ID: 905028328

View in Genome Browser
Species Human (GRCh38)
Location 1:34865897-34865919
Sequence GGGCGCCTTCGCGTGGGATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905028320_905028328 -10 Left 905028320 1:34865884-34865906 CCCTGCCCAGCCCGGGCGCCTTC 0: 1
1: 0
2: 6
3: 47
4: 437
Right 905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG 0: 1
1: 0
2: 0
3: 4
4: 116
905028318_905028328 -8 Left 905028318 1:34865882-34865904 CCCCCTGCCCAGCCCGGGCGCCT 0: 1
1: 0
2: 23
3: 65
4: 611
Right 905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG 0: 1
1: 0
2: 0
3: 4
4: 116
905028313_905028328 24 Left 905028313 1:34865850-34865872 CCAGGTGAGGGGCGCAGGGCGGA 0: 1
1: 0
2: 2
3: 13
4: 290
Right 905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG 0: 1
1: 0
2: 0
3: 4
4: 116
905028319_905028328 -9 Left 905028319 1:34865883-34865905 CCCCTGCCCAGCCCGGGCGCCTT 0: 1
1: 0
2: 3
3: 27
4: 375
Right 905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905028328 Original CRISPR GGGCGCCTTCGCGTGGGATC AGG Exonic
900191679 1:1354734-1354756 GGGCGGCTCCGCGTGGGGTTCGG + Exonic
900640408 1:3685634-3685656 GGGCGCCAACGGGTGGGCTCGGG + Intronic
905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG + Exonic
907341317 1:53738264-53738286 GGGGGCTTTTGCGTGGAATCAGG - Intergenic
908378639 1:63573213-63573235 GGGCTGCTTCGAGTGGGATTAGG + Intronic
910759081 1:90717925-90717947 GGGCGCGTTCGCTTGTAATCCGG + Intergenic
910825913 1:91406986-91407008 GCGCGCCTTCTAGTGGGAGCTGG - Intergenic
911510181 1:98801608-98801630 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
911984393 1:104602257-104602279 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1071550370 10:86561799-86561821 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1076335534 10:129704035-129704057 GGCCGCCTTCCCCAGGGATCAGG + Intronic
1077919207 11:6630644-6630666 GGGCACCTTCGCGCTGGATGCGG - Exonic
1079847160 11:25487015-25487037 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1088555394 11:111055566-111055588 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1092738922 12:11610301-11610323 GGGCTGCTTCGAGTGGGATTGGG + Intergenic
1092790113 12:12063550-12063572 GGGCTGCTTCGAGTGGGATTGGG - Intronic
1092924375 12:13260139-13260161 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1096007499 12:48184478-48184500 AGACTCCTTCGCCTGGGATCGGG + Exonic
1098920401 12:76297240-76297262 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1100940821 12:99721198-99721220 GGGCTGCTTCGAGTGGGATTAGG - Intronic
1112325305 13:98439667-98439689 GGGCGCCTGGGCCTGGGATGTGG + Intronic
1120531479 14:85637644-85637666 GGGTGCCTTCTCATGTGATCAGG + Exonic
1122508146 14:102245269-102245291 GGGCTGCTTCGAGTGGGATTAGG - Intronic
1131684598 15:94755928-94755950 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1132263471 15:100445669-100445691 GGGCTGCTTCGAGTGGGATTAGG - Intronic
1132569180 16:636647-636669 GGGCGCCTTCCCTTGGTTTCGGG + Intergenic
1133033854 16:3023950-3023972 GGGGTCCTGCGGGTGGGATCTGG + Exonic
1133651794 16:7819859-7819881 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1135315231 16:21439472-21439494 GGGCTGCTTCGAGTGGGATTAGG - Intronic
1135368157 16:21871740-21871762 GGGCTGCTTCGAGTGGGATTAGG - Intronic
1135443660 16:22499409-22499431 GGGCTGCTTCGAGTGGGATTAGG + Intronic
1141906929 16:87033099-87033121 GGCCGCCCTGGCGTGGGCTCAGG - Intergenic
1143141988 17:4745925-4745947 CGGCGCCTTCGGGTGGGGGCAGG - Exonic
1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG + Intronic
1146371052 17:32265897-32265919 GGGCGCCCTCGCCTCGGAGCCGG + Intergenic
1150676069 17:67246180-67246202 GGGCGCCTTGGCGCGGGCTGAGG + Intergenic
1156095816 18:33530868-33530890 GGGTGCCTTTGTGGGGGATCTGG - Intergenic
1158643399 18:59221304-59221326 GGGCGCCTGCGGGTGGGGTCAGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161827289 19:6576754-6576776 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1162721702 19:12666677-12666699 GGGCGCCTACGCGCGGGCTTCGG - Exonic
1162798695 19:13099456-13099478 GGGCGCCGTCGTCTGGGACCCGG + Exonic
1164834870 19:31350179-31350201 GGGGGCCTGCCCGTGGGCTCTGG - Intergenic
1168248808 19:55129027-55129049 GGGCTGCTTCGAGTGGGATTGGG - Intergenic
933551998 2:83789467-83789489 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
934142081 2:89056396-89056418 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
934227157 2:90144150-90144172 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
940107804 2:150117979-150118001 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
945173905 2:207022741-207022763 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
947870480 2:233434818-233434840 GGTCGGCCTCGCGTGGGAACAGG - Exonic
1169044430 20:2524664-2524686 GGGGGCCTTCGCAGAGGATCTGG + Intronic
1170890246 20:20369502-20369524 GGGCGCCTTCTCGTCGGGCCCGG - Exonic
1173652565 20:44676176-44676198 GGGCTGCTTCGAGTGGGATTGGG - Intergenic
1173672803 20:44810060-44810082 GGGCGCCTTCCCAGGGGATTGGG + Intronic
1174066338 20:47868373-47868395 GGGCGACTTTGCCTGGGATCTGG - Intergenic
1174157739 20:48527718-48527740 GGGTGACTTTGCCTGGGATCTGG + Intergenic
1176686106 21:9849838-9849860 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1179590795 21:42406457-42406479 GGGCGCCTCTGGGTGGGATGGGG + Intronic
1182111324 22:27725835-27725857 AGGCGCTTTCACGTGGCATCAGG + Intergenic
1182732689 22:32507938-32507960 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
951315879 3:21189532-21189554 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
953076728 3:39578351-39578373 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
954575002 3:51671140-51671162 GGGCGCGTGCGCGCGGGACCCGG - Intronic
954690857 3:52394914-52394936 GGGAGCCTTTGCCTGGCATCTGG + Exonic
958422454 3:93943550-93943572 GGGCAGCTTCGAGTGGGATTAGG - Intronic
959287950 3:104440471-104440493 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
959485356 3:106923277-106923299 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
961712254 3:128836621-128836643 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
965861471 3:173155742-173155764 GGGCTGCTTCAAGTGGGATCAGG + Intergenic
966085890 3:176066799-176066821 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
966279879 3:178214115-178214137 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
966398062 3:179521949-179521971 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
967152535 3:186663160-186663182 GGGCTGCTTCGAGTGGGATTAGG - Intronic
968901844 4:3435706-3435728 GGGTGGCTTCTGGTGGGATCCGG - Intronic
969653611 4:8482949-8482971 GGGCTGCTTCGAGTGGGATGAGG + Intronic
970042469 4:11811448-11811470 GGGCTGCTTCGAGTGGGATGAGG - Intergenic
970853581 4:20630289-20630311 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
971453699 4:26823575-26823597 GGGGGCCTTTGTGTGGAATCTGG + Intergenic
974047454 4:56908925-56908947 GGGCGCCCTCGCGAGGCGTCGGG - Intronic
974904353 4:68037070-68037092 GGGCTGCTTCGAGTGGGATTGGG - Intergenic
981079168 4:140622169-140622191 GGGCGCCTTCCCGGGGGAGTGGG - Exonic
982396258 4:154918841-154918863 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
983346005 4:166525899-166525921 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
984412219 4:179408796-179408818 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
985616684 5:927057-927079 GGGCGGCTTCGCGGGGACTCGGG + Intergenic
995124645 5:108568184-108568206 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
996918180 5:128735436-128735458 GGGCTGCTTCGAGTGGGATTAGG - Intronic
1001069534 5:168572857-168572879 GGGCTGCTTCGAGTGGGATTAGG + Intronic
1004507595 6:16259537-16259559 GGGCTGCTTCGAGTGGGATTAGG + Intronic
1004768165 6:18754644-18754666 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1017873121 6:158502873-158502895 GGGCGCTGTCGGGTGGGCTCAGG - Exonic
1017921996 6:158880916-158880938 GGGCTGCTTCGAGTGGGATTAGG + Intronic
1022518905 7:30993258-30993280 GGGCGACTGTGCGTGGGAACGGG - Intergenic
1031364365 7:120886178-120886200 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1031777858 7:125923569-125923591 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1037482144 8:19314384-19314406 GGGCGCCCCCACGTGGGGTCTGG + Intronic
1043599414 8:81919392-81919414 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1043838190 8:85068614-85068636 GGCCTGCTTCGAGTGGGATCAGG - Intergenic
1047856823 8:128919776-128919798 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1049774698 8:144398914-144398936 GGGCGCCTCCTGGTGGGACCTGG - Intronic
1050118065 9:2280888-2280910 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1053610613 9:39709710-39709732 GGGTGCCTTCTCATGAGATCTGG - Intergenic
1053783210 9:41631752-41631774 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1053868648 9:42467732-42467754 GGGTGCCTTCTCATGAGATCTGG - Intergenic
1054087640 9:60761447-60761469 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054171163 9:61841894-61841916 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1054242910 9:62632685-62632707 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054557034 9:66667203-66667225 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054666370 9:67738918-67738940 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1055627193 9:78186277-78186299 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1057868168 9:98697851-98697873 GGGGGCATTCGCATGGGCTCTGG + Intronic
1057881608 9:98796550-98796572 GGGCGCCTGCGGGCGGTATCCGG - Intronic
1060737426 9:126074957-126074979 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1060897150 9:127225264-127225286 GGGCGCACTCGGGTGGGCTCGGG - Intronic
1185991482 X:4896755-4896777 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1186112441 X:6272738-6272760 GGGCTGCTTCGAGTGGGATTGGG + Intergenic
1191013782 X:55788858-55788880 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1193537556 X:82732386-82732408 GGGCTGCTTCGAGTGGGATTAGG - Intergenic
1198598852 X:138263970-138263992 GGGCTCCTTCGAGTGGGATTAGG - Intergenic
1198983302 X:142423896-142423918 GGGCTGCTTCGAGTGGGATTAGG + Intergenic
1200007210 X:153095104-153095126 GGGCTGCTTCGAGTGGGATTAGG + Intergenic