133291137-133291159 CCCTGGGCCCCATGGGCAGCAGG + Intronic
1077147785 11:1053639-1053661 GCCTGGGCCCAGAGGGGAGTTGG + Intergenic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1077872210 11:6271518-6271540 GCCAGGGCCCAGTGTGCTGATGG - Exonic
1077907853 11:6547656-6547678 CCCTGGCCCAGGTGGGAAGATGG + Exonic
1078533714 11:12156655-12156677 ACCTGGGCCAGGTGGGAAGATGG + Intronic
1078870368 11:15338455-15338477 CACTGGGCCCCGTGCTCAGAAGG - Intergenic
1082030488 11:47599952-47599974 CCCTGGGCCCCTTCTGCAGATGG + Intergenic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083202887 11:61131088-61131110 CCTTGGGCCCTCTGGCCAGAGGG - Exonic
1083682611 11:64358384-64358406 CCCTGGGCCTCATGGGGAGAGGG + Intergenic
1084409880 11:69000656-69000678 CCCTGGCACCACTGGGCAGTAGG - Intergenic
1084417594 11:69042408-69042430 CCCTGTGTCCAGTGGCCTGAGGG + Intergenic
1084657383 11:70527406-70527428 CCCAGGGCCCACTGGGAAGCGGG - Intronic
1084936723 11:72590668-72590690 CCCTGGGCCCGGCAGGCAGAGGG - Intronic
1085076414 11:73596900-73596922 CCCTTGGCCAAGGTGGCAGAGGG - Intronic
1085199194 11:74691483-74691505 CCCTTGGCCCAGTTGTCACAGGG + Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1089356237 11:117855752-117855774 TCCAGGGCCCAGTGCGCAGGTGG - Intronic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1090073721 11:123565710-123565732 CCCTGCACCCAGTGGGAGGATGG + Intronic
1090240640 11:125179096-125179118 CCCTGGGCTCAATGAACAGAAGG + Intronic
1090752401 11:129759105-129759127 GCAAGGGGCCAGTGGGCAGACGG + Intergenic
1091049620 11:132355580-132355602 ATCTGGGCACACTGGGCAGAAGG + Intergenic
1091342007 11:134823311-134823333 CCCAGGGACAAGGGGGCAGAGGG + Intergenic
1092615563 12:10212976-10212998 CGCTGGGCCGAGTGTGCAGGGGG - Exonic
1094534810 12:31311588-31311610 CCCTGGGTCCAGGGGGCTGCGGG - Intronic
1095800998 12:46269553-46269575 CCCTGGGCACAGCCTGCAGATGG + Intronic
1096622993 12:52876011-52876033 TCTTAGGCCCAGAGGGCAGAGGG - Intergenic
1096862444 12:54539681-54539703 CCCTGGGCCCAGTGTTTAAAAGG + Intronic
1097627326 12:62016549-62016571 CCCTGGTGCCTGTGGGAAGAAGG - Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1098185540 12:67892410-67892432 CCCGGGGCCCAGCTGACAGACGG - Intergenic
1101414819 12:104499816-104499838 CCATGGCCACAGGGGGCAGAAGG - Intronic
1102101247 12:110280903-110280925 CTCTGGGGCCGGTGGGCGGATGG - Intronic
1102232732 12:111274743-111274765 GCCTGGGCCCAGATGGGAGAAGG + Intronic
1102517327 12:113458529-113458551 CCCTGGGCCCAGTAAGCACTTGG + Intergenic
1102569401 12:113818381-113818403 TACTGGGGCCAGTGGGCAGGGGG + Intronic
1102641279 12:114368929-114368951 CCCTGGGGCCAGGAGGCTGAAGG + Intronic
1102708992 12:114908814-114908836 CCCTGGGGTCATTTGGCAGAAGG + Intergenic
1102777833 12:115536077-115536099 GCCTGAGCCCAGGAGGCAGAGGG + Intergenic
1103004456 12:117409734-117409756 ACTTGGGCCAAGTTGGCAGAGGG - Intronic
1103711787 12:122918143-122918165 CCTTGGGCTCAGTGTGGAGAAGG - Intergenic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1105454347 13:20526207-20526229 CCCTGCGCCCAGTTCGCAGTTGG - Intergenic
1109336155 13:60997210-60997232 CCCTGGACCCAGAGAGCACAAGG - Intergenic
1113554940 13:111225578-111225600 CACTGGGACAAGTGGGCACATGG - Intronic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1115650731 14:35401334-35401356 CCCTGGGCCCAGTGTGTGGGAGG - Intergenic
1115849990 14:37583749-37583771 CCCGGGGCGCGCTGGGCAGAAGG - Intergenic
1115850180 14:37584453-37584475 CCCAGGGCCCGGTGGGGAGGGGG + Intergenic
1118321043 14:64753595-64753617 CCATGGGCAGAGTGTGCAGATGG - Exonic
1118908677 14:70043233-70043255 GGATGGGCCCAATGGGCAGAGGG + Intergenic
1119485562 14:74984622-74984644 CCCTGGGCCTAGTGGGAATGTGG + Intergenic
1119728253 14:76935351-76935373 CCCTTGGGCCACTGGGCTGAGGG - Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121098465 14:91233892-91233914 CCCTGAGGCCCGTGGGCTGAAGG + Exonic
1121406348 14:93721412-93721434 CCCTGGACCCGCTGGCCAGAGGG - Exonic
1121407329 14:93727245-93727267 CCCTGGGAGCTGTGGGCCGAGGG + Intronic
1121493460 14:94376377-94376399 CCCTGTGCCCAGTGTGGAGCAGG - Intergenic
1122328109 14:100894880-100894902 CACTGCCCCCAGTGGGCAGTGGG + Intergenic
1122641029 14:103159555-103159577 CCCTGGTCCCCTTGGGCACAAGG + Intergenic
1122741302 14:103872854-103872876 CCCAGGGCCCTGTGTGCAGTGGG + Intergenic
1122791853 14:104187389-104187411 ATCTGGGCCCCGTGAGCAGACGG + Intergenic
1122802953 14:104240951-104240973 CCCTAGGACAAGTGGGCACATGG - Intergenic
1122929194 14:104925721-104925743 CCCTGGGGACAGTGGGGACACGG + Intronic
1123028510 14:105439741-105439763 CCCTGGAGCCAGTGGCCCGATGG + Intronic
1123049123 14:105532152-105532174 CCCTGGCCCCACTGGTGAGAGGG - Intergenic
1123122937 14:105926533-105926555 CCCTGGGCTCAGGAGGTAGAAGG - Intronic
1124802174 15:32843665-32843687 CAATGAGCTCAGTGGGCAGACGG + Intronic
1125087560 15:35748143-35748165 CCCTGGGCCCTGTGCACACATGG - Intergenic
1126866670 15:52944422-52944444 CCCTGGGCCCAGGCAGCACATGG - Intergenic
1128124961 15:65185391-65185413 CCCCGGGCCCAGTAGGCTGGGGG - Intergenic
1128639152 15:69323178-69323200 CTCTTGGCCTAGTGGACAGAGGG - Intronic
1129193495 15:73951280-73951302 CCCGGGGGCCTGTGGGCAGCAGG + Intronic
1129542742 15:76364288-76364310 CCCTGGGACCACCGGGAAGAAGG - Intronic
1129702170 15:77774330-77774352 CCCTGGGAGAGGTGGGCAGAGGG - Intronic
1130907493 15:88251000-88251022 CCCTGAGCCCAGGGTGCAGATGG + Intronic
1131117668 15:89804683-89804705 CCCAGGGCCCAGTGGGCTGGGGG + Intronic
1132498633 16:275252-275274 CCCAGGGCCCAGTGGGAGGCAGG + Intronic
1132514534 16:360044-360066 CGCTGGGGATAGTGGGCAGAAGG - Intergenic
1132656527 16:1043924-1043946 GCCTGGGGGCAGTGGGCAGTTGG + Intergenic
1132887153 16:2187310-2187332 CGCTGGGCCCAGTGGACTGTAGG - Intronic
1132975957 16:2711369-2711391 CCCAGGCCCCCGTGGTCAGAGGG - Intergenic
1133201975 16:4209315-4209337 GCCTGGGGGCAGGGGGCAGAGGG - Intronic
1133218896 16:4309889-4309911 CTCTGGGCCCTGCGGGCAGGTGG + Intergenic
1133344227 16:5059599-5059621 CCATGGGCAAAGTGGGCAGCCGG - Intronic
1134065984 16:11228528-11228550 GCCTTGGTACAGTGGGCAGACGG - Intergenic
1134090114 16:11387047-11387069 CCCTGTGCCCAGGAGGCAGGGGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1137609373 16:49808813-49808835 CCCTGGGCCATGGGGGCAGGTGG - Intronic
1137668718 16:50266830-50266852 CCGTGAGCCTACTGGGCAGATGG + Intronic
1138349080 16:56336924-56336946 CCCGAGGCCCAGTGCTCAGAGGG - Intronic
1139348695 16:66321835-66321857 CCCTGGGACCAGAGGCCATATGG - Intergenic
1139821809 16:69726848-69726870 CTCAGGGCACAGTGCGCAGATGG - Exonic
1140477231 16:75245120-75245142 CCCTGAGCCCGGTGGGCTGCAGG - Intronic
1141038851 16:80654565-80654587 CCCAGGGCCCTGTATGCAGAGGG - Intronic
1141592848 16:85080089-85080111 GCCGGGACCCAGAGGGCAGAGGG + Intronic
1142155627 16:88531778-88531800 CCCTGGGACCCGTGGGGAGTGGG - Intronic
1142236540 16:88925149-88925171 CCATGTCCGCAGTGGGCAGAGGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142893385 17:2959451-2959473 GGCTGGGCCCAGGGGGCACATGG - Intronic
1144650697 17:17005104-17005126 CCCTGGGACCTGAGGGCTGAGGG - Intergenic
1146793355 17:35765217-35765239 TCCTCTGCGCAGTGGGCAGAAGG - Intronic
1147040061 17:37711572-37711594 GCCTGGGTCCAGTTTGCAGATGG + Intronic
1147312510 17:39603966-39603988 CCCTGCCTCCGGTGGGCAGAGGG + Intronic
1147998717 17:44375535-44375557 CCCGGGACCCACGGGGCAGAGGG - Intronic
1148240735 17:45998052-45998074 CCCGAGGCCCAGTGCCCAGAAGG - Intronic
1148685914 17:49501210-49501232 CCCTGTTCCCAGTGGCCACATGG + Intronic
1148789154 17:50163781-50163803 CCCTAGGCCCAATAGACAGAAGG + Intergenic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1150226704 17:63528346-63528368 CCCTGGGCCCAGGCAGCAGATGG + Intronic
1150266054 17:63833088-63833110 CCCTGGGCCCAGGAAGCAGTAGG - Exonic
1150950800 17:69801041-69801063 TCCTGGGCCCAGAGAGCACAGGG - Intergenic
1151265558 17:72952496-72952518 CCCCATGCCCAGTGAGCAGATGG - Intronic
1151320034 17:73347537-73347559 CTGTGGGCCCCGTGGGCTGAGGG - Intronic
1151409747 17:73914394-73914416 CTTTGTGCCCAGTGGGCAAAAGG - Intergenic
1151871831 17:76841776-76841798 CCCTGGACCCACTGGGTACAAGG - Intergenic
1152137288 17:78512020-78512042 CCTTGGGCCTAGGGAGCAGAAGG + Intronic
1152218391 17:79047614-79047636 CACTGGACCCAAAGGGCAGAAGG + Exonic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1152436345 17:80278588-80278610 CCATGGGCCCTGGAGGCAGACGG + Intronic
1152467963 17:80476384-80476406 CCCGGCGCCCAGGAGGCAGAGGG + Exonic
1152615436 17:81335794-81335816 CCCTGCTCAGAGTGGGCAGATGG + Intergenic
1152621786 17:81368541-81368563 CTCTGTGCCCAGTGGGCCCATGG + Intergenic
1152622448 17:81372160-81372182 CCATGGGCCCAGAAGGCACAGGG + Intergenic
1152691354 17:81719566-81719588 CCCGGGGTCCAGTGGGCAGAGGG - Intronic
1152809929 17:82376473-82376495 CCCTTGCCCCAGTGTTCAGATGG - Intergenic
1152821384 17:82439478-82439500 CCCTGGGCCCCATGGGTTGAGGG + Intronic
1152892759 17:82891854-82891876 CCCTGGGCTCAGTAGGGAGAAGG - Intronic
1153050505 18:898970-898992 GCCTGAGCCCAAAGGGCAGAGGG + Intergenic
1153255465 18:3165988-3166010 TCCTGGGCACAGTGGGCAGTGGG - Intronic
1153659800 18:7316772-7316794 CCCTGGGCCCTGTGGGGTCAGGG - Intergenic
1154383112 18:13870139-13870161 CCCTGCACTCAGTGGGCACAAGG + Intergenic
1155256143 18:23999776-23999798 GCCAGGGCCCAGCAGGCAGATGG + Intronic
1155717867 18:28969672-28969694 GCCTGGGTCAAGTGGGCATAAGG - Intergenic
1156339624 18:36199787-36199809 CCCAGGGCCCAGAGAGCAGTGGG + Exonic
1157295299 18:46437873-46437895 ACCTGGGACCTGTGGGCAGAGGG + Intronic
1157298364 18:46462096-46462118 CCCTGGGGACTGTGGGCAGGAGG + Exonic
1157736532 18:50054499-50054521 GCCAGGTCCCAGGGGGCAGATGG - Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158730711 18:60019624-60019646 CGCAGGGCCCAGTGCTCAGAAGG - Intergenic
1158774233 18:60556616-60556638 TGCTGGGCCAAGTGGGCAGAAGG + Intergenic
1159955197 18:74514007-74514029 CCCTGGGCCCAGCGGTAAGGAGG - Intronic
1160383642 18:78479720-78479742 CCGAGGGCACAGTGGGCAGAGGG - Intergenic
1160494621 18:79365606-79365628 CCCTTCAGCCAGTGGGCAGAAGG + Intronic
1160725178 19:614663-614685 CACAGGGCCCAGTGGGCGGCAGG + Intronic
1160772709 19:840300-840322 CCCTGGGCCCTGTGGACATCGGG + Intergenic
1161155154 19:2728729-2728751 CCCTGGGCCCTGTGGACATTGGG + Intronic
1161474316 19:4475658-4475680 CCCTGGGCACTGTGGACACATGG + Intronic
1161646385 19:5455859-5455881 CCCTGGCCCCCGAGGGCATACGG + Exonic
1161821932 19:6534943-6534965 CCCTGGCCTCAGTGTGAAGATGG - Exonic
1162366773 19:10254486-10254508 CCCAGGGCCCTGGAGGCAGAAGG + Intronic
1162806392 19:13139944-13139966 CCCTGGGAGCAGTGGGTAGGTGG - Exonic
1163054215 19:14706185-14706207 CCCTGGACACAGAGGCCAGAGGG + Intronic
1163102658 19:15107582-15107604 CCCAGGGCCCCGAGGACAGACGG + Intronic
1163160911 19:15463824-15463846 GCCGGGGTCCTGTGGGCAGAGGG - Intronic
1163288518 19:16364209-16364231 CCCAAGGCCCAGTTAGCAGAGGG + Intronic
1163370672 19:16899608-16899630 CCCTGGGGGCAGTGGTCAGTGGG + Intronic
1163435301 19:17292045-17292067 GCCTGAGCCCAGTCTGCAGATGG + Intergenic
1163512264 19:17742400-17742422 CCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1163715542 19:18870352-18870374 GCCCGGGACCAGTGGGCTGAGGG + Exonic
1164078595 19:21843252-21843274 GCCTGGGCCCAGTACACAGATGG - Intronic
1164206860 19:23066257-23066279 GCCTGGGCCCAGTGTACAGATGG - Intergenic
1164255493 19:23524628-23524650 GCCTGGGGCCAGTGCACAGATGG - Intergenic
1164281340 19:23771564-23771586 GCCTGGGCCCAGTGTACAGACGG + Intronic
1164700039 19:30278610-30278632 CCCAGGACCCAGGGGGCACAGGG - Intronic
1164776087 19:30854832-30854854 GCCTGGGCCGAGTGGTGAGACGG - Intergenic
1165068351 19:33241551-33241573 CCTGGGGCCCTCTGGGCAGAGGG - Intergenic
1165232100 19:34393668-34393690 CCCTGCGTCCTGTGGGCAGTGGG - Intronic
1166864192 19:45826156-45826178 CTCTGGGCCCTGCGAGCAGAGGG - Intronic
1166989901 19:46685864-46685886 ACCTGAACCCAGGGGGCAGAGGG + Intronic
925179267 2:1806436-1806458 AGCTGGGCCCAGCGGGCGGACGG + Intronic
925415844 2:3669681-3669703 TTCTGGGTCCAGTGGGCAGGTGG + Intronic
926890364 2:17634232-17634254 CCCAGGGCCCTGTGCTCAGAAGG + Intronic
927156018 2:20222252-20222274 CTCTGGCCCCAGTGGGAAGCAGG - Intronic
927277725 2:21275736-21275758 CCCTGGGGCCAGTGCCCAGAGGG + Intergenic
927514068 2:23661707-23661729 CCCCAGGCCCACTGGGAAGAGGG + Intronic
928181682 2:29072575-29072597 CCCTGTGCCCTGTGGGCACCAGG - Exonic
928269605 2:29844323-29844345 CCCCGGGGCCAGTGGGGAGCAGG + Intronic
929593678 2:43162506-43162528 CCTTGGGGGCAGTGGCCAGAGGG + Intergenic
929779170 2:44946800-44946822 CCTTGGGGCCAGTGGGAACATGG - Intergenic
930730517 2:54723971-54723993 CCCTGAGCCCAGCGTGGAGAGGG - Intronic
931667427 2:64619424-64619446 CCCTGGGCCACATGGGAAGAAGG - Intergenic
932336236 2:70932898-70932920 CCCTGGGCACAGAGAGCAGCCGG - Exonic
932574802 2:72956719-72956741 CCCTGGGTCCAGTGAGTAGAGGG - Intronic
932607774 2:73176155-73176177 CCCTCGACCCACTAGGCAGACGG - Intergenic
934175005 2:89571060-89571082 ACTTGGGCCCAGGAGGCAGAGGG - Intergenic
934285321 2:91645414-91645436 ACTTGGGCCCAGGAGGCAGAGGG - Intergenic
934521361 2:95022140-95022162 CCCTGGAGGCAGTGGGCACACGG + Intergenic
934577284 2:95410979-95411001 GGCAGGGCCCAGAGGGCAGAAGG - Exonic
934639581 2:96019653-96019675 GGCAGGGCCCAGAGGGCAGAAGG - Intergenic
934794069 2:97085724-97085746 GGCAGGGCCCAGAGGGCAGAAGG + Exonic
935332649 2:101988528-101988550 TCCTGGGCCCACGGGGCAGAAGG + Intergenic
935697108 2:105779603-105779625 CACTTGGCCTTGTGGGCAGATGG + Intronic
936093259 2:109514389-109514411 CCCTGGGGGCGGTGGGCGGATGG - Intergenic
937098573 2:119251248-119251270 CCAAGGGCCTAGTGGGCAGTTGG - Intronic
937305694 2:120869162-120869184 GCCTGGCCCCAGTGGGGACAGGG + Intronic
937325551 2:120987940-120987962 CACCGTGCCCAGTGAGCAGATGG - Intronic
938009722 2:127819361-127819383 CCCTTGGCCCAGAGAGCACATGG + Intergenic
938341729 2:130540480-130540502 TCCTGACCCCAGTGGGGAGAAGG + Intronic
938348100 2:130580229-130580251 TCCTGACCCCAGTGGGGAGAAGG - Intronic
939643848 2:144672204-144672226 CCATGGTCCCTGTGAGCAGATGG - Intergenic
940183646 2:150960272-150960294 CCCTAGACCCAGAGGCCAGAAGG + Intergenic
941414667 2:165205386-165205408 CCCGGGGCCCAGTGGGCCTGTGG - Intergenic
942452405 2:176116479-176116501 CCCTGGGCCCAACCGGCGGAAGG - Intronic
943858391 2:192828317-192828339 CCATGGGCACAGTGGACAGCAGG + Intergenic
944096348 2:195973095-195973117 ACATGGGCCCAGTGGCAAGAAGG + Intronic
944274612 2:197821700-197821722 CCATTGGCCCAGTGGTCATATGG + Intronic
946135867 2:217646464-217646486 CCCTGGCCCCTCTAGGCAGATGG - Intronic
946337653 2:219049354-219049376 CCCTGGCCCAGCTGGGCAGAAGG + Intergenic
947112936 2:226739010-226739032 CCCAGGGCCCTGTGAGGAGAGGG + Intronic
947463770 2:230324109-230324131 CCCTGGGCTCAGCGGGCATTTGG - Intergenic
947715989 2:232339058-232339080 CCCTGGACCTAGGGGGAAGATGG + Intronic
947735009 2:232449800-232449822 CCCTGGACCTAGGGGGAAGATGG + Intergenic
947843065 2:233221018-233221040 CCCAGGGCCCCATGGGAAGAGGG + Intronic
948433064 2:237932758-237932780 CCCTGGGCCAATTTGGAAGAAGG - Intergenic
948459862 2:238123868-238123890 CCCGTGGCCCAGTGGGGTGAGGG + Intronic
948588705 2:239036396-239036418 GCCTGGGCCCAGCGGGCTGGGGG + Intergenic
948614714 2:239191147-239191169 ACCTGGGCCAAGTGGGGAGGTGG + Intronic
948643264 2:239388553-239388575 GCCTGGCCCCAGAGGGCAGCTGG + Intronic
948660925 2:239506011-239506033 CCCTCGGTCCAGTAGGCAGTGGG + Intergenic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948749720 2:240124744-240124766 TCCTGCACCCACTGGGCAGAGGG - Intergenic
1169801480 20:9516136-9516158 CTCCGAGCCCAGCGGGCAGAGGG + Intronic
1170704506 20:18733169-18733191 CAGTTGGCTCAGTGGGCAGAAGG + Intronic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1172092101 20:32440522-32440544 CCCTCAGCGCAGTGGGCACAAGG - Intergenic
1172278430 20:33693972-33693994 CCAGGGGCCCAGTGGGCAGGAGG + Intergenic
1172514351 20:35522771-35522793 CACATGGCCCAGTGGGCACAGGG + Intergenic
1172595367 20:36147709-36147731 CCCTGGTCCCAGGTGCCAGAAGG - Intronic
1172885629 20:38229025-38229047 CCCTGTACCCACTGGCCAGATGG - Intronic
1173788550 20:45812775-45812797 CCCGGGGTCCGGTGGGCAAAAGG + Exonic
1174386036 20:50189278-50189300 CCCTGGCCCCAGCGGGCAGGCGG - Intergenic
1174396607 20:50250641-50250663 CTCTGGGGCCACTGAGCAGATGG + Intergenic
1174862612 20:54105347-54105369 CCCAGAGGCCAGTGGGAAGATGG - Intergenic
1175281728 20:57808325-57808347 CGCTAGGGCCAGTGGGAAGATGG - Intergenic
1175698988 20:61123753-61123775 CCATGGGCACAGTGTGGAGAAGG + Intergenic
1175754716 20:61522239-61522261 CCCCGGACCCAGTGGGCACGTGG + Intronic
1175779689 20:61674499-61674521 CCCTGGGCCCAGTGCTCAGCAGG + Intronic
1176078398 20:63259633-63259655 CCCTCGGCTGAGGGGGCAGAGGG + Intronic
1176594852 21:8683486-8683508 GCCTGGGCCCTGGGGGCAAAGGG + Intergenic
1179537046 21:42059477-42059499 CCATGGGACCACTGGCCAGATGG - Intergenic
1179885904 21:44314213-44314235 TCCTGCCCCCAGTGGGCAGGAGG + Intronic
1179903369 21:44406532-44406554 CTCTGGGCCCAGTGAGCATCGGG + Intronic
1180199485 21:46215873-46215895 CCCAGGGCCCTGAGGGCGGATGG - Intronic
1180632800 22:17241489-17241511 ACCTGGGCCCAAGGGGCAGAGGG - Intergenic
1180959022 22:19754390-19754412 CCCTGGGACCAGGGAGCAGATGG + Intergenic
1181457895 22:23070178-23070200 GCCTGTGCCCAATGGACAGAGGG + Intronic
1181460762 22:23084719-23084741 CCCAAGGCCCAGTGGGGAGCTGG + Intronic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1181766543 22:25096273-25096295 CCCTGACCCCAGTGGGGCGAAGG - Intronic
1181925503 22:26355438-26355460 CCCTGGGCCCAGTGGTGAGGTGG + Intronic
1182273184 22:29168733-29168755 CCCAGGGCCTTGTGGGCAGAGGG - Intergenic
1182416237 22:30223166-30223188 CCCAGCGTCCAGTGGGAAGACGG - Intergenic
1182621269 22:31620031-31620053 CCCTGGGCCCAGTTCACAGCAGG - Intronic
1183545594 22:38453601-38453623 CCCTGGGCTCAATGAGCAGTGGG - Intronic
1183677293 22:39306740-39306762 CCCTGGGCCATGGGGGAAGATGG + Intergenic
1184108344 22:42381499-42381521 GTCAGGGGCCAGTGGGCAGAGGG + Exonic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1184394058 22:44222236-44222258 ACATGGGCCCAAAGGGCAGAGGG + Intergenic
1184478147 22:44732390-44732412 AGGTGGGCACAGTGGGCAGAGGG + Exonic
1184650423 22:45917071-45917093 CACAGTGCCCAGTGGGCAGGTGG - Intergenic
1184653818 22:45931408-45931430 CCCTGGGCCAGGTGGGCTCAGGG + Intronic
1185153278 22:49178607-49178629 CCCTGGGCCCAGCGGGGAGCTGG - Intergenic
950360123 3:12444127-12444149 TCCTGAGCCCAGTGGGAAAATGG - Intergenic
950459197 3:13111207-13111229 CCCTGGGCACACTGGGGAGGTGG - Intergenic
950491512 3:13307950-13307972 CCCTGGGTGCAGTGGGCAAGCGG - Intergenic
950728452 3:14935172-14935194 CTCTGTGCCCAGTGAGCAGAGGG - Intergenic
951506401 3:23449954-23449976 CAGTGGGCCCAGTGGCCAGGAGG - Intronic
952130577 3:30356984-30357006 CACTGGGCCAAGTGGGCAAGTGG - Intergenic
952389100 3:32864671-32864693 GCCTGAGCCCTGAGGGCAGACGG - Intronic
952886804 3:38017279-38017301 CCCTGGGGTCTATGGGCAGAGGG + Intronic
953140523 3:40225491-40225513 CCCTGGACCCAGTGGACTGTGGG - Intronic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953905959 3:46868418-46868440 CCGTCAGCACAGTGGGCAGAGGG - Intronic
954130896 3:48560398-48560420 CCCTGGGCCCAGGGCTCACAAGG + Intronic
954289681 3:49643022-49643044 GGCTTGGCACAGTGGGCAGATGG - Exonic
954387409 3:50251542-50251564 ACCTGAGCGCAGTGAGCAGAGGG + Intronic
954437304 3:50503085-50503107 CCCCGGGCGCAGCGGGCAGCCGG + Intronic
954783834 3:53079063-53079085 CCTCTGGCCCAGTGGGCAGTGGG + Intronic
954795789 3:53160917-53160939 CCCAGGCCCCAGCGGGCGGAGGG + Intronic
960632168 3:119743198-119743220 GCCTGCGCCCAGGAGGCAGAGGG - Intronic
961270087 3:125681761-125681783 CCATGGCCCCAGTGGAGAGAGGG - Intergenic
961387408 3:126530282-126530304 CCCAGGGGCCAGTGGGTAGAAGG - Intronic
961458190 3:127034480-127034502 CCCGGGGCCCGGTTGGCAGCTGG + Exonic
962009771 3:131381757-131381779 CCGAAGGCCCAATGGGCAGAGGG - Intronic
962317260 3:134366721-134366743 CCCTGTGCCCAGTGTCCAGAAGG + Intronic
967325891 3:188239211-188239233 GCCTGGGCCCTGGGTGCAGATGG + Intronic
967826163 3:193879365-193879387 TCCTAGTCTCAGTGGGCAGATGG - Intergenic
967858343 3:194134541-194134563 CCCAGGGCCCCGCGGGGAGAGGG + Intergenic
968001630 3:195210385-195210407 CCCTGAACACAGTGGGCAGGAGG + Intronic
968547926 4:1208048-1208070 CTCAGGGCCCAGTGGCCAGATGG + Intronic
968548656 4:1211246-1211268 CCACAGACCCAGTGGGCAGAGGG + Intergenic
969061463 4:4438636-4438658 CTCTGGGCCCAGTGGCCATCCGG + Intronic
969621799 4:8282354-8282376 GCCTATGCCCAGTGGGCAGAAGG - Intronic
970600310 4:17636780-17636802 CCCAGGGCCCCCTGGGGAGATGG + Intronic
972323696 4:37995486-37995508 CCCTGGGCTCAGTACACAGATGG + Intronic
982126662 4:152189716-152189738 CCAGGGGCCCAGTGAGCACAGGG - Intergenic
983520269 4:168701272-168701294 CCATGTGCCCAGTGCTCAGAAGG + Intronic
984471477 4:180181363-180181385 CCCAGGACCCAGTAGGCCGAGGG - Intergenic
985487863 5:162075-162097 CCGTGGGCGCAGTGGCCAGGGGG - Intronic
985547439 5:516927-516949 TCCTGGGCCCAGTGTCCAGATGG + Intronic
985644183 5:1077341-1077363 CCCTGGGCCCAGGTAGCAGGAGG + Intronic
985707469 5:1409846-1409868 CCCTGTGCTCTGTGTGCAGATGG - Exonic
985726717 5:1520042-1520064 CCAGGGACCCAGTGGGCAGCAGG + Intronic
986430144 5:7673604-7673626 ACTTGGACCCAGTGGGCAGAGGG - Intronic
989648176 5:43659243-43659265 GGCTGGGCCCTGTGTGCAGAGGG + Exonic
990948093 5:61270636-61270658 CCCTGGGCCAAAGGGCCAGAGGG - Intergenic
992444131 5:76819311-76819333 TCCTGGGCACGCTGGGCAGACGG + Intronic
994093356 5:95827444-95827466 CCCTGGGCACAGGGAGCAGCAGG - Intergenic
997716105 5:136044248-136044270 GCCTGGGGCCAGTGGGCACGTGG - Intronic
999113667 5:149142630-149142652 CCCTGGGCCCACCGGGCTGCAGG - Intronic
1000269047 5:159665683-159665705 CCCTGTGCCCATTAGGCAGATGG - Intergenic
1001246413 5:170108389-170108411 CCCTGAGCCCAGTGACAAGACGG + Exonic
1001751679 5:174136270-174136292 CCCTGGGCTGGGTGGGCAGTAGG - Intronic
1002079489 5:176728883-176728905 CCTTGGGCCCTGTGGGCTGAAGG + Intergenic
1002414045 5:179109217-179109239 CCCTTGACCCAGGAGGCAGAGGG + Intergenic
1002521222 5:179794191-179794213 ACCTGGGCCTAGGGGGCAGAGGG - Intronic
1003278586 6:4673434-4673456 CACTGGCCCCAGTGGGCAAGAGG - Intergenic
1003935128 6:10968347-10968369 ACCAGGGCCCAGTGGACAAAGGG + Intronic
1004115160 6:12759563-12759585 CCTTGGGCTCAGTGGGCATGGGG + Intronic
1005463898 6:26093272-26093294 CCCAGGGCACAGTGGGAAGAGGG + Intronic
1006286934 6:33103970-33103992 CCATGGGCCCCGGGGGCTGAAGG - Intergenic
1006391472 6:33761404-33761426 GCCAGGCCGCAGTGGGCAGAGGG + Intergenic
1006719069 6:36138493-36138515 ACGTGGGCCCAGTGGGCTGCAGG + Intronic
1007528716 6:42521280-42521302 CCCTGGGCCCAAAGAGCACACGG - Intergenic
1007547962 6:42708530-42708552 CCCTGGACACACTGAGCAGATGG + Intronic
1007736405 6:43984927-43984949 ACCTGAGCCCTGTGGGCAGGCGG - Intergenic
1008231738 6:48991015-48991037 TGCTGGGCAGAGTGGGCAGAAGG + Intergenic
1009975077 6:70663664-70663686 CACAGGGCCCAATGGGTAGAAGG + Intergenic
1012938843 6:105396507-105396529 TCCTTGTCCCAGTGGGGAGATGG + Intronic
1014726581 6:124978656-124978678 CCCACAGCTCAGTGGGCAGAAGG + Intronic
1015312329 6:131779379-131779401 CCCTAAGCCCAGGGGGAAGAGGG - Intergenic
1015658548 6:135546902-135546924 CCCTGTGACCAATGGGCGGAGGG + Intergenic
1015936124 6:138407431-138407453 CTCTGGGCCCACTGGGATGAAGG + Intronic
1017042058 6:150315617-150315639 CCCTGGGCCCAGGAGCCTGATGG + Intergenic
1018058317 6:160071026-160071048 CCCTGTGCCCAGGGCCCAGAAGG + Intronic
1018857064 6:167682300-167682322 CCCTGGGGCCGATGGCCAGAAGG + Intergenic
1018908968 6:168091021-168091043 CCCTGGGCTCCGTGGGGAGAAGG + Intergenic
1018953926 6:168395447-168395469 CCCTCTTCCCAGTGTGCAGATGG - Intergenic
1019333834 7:473372-473394 CCCTGGGTCCAGGAGGCAGACGG + Intergenic
1019384333 7:746275-746297 GCCTGGGCCCAGCGGGCAGGGGG - Intronic
1019384456 7:746684-746706 CCCTGGGCAGGGTGGGCAGGGGG - Intronic
1019447439 7:1078745-1078767 CCGGGGTCCCAGTGGGCAGGTGG - Intronic
1019511834 7:1421616-1421638 CCCGAGGGCCAGGGGGCAGATGG + Intergenic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1019716750 7:2542701-2542723 CCCTGGGCCCTGTGGGCAGCAGG + Intronic
1021760008 7:23894445-23894467 CCCTGGGCCTGGTGGGTATAGGG + Intergenic
1022497287 7:30861098-30861120 CCCTGGGTCCTGCAGGCAGATGG + Intronic
1022972440 7:35530287-35530309 CCCTCGCATCAGTGGGCAGAGGG - Intergenic
1023861631 7:44220498-44220520 CCCTGGGCACAGAGGGGACAGGG + Intronic
1023862490 7:44224867-44224889 ACCTGGGCCCAGGTGGCAGGTGG - Intronic
1026848368 7:73710083-73710105 ACCTGGGCCCAGCAGGCACAAGG + Intronic
1029503685 7:100949606-100949628 GCATGGGCCCAGCGGGCAGGGGG - Exonic
1032090995 7:128911499-128911521 CCCTGGGCTCAGCAGGCAGAGGG + Intergenic
1032358143 7:131229318-131229340 CACTGGGGCCTGTGGGCAGGTGG - Intronic
1033480384 7:141734412-141734434 CCCTGGGCCTAGTGGGAAAAAGG - Intergenic
1033529181 7:142245773-142245795 CCCTGGGGCAGGTGGGCAGGAGG + Intergenic
1034292108 7:149941066-149941088 CTCTGAGCCCAGGGGACAGAAGG - Intergenic
1034447758 7:151122191-151122213 CCCTGGGCCAAAGGGGCAGAGGG + Intronic
1034528227 7:151679464-151679486 CCCTGTGTCCAGTGGGGAAAGGG - Intronic
1034813965 7:154155831-154155853 CTCTGAGCCCAGGGGACAGAAGG + Intronic
1034954381 7:155325477-155325499 ACCTGGGCTCTGTGGCCAGAGGG - Intergenic
1035094172 7:156340169-156340191 CCCTGACCACACTGGGCAGATGG + Intergenic
1035186703 7:157131845-157131867 GCTTGGGCCCAGGAGGCAGAGGG + Intergenic
1035219533 7:157397614-157397636 CCCAGGGCCCAGCTGGGAGAGGG - Intronic
1035362466 7:158322569-158322591 ACCTGGCCCCAGTGGGCAACGGG + Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035546104 8:483529-483551 CACTGGGCCCAGGGAGCAGAAGG - Intergenic
1035628483 8:1091067-1091089 CCCGGAGCCCTGTGCGCAGACGG - Intergenic
1035652780 8:1281461-1281483 GCCTGTGCCCAGGGGACAGAAGG - Intergenic
1036640333 8:10579603-10579625 CGCTGGGCCCAGTGGGGGGCCGG - Intergenic
1038268863 8:26059122-26059144 CCCTGTGCCCAGTGCACAGCTGG + Intergenic
1039798532 8:40935240-40935262 CCTTGGGCCTAGTAGGCAGAGGG + Intergenic
1040705964 8:50127477-50127499 CCCACCGCCCAGTGGGTAGAGGG + Intronic
1041639523 8:60181499-60181521 CACTGGGGCCTGTGGGCAGGTGG + Intergenic
1041970707 8:63738975-63738997 CCCAGGTCTCAGTGGACAGAGGG - Intergenic
1043401108 8:79885129-79885151 CCCTGAGGGCAGTGGGCTGAGGG + Intergenic
1045468394 8:102489675-102489697 CCCTGGGCCCGGGAGGCAGGTGG + Intergenic
1046860959 8:119091198-119091220 GACTGGGCCCATTGGGAAGAAGG + Exonic
1048208687 8:132436813-132436835 CCCTGGGCTCAGTCCTCAGAAGG + Intronic
1048210401 8:132449939-132449961 CTCTGGACACAGTGGGAAGAGGG - Intronic
1048442282 8:134468876-134468898 CACTGGGCCATGTGGGCACAGGG + Intergenic
1048908650 8:139112991-139113013 CTATGGGCTCAGTGGGCAGCAGG + Intergenic
1048935253 8:139349870-139349892 CCCTGGGGCCAGAAGCCAGAGGG - Intergenic
1048956761 8:139543769-139543791 CCCTGGGCCAGGTGGGAAGGAGG + Intergenic
1049289612 8:141794908-141794930 GCCAGGGCCAAGTTGGCAGAGGG - Intergenic
1049299650 8:141862783-141862805 CCCTGAACCCATTGGGGAGAGGG + Intergenic
1049340670 8:142110856-142110878 CACTGGGCCCGCTGGTCAGAAGG - Intergenic
1049407888 8:142459883-142459905 CCCTGCCCCCAGCAGGCAGAGGG + Intronic
1049427690 8:142544669-142544691 GCCGAGGCCCAGCGGGCAGATGG + Exonic
1049745087 8:144259864-144259886 CCCTGGGGTCAGCGGGGAGAGGG + Intronic
1050594711 9:7194087-7194109 CCCTGGGCCAAGGGGGAGGAGGG - Intergenic
1051431409 9:16984332-16984354 CCCTGGTCCCCTTGGTCAGAGGG + Intergenic
1051729499 9:20125604-20125626 ACCTGGGCCCAGTGGAATGAGGG - Intergenic
1052383291 9:27794989-27795011 CACTGGGGCCTGTGGGGAGATGG - Intergenic
1052509072 9:29390989-29391011 CCCTGCTCCCAGTGCGCAGGTGG + Intergenic
1053203681 9:36169223-36169245 CCCTGGGCCCAGAGCTCAGGAGG - Intergenic
1056754346 9:89372736-89372758 CCCTGGGCTCAGTGACAAGAGGG - Intronic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057989702 9:99755782-99755804 CCATGGGCCCAGGAGGCAGTTGG + Intergenic
1059190906 9:112325320-112325342 CCCTTCCCCCAGTGTGCAGACGG - Intronic
1059325398 9:113501290-113501312 CCCCGGGCCCGGCGGGGAGAGGG - Intronic
1059331755 9:113539947-113539969 CCACGGGCCCAGTGCCCAGATGG - Intronic
1059418966 9:114179251-114179273 CCCTGGGCCCAGGGAGCACAGGG - Intronic
1059919465 9:119141823-119141845 GCTTGGGCCCTGTGGGCAGTGGG + Intergenic
1060221730 9:121767695-121767717 CCCTGACAGCAGTGGGCAGATGG + Intronic
1060987539 9:127828414-127828436 CCCTGGGGCCGGTGGCCAGAGGG - Intronic
1061138600 9:128751010-128751032 CCCTGGGGACAGGGTGCAGAAGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061160545 9:128891591-128891613 GTCTGGGCCCTGGGGGCAGAAGG - Intronic
1061216502 9:129224821-129224843 CCCTGGGCCCAGGGAGCGGAGGG - Intergenic
1061482708 9:130904836-130904858 CCCTGACCCCAGAGGGCCGAAGG + Intronic
1061493542 9:130959245-130959267 CACTGGGCCCTGTGGGCAGGTGG - Intergenic
1061853247 9:133428463-133428485 CACTGCGCCCAGTTAGCAGATGG + Intronic
1062016008 9:134291733-134291755 GCCTCGGCCCAGTGGGGTGATGG - Intergenic
1062535700 9:137020255-137020277 GCCTGGGACCCCTGGGCAGAGGG - Intronic
1185610081 X:1389162-1389184 CCCAGGGTCCTGTGGGCTGAAGG - Intronic
1186512410 X:10139710-10139732 GCTTGAGCCCAGGGGGCAGAGGG - Intronic
1189642616 X:43089055-43089077 CCCAGGGCCCTGTAGTCAGAAGG + Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1190110645 X:47586851-47586873 CCCTGGGACCAGTGGGGATGAGG + Intronic
1190385786 X:49881023-49881045 CCCTGGGCTCATGGGCCAGAAGG - Exonic
1190880984 X:54492556-54492578 CCCTGGGCCGGCTGGGCAGTGGG + Intronic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1192805625 X:74506133-74506155 CCCTGAGCCCATGGGTCAGAAGG - Intronic
1196768398 X:119270408-119270430 TCCTGGGTCCAGTGTGCAGAAGG - Intergenic
1199984151 X:152938313-152938335 CCCTGGCCCCAGAAGCCAGAGGG - Intronic