ID: 905028528

View in Genome Browser
Species Human (GRCh38)
Location 1:34866688-34866710
Sequence CATCGACGGCAGAGCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905028528_905028536 16 Left 905028528 1:34866688-34866710 CCCTCAAGGCTCTGCCGTCGATG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 905028536 1:34866727-34866749 GGACAGTCTGTCCTTCCGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 70
905028528_905028532 -5 Left 905028528 1:34866688-34866710 CCCTCAAGGCTCTGCCGTCGATG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 905028532 1:34866706-34866728 CGATGCCTAGGCCCGAACTGAGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905028528 Original CRISPR CATCGACGGCAGAGCCTTGA GGG (reversed) Intronic
900496804 1:2979394-2979416 CCTGGACTGCAGAGCCCTGATGG - Intergenic
901019438 1:6248456-6248478 CAACGACGGCAGAGTAATGAGGG + Exonic
901563822 1:10095469-10095491 CATCGAAGCCAGAGCAGTGAAGG + Exonic
903367674 1:22815132-22815154 CATTGACGGCAGAGCCATGTGGG + Intronic
903744809 1:25579717-25579739 CATTGAAGGCAGAGCTTCGAGGG - Intergenic
905028528 1:34866688-34866710 CATCGACGGCAGAGCCTTGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
909665936 1:78133516-78133538 CATGGAGGAGAGAGCCTTGAAGG + Intronic
916979155 1:170114957-170114979 CACCGAAGGCAGAGTCTGGATGG + Intergenic
921361037 1:214331315-214331337 CATGAAGGACAGAGCCTTGATGG + Intronic
922252709 1:223864427-223864449 CAGGGACAGCAGAGCCTGGATGG + Intergenic
924551903 1:245085940-245085962 CATCGAGGGCAAAGCCTTGGTGG - Intronic
1063542138 10:6944610-6944632 CATGGAAGGAAGAACCTTGAAGG + Intergenic
1067045725 10:42984173-42984195 CAGTGAGGGCAGAGCCTTGATGG - Intergenic
1069260611 10:66390279-66390301 CATCAACAGCAAAGCCTTAAGGG + Intronic
1070542536 10:77426771-77426793 CATCCCCAGCAGAGCCTTAAAGG + Intronic
1077151236 11:1074022-1074044 CATCAAAGGCACAGCCTTGGGGG + Intergenic
1077206851 11:1348947-1348969 CATATACGGCAGAGCCATGTGGG + Intergenic
1077776432 11:5277051-5277073 CTCCGCAGGCAGAGCCTTGATGG - Intronic
1087137278 11:94733602-94733624 CATCTAAGGCAGAGGCCTGAGGG - Intronic
1092017636 12:5172350-5172372 CATCTGCGGCAGAGCCTTAGAGG + Intergenic
1114933636 14:27506711-27506733 CATTGAAGTCAGAGCCTTGAGGG - Intergenic
1202836415 14_GL000009v2_random:80443-80465 CATTGAAGACAGAGCCTTGGTGG + Intergenic
1150999598 17:70359135-70359157 CATCAAAGCCAGAGCCCTGAAGG - Intergenic
1151517790 17:74607583-74607605 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151517814 17:74607681-74607703 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1157186996 18:45549220-45549242 CACCGAAGGCAGAGCATTGATGG - Intronic
1158559853 18:58504870-58504892 CATCGACGGTAGAGCATTCCAGG + Intronic
1162259228 19:9518869-9518891 CAGGGACAGCAGAGCCTGGATGG - Intergenic
1167812538 19:51847337-51847359 CATCGACGGGAGAGGCTGGTGGG - Intergenic
1202636224 1_KI270706v1_random:46922-46944 CATTGAAGACAGAGCCTTGGTGG - Intergenic
939761183 2:146182065-146182087 CATCAACAGCAAAGTCTTGATGG - Intergenic
1171882359 20:30627861-30627883 CATTGAAGACAGAGCCTTGGTGG - Intergenic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
955417617 3:58707040-58707062 CATCGACAGAAAAGCCCTGAGGG - Intergenic
958946689 3:100370600-100370622 CATCTACGCCAAAGCTTTGAGGG + Intronic
960589738 3:119353972-119353994 CATTGACAGCAGAGACCTGAGGG + Intronic
962942472 3:140138305-140138327 CATGGACAGCAGAGCTGTGAGGG - Intronic
966004922 3:174998436-174998458 TATCTACTGCAGACCCTTGAGGG - Intronic
966909209 3:184549238-184549260 CATCCTCGGCAAAGCCTGGATGG + Intronic
973366029 4:49210308-49210330 CATTGAAGACAGAGCCTTGGTGG - Intergenic
973394568 4:49582143-49582165 CATTGAAGACAGAGCCTTGGTGG + Intergenic
1202763538 4_GL000008v2_random:132789-132811 CATTGAAGACAGAGCCTTGGTGG - Intergenic
987286755 5:16465240-16465262 CATGGACGGCTGGGCCTTGATGG + Exonic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
997590397 5:135068706-135068728 AAACCACGGCAGATCCTTGAAGG + Intronic
998139183 5:139690343-139690365 CATCCAGGGCTGGGCCTTGAAGG + Intergenic
1001910566 5:175513982-175514004 CACAGACGGCAGAGCGTGGATGG + Intronic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1004311540 6:14550246-14550268 CATCTACAGTAGAACCTTGATGG + Intergenic
1015325538 6:131919087-131919109 CATTGAAGACAGAGCCTTGGTGG + Intergenic
1018863523 6:167730629-167730651 CATCCAGGGCACAGCCTTGCAGG - Intergenic
1028850751 7:95534597-95534619 CATCGAGGGCAGAGAGTGGAGGG - Intronic
1029456748 7:100675575-100675597 CATCCACGGCAGAGACCTGTAGG - Intronic
1043656577 8:82674672-82674694 CATTGAAGACAGAGCCTTGGCGG + Intergenic
1046701218 8:117403200-117403222 CATCTTCAGCAGAGCCTTCATGG - Intergenic
1050577441 9:7011905-7011927 CATGGAAGGCAGAGCAGTGAAGG - Intronic
1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG + Intronic
1057865277 9:98675271-98675293 CATGGATGGAAGAGGCTTGAAGG + Intronic
1059234596 9:112751015-112751037 CGTGGACGGCAGGGCCTTGGGGG - Exonic
1062053675 9:134459783-134459805 CACACAGGGCAGAGCCTTGAGGG - Intergenic
1062212472 9:135372423-135372445 CAGGGACGACAGAGCCTTGGAGG + Intergenic
1203544293 Un_KI270743v1:117662-117684 CATTGAAGACAGAGCCTTGGTGG - Intergenic
1191823645 X:65340003-65340025 CATTGCAGTCAGAGCCTTGATGG + Intergenic
1193265607 X:79464574-79464596 CATCGAAGCCTGAGCCTAGAGGG - Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1199343032 X:146704573-146704595 CAGCCACGGCAGAGTCTTTATGG + Intergenic