ID: 905028932

View in Genome Browser
Species Human (GRCh38)
Location 1:34868765-34868787
Sequence TATCCAGGAGTCACGGCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905028927_905028932 9 Left 905028927 1:34868733-34868755 CCTGAGTCGGGGAGGCTACGTGA 0: 1
1: 0
2: 0
3: 0
4: 40
Right 905028932 1:34868765-34868787 TATCCAGGAGTCACGGCGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905028932 Original CRISPR TATCCAGGAGTCACGGCGGC CGG Exonic
902433038 1:16378431-16378453 TAGCCAGGTGTCACGGTGGCAGG - Intronic
905028932 1:34868765-34868787 TATCCAGGAGTCACGGCGGCCGG + Exonic
917514159 1:175693212-175693234 TCTCCAGGAGTCTCTGAGGCTGG + Intronic
917600265 1:176566626-176566648 TATTCAGGAGTGACAGAGGCAGG + Intronic
924775505 1:247112449-247112471 TGTCCAGGACTCAGGCCGGCGGG - Intergenic
1063910468 10:10824545-10824567 TATCCAAGAGCCATGGGGGCAGG - Intergenic
1075348342 10:121701402-121701424 TATCCAGGAGTCATGGCAAATGG - Intergenic
1083477880 11:62925792-62925814 TCTCCAGGAGTCCTGGCGGGAGG - Intergenic
1083540625 11:63509434-63509456 TCTCCAGGAGACAGGGCAGCTGG + Intronic
1083888076 11:65582330-65582352 TATCCAGGGGTCTGGGAGGCTGG + Exonic
1095859612 12:46902047-46902069 CATCCAGGAGACAGGGCGGGAGG - Intergenic
1104755047 12:131264086-131264108 TTTCCAGAAGTCATGGGGGCTGG - Intergenic
1104903332 12:132200954-132200976 TGTGCAGGAGTCAGGGCGGAAGG + Intronic
1105502427 13:20984077-20984099 TAGCCAGGTGTCATGGTGGCGGG - Intronic
1119940555 14:78636571-78636593 TCTCGTGGAGTCACGGGGGCAGG + Intronic
1121797299 14:96745824-96745846 TATCCATGAGTCACAGGGCCAGG + Intergenic
1133848750 16:9481796-9481818 TGTCCAGGAGGCAAGGTGGCTGG + Intergenic
1141484251 16:84328358-84328380 TATCCAGCATTCACAGGGGCTGG - Intronic
1142750848 17:1986765-1986787 TAGCCAGGAGTCACAGAGCCAGG + Intronic
1146024771 17:29310305-29310327 TAGACATGAGCCACGGCGGCTGG - Intergenic
1148755757 17:49972196-49972218 TCTCCAGGAATCTCGGCCGCGGG - Intronic
1151919464 17:77142295-77142317 TAGTCATGAGTCACGGCGCCTGG - Intronic
1158204237 18:54973779-54973801 TAGCCAGGAGTCAGGGTGGAGGG - Intergenic
1162721641 19:12666326-12666348 CATCCCGGAGACACGGAGGCAGG + Intronic
1162820166 19:13218234-13218256 TATCCAGGCGTGGCGGCGGGCGG - Intronic
1170356172 20:15494305-15494327 TATCCAGGAGGAAGGGCTGCTGG - Intronic
1172793557 20:37522504-37522526 TGTCCACGAGTCAGGGCAGCTGG - Intronic
1174078261 20:47953122-47953144 TATCCATCAGTCACGACTGCTGG + Intergenic
1180998523 22:19977260-19977282 AAGCCAGGAGTCAAGGAGGCTGG - Intronic
1182010942 22:27000134-27000156 TAGCCAGGAGTGGCGGTGGCGGG - Intergenic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184288117 22:43483404-43483426 CACCCAGGATTCAAGGCGGCCGG + Intronic
1184415768 22:44350947-44350969 TGTCCAGGAGTCACGGGGGGTGG + Intergenic
949480840 3:4493013-4493035 AATCCAGGTGTCACTGGGGCCGG - Intergenic
960702535 3:120451469-120451491 CATCCCGGGGTCACGGCAGCAGG + Intergenic
961491801 3:127261512-127261534 TCTCCAGGAGTCACCACGACAGG - Intergenic
969692084 4:8709338-8709360 AATCCAGGAGACACCGAGGCTGG + Intergenic
984767622 4:183411600-183411622 TTTACAAGAGTCACGGAGGCTGG - Intergenic
1008109587 6:47477988-47478010 TCCCCAGGAGCCACGGCGGCGGG - Exonic
1009707784 6:67277007-67277029 TAGGCAGGAGTCACGGCGCCCGG - Intergenic
1016576071 6:145571154-145571176 TAGCCAGGATTCACGGGGCCAGG - Intronic
1018929420 6:168230789-168230811 TGTCCAGGAGTCAGGACTGCAGG + Intergenic
1019410557 7:904833-904855 TTTCCAGGAGCCTGGGCGGCCGG - Intronic
1021328543 7:19305308-19305330 TAGCCAGGCGTCATGGTGGCCGG - Intergenic
1031163455 7:118197288-118197310 AATCCAGGAGTCAGGGTGGGTGG + Intergenic
1044486969 8:92765749-92765771 TAGCCAGGACTCACGGCTCCAGG - Intergenic
1061546881 9:131309595-131309617 TAGCCAGGAGTCGGGGCGGAGGG - Intergenic
1189192472 X:39122431-39122453 TAGCCAGGTGTAACGGAGGCTGG - Intergenic
1199036112 X:143052905-143052927 TATCCAGGAGTCACGGAGTAGGG + Intergenic