ID: 905032690

View in Genome Browser
Species Human (GRCh38)
Location 1:34898290-34898312
Sequence CTGAGGATAAGCAGCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905032684_905032690 10 Left 905032684 1:34898257-34898279 CCTGGGGAGTTATAGAGGCACCC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 281
905032682_905032690 23 Left 905032682 1:34898244-34898266 CCAGTGTTTAGATCCTGGGGAGT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 281
905032686_905032690 -10 Left 905032686 1:34898277-34898299 CCCAAGACACAGACTGAGGATAA 0: 1
1: 0
2: 1
3: 27
4: 231
Right 905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905032690 Original CRISPR CTGAGGATAAGCAGCCAGGG AGG Intronic
900429154 1:2593751-2593773 CCGCGGAGAAGCAGCCAGGAAGG - Intronic
900575832 1:3382090-3382112 CTGCGCATCAGCAGTCAGGGTGG + Intronic
901255739 1:7824971-7824993 CCGAGGATAAGAAACAAGGGAGG - Intronic
901475846 1:9488715-9488737 CTGAGAAGGAGCAGTCAGGGAGG + Intergenic
902329538 1:15724575-15724597 CTGGGGAGAAGCAGCCTGGGGGG + Intronic
902505561 1:16937506-16937528 CTGAGGTCACACAGCCAGGGAGG + Intronic
903249587 1:22043134-22043156 CCGAGGAACAGCAACCAGGGCGG + Intergenic
903911703 1:26731522-26731544 CTGAGGATACGCAGCCTGCTGGG - Exonic
904997156 1:34640002-34640024 TTGGGGATAATTAGCCAGGGAGG - Intergenic
905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG + Intronic
905235547 1:36543669-36543691 CTGAGAAGGGGCAGCCAGGGAGG - Intergenic
905793521 1:40802619-40802641 CTGAGGAGAAGGAGCCCGGGCGG + Intronic
906036908 1:42756329-42756351 CTGAGGATAAGCAGCTAAAGGGG + Intronic
906535787 1:46550342-46550364 CTGAGGACAAGCACCCAGTCCGG - Intronic
906684146 1:47752189-47752211 CGGTGGATGACCAGCCAGGGAGG + Intergenic
906832404 1:49047105-49047127 CTGAAGCTAAGTGGCCAGGGTGG + Intronic
907221215 1:52908041-52908063 CTGAGGACAGGCAGCCAGCGAGG + Intronic
907386011 1:54125717-54125739 CTGCGGAGCGGCAGCCAGGGAGG + Intergenic
908249461 1:62253739-62253761 CTGAGGATACCCAGCAAGGGAGG + Intronic
908634872 1:66152395-66152417 ATGAAGATGAGCAGGCAGGGTGG + Intronic
909114114 1:71513310-71513332 ATGAGGAAAAGCACACAGGGTGG + Intronic
910184096 1:84517224-84517246 CTGAGAATGAACAACCAGGGAGG - Intergenic
910375054 1:86559325-86559347 CTTAGGAGAAGCAGCTAGGTTGG - Intronic
911580126 1:99624654-99624676 GTGAGGATCAGCACCCAGTGGGG - Intergenic
912108255 1:106307241-106307263 CTGAGGATAGGCACCTAAGGTGG - Intergenic
913488409 1:119355400-119355422 CTGAGAAAGAGCAGCCAGTGAGG + Intergenic
914830853 1:151169872-151169894 CTGGGGATCAGCAGGCAGGGAGG - Exonic
915357510 1:155264346-155264368 CTAAGGATCAGCTGCCAGGAAGG + Intronic
915581595 1:156816249-156816271 ATGAGGTTAAGTAGCCAAGGCGG + Intronic
915735513 1:158082147-158082169 CAGAGGATAATTAGCCAGGCAGG + Intronic
916682589 1:167117756-167117778 CAAAGGATAAGCAGTCATGGCGG - Intronic
917222881 1:172749902-172749924 CTGAGGAGCTCCAGCCAGGGAGG + Intergenic
917503341 1:175605836-175605858 GTGAGGACAACCAGGCAGGGAGG - Intronic
919640084 1:200038714-200038736 CGAAGGAGAAGCAGCCAGAGCGG - Intronic
920274298 1:204792601-204792623 CTGAGGTCATGCAGCCAGTGTGG - Intergenic
920800688 1:209184550-209184572 CAGAGGAAAAGAAGCAAGGGTGG + Intergenic
921900856 1:220449146-220449168 CTGAGAGTAAGCAGCCAGTCTGG - Intergenic
922156067 1:223040540-223040562 ATGAGGATAAGAAGCCAGCCAGG + Intergenic
922564126 1:226590174-226590196 CTGAGGAGAAGCTGCCGGGAGGG - Intronic
923188425 1:231596497-231596519 GTGGGGAAAAGCAGCCTGGGGGG + Intronic
923500469 1:234559870-234559892 CTGAGGAAATGCTGCCAGTGTGG + Intergenic
1062805076 10:413195-413217 CTGTGGATAAGAGGCCATGGAGG - Intronic
1063909252 10:10812668-10812690 CTGAGGGTGGACAGCCAGGGAGG - Intergenic
1064465633 10:15577772-15577794 CCTAGGATAAACAGCCAGTGTGG + Intronic
1064691881 10:17926962-17926984 CCTGGGAGAAGCAGCCAGGGAGG + Intergenic
1066802628 10:39207775-39207797 CTCAGGGAAAGCAGCCAGGTGGG - Intergenic
1067175054 10:43939821-43939843 CTGAACAAAAGCAGCCAAGGGGG + Intergenic
1068237136 10:54251967-54251989 CTGAAGATAAAAAGGCAGGGGGG - Intronic
1070729298 10:78814202-78814224 GCGAGGATGAGGAGCCAGGGAGG - Intergenic
1070812842 10:79306897-79306919 CAGAGGATCAGCAGACTGGGAGG - Intronic
1070978147 10:80622139-80622161 CTGATGATAATAAGCCATGGGGG - Intronic
1072555304 10:96510166-96510188 GTGAGGATAGGCAGGCAGGCAGG + Intronic
1073134133 10:101210518-101210540 CTGATCATAAGCAGACAGTGAGG - Intergenic
1073610096 10:104934691-104934713 CTGAGCATAAGGAGGCAGGCTGG - Intronic
1075794125 10:125106809-125106831 ATGAGAACCAGCAGCCAGGGTGG + Intronic
1076770262 10:132659059-132659081 CTGGGGATGAGCAGCCCAGGAGG + Intronic
1077560909 11:3260026-3260048 CCGAGGACCAGCAGCAAGGGTGG + Intergenic
1077566806 11:3305856-3305878 CCGAGGACCAGCAGCAAGGGTGG + Intergenic
1078349812 11:10583337-10583359 CTGAGAAGTAGCAGCCAGAGAGG + Intronic
1078434737 11:11314952-11314974 ATGAGGATAAGCTGGCAAGGTGG + Intronic
1083661505 11:64253635-64253657 CTCAGGACCAGCAGCCAGAGGGG - Intronic
1084230412 11:67748433-67748455 CTTAAGATAAGCAGAGAGGGTGG + Intergenic
1084502743 11:69544521-69544543 AGGAGGAGAAGCAGGCAGGGCGG + Intergenic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1087078178 11:94144736-94144758 CTGAGGATGAATGGCCAGGGAGG - Intronic
1087110149 11:94457129-94457151 CTGAAAATATGCAGCCAGTGAGG + Intronic
1088921879 11:114265365-114265387 CTGAGAAGCAGCAGCCAGTGAGG - Intronic
1090247494 11:125226888-125226910 CAGAGGAGAGGCTGCCAGGGAGG - Intronic
1091986069 12:4910906-4910928 CCGAGGAGAAGCAGAGAGGGTGG + Exonic
1092905631 12:13098333-13098355 CTGTAGATTAGCAGGCAGGGAGG - Intronic
1093542127 12:20299480-20299502 CTGACTAGAAGCAGCCAGGAGGG - Intergenic
1094342849 12:29432073-29432095 CTGAGGAACAGCAGCAAGGTTGG + Intronic
1094777395 12:33746155-33746177 ATGAGTGAAAGCAGCCAGGGGGG + Intergenic
1095635609 12:44429632-44429654 CTGAGGATAAGTGGCCAGTGAGG + Intergenic
1097040513 12:56153496-56153518 GTGAGGGGTAGCAGCCAGGGAGG - Intronic
1100001284 12:89838969-89838991 CTGAGAATAAGGAGTCAAGGAGG + Intergenic
1100647142 12:96543469-96543491 CTGGGGGTAAGAAGCCAGGAGGG + Intronic
1101207601 12:102504430-102504452 CTCAGGATCAGCACCCGGGGAGG + Intergenic
1101509567 12:105380526-105380548 CTGAGGACGAGCAGACAGAGAGG - Intronic
1103862293 12:124024927-124024949 CTGAGGACATGCTCCCAGGGGGG + Intronic
1104515605 12:129423310-129423332 CTAAGGAAAATCAGCCAAGGTGG + Intronic
1106602723 13:31200744-31200766 CTGAGGATAAGCGGCCAGCTCGG + Intronic
1106714015 13:32369139-32369161 CTGAGCAGACGCAGCCAGGGTGG - Intronic
1106951507 13:34889838-34889860 TTCAGGAGAAGCAGCCAGGTGGG + Intergenic
1107254542 13:38407996-38408018 CCCAGGATCAGCAGCCACGGTGG - Intergenic
1107437103 13:40389813-40389835 CTAAGGATCACCAGCCTGGGTGG + Intergenic
1113377998 13:109782488-109782510 CTCAGGAAAAGCAGCGAGGGCGG - Exonic
1113680492 13:112240325-112240347 CTGAAGACAAGCAGGCTGGGGGG - Intergenic
1114617734 14:24077131-24077153 CTGAGGGCAAGCAGAGAGGGTGG - Intronic
1117665549 14:58052588-58052610 CTGAGAAGGAGCAGCCAGAGAGG - Intronic
1119770265 14:77216268-77216290 CTGAGAAGTAGCAGCCAGTGAGG - Intronic
1120859887 14:89245795-89245817 CTGAGGACACGCAGCCGGAGAGG + Intronic
1121086829 14:91153106-91153128 CTGAGAAAAGGCGGCCAGGGAGG - Intronic
1121086939 14:91153856-91153878 CTGAGGACATGCACCCAAGGTGG + Intronic
1122391852 14:101394809-101394831 GTGAGCATAAGCAGCCCAGGAGG + Intergenic
1122989244 14:105229248-105229270 CTGAGGATGCGGAGCCAGGCTGG + Intronic
1125039048 15:35161917-35161939 CTGAGGAGAAGCAGTCTGGAAGG - Intergenic
1125437589 15:39664047-39664069 CGCAGCATAACCAGCCAGGGTGG + Intronic
1125793753 15:42389359-42389381 CTGAGGAGCACCAGCAAGGGAGG - Intronic
1128113801 15:65093232-65093254 CTGAGGAAGAGGAGACAGGGAGG + Intronic
1128810303 15:70566552-70566574 CTGAGGATTTACAGCCAGGCTGG - Intergenic
1129163161 15:73758906-73758928 CTGAGAAGCAGCAGCCAGAGAGG - Intergenic
1131931795 15:97450619-97450641 CTGAGGATAAGAAGACATGGAGG + Intergenic
1132152997 15:99475536-99475558 CTGAAGAGGTGCAGCCAGGGAGG - Intergenic
1132490854 16:229924-229946 GGGAGGATAAGGAGCCGGGGAGG - Intergenic
1132721950 16:1320887-1320909 ATGGGGACAAGCAGCAAGGGCGG - Intronic
1134076077 16:11292460-11292482 CTGAGGAGGAGCAGCTAGGAAGG + Intronic
1134880787 16:17743802-17743824 ATGAGGAGAAGCAGACAGGGAGG + Intergenic
1135137892 16:19898297-19898319 CTCGGGATCAGCATCCAGGGTGG + Intergenic
1137556536 16:49473865-49473887 CTGAGGATAAGCCACCAGGGAGG - Intergenic
1138147178 16:54623102-54623124 CTGAGGATTAGCAGGCAGAAGGG + Intergenic
1138652836 16:58471614-58471636 CTGAGGATTAAGAGGCAGGGAGG - Intronic
1141857813 16:86696221-86696243 CTGAGGAGACGGAGCCACGGAGG + Intergenic
1142281519 16:89150655-89150677 CTGAGGAGAAGCCGCCTGTGAGG + Intronic
1143116099 17:4582615-4582637 CTGAGAAAAAGGAGCCAAGGGGG + Intergenic
1143282906 17:5767950-5767972 CTGAGGTTTAGCAGACAGGTGGG - Intergenic
1143513357 17:7407643-7407665 CTGAGGAGAACCTGCCTGGGAGG + Intronic
1143963835 17:10741946-10741968 CTGAGGAAGAGTAGCCCGGGAGG - Intergenic
1144488976 17:15691500-15691522 CTAACCATAAGCAGCCAGAGGGG + Intergenic
1144556427 17:16286519-16286541 TTGAGGATATTCAGCCAGTGGGG + Intronic
1144912047 17:18690804-18690826 CTAACCATAAGCAGCCAGAGGGG - Intergenic
1145721583 17:27078155-27078177 CTGAGAACAAGTGGCCAGGGAGG - Intergenic
1146241497 17:31232552-31232574 CTCGCGATAATCAGCCAGGGTGG - Intronic
1147384456 17:40073079-40073101 GAGCTGATAAGCAGCCAGGGTGG - Intronic
1147587533 17:41660927-41660949 GTGTGGACATGCAGCCAGGGAGG + Intergenic
1150438081 17:65169504-65169526 GTGAGGATAAGGAGACATGGCGG + Intronic
1151166729 17:72210016-72210038 CAGAGGGGAAGCAGCCAGGGGGG + Intergenic
1151245330 17:72790102-72790124 CTGAGGATAACAAGCCGGGTGGG + Intronic
1151398729 17:73842089-73842111 TTCAGGATAAACAGGCAGGGAGG + Intergenic
1151536811 17:74743623-74743645 CTGTGGATAATTATCCAGGGTGG - Intronic
1153759594 18:8317631-8317653 TTGAGAACAAGCGGCCAGGGAGG + Intronic
1155596806 18:27497395-27497417 CTGAGAAGAAGCAGCCAATGAGG + Intergenic
1156700859 18:39822840-39822862 CTGAGCAAAAGCAGCCAGAAGGG - Intergenic
1156882231 18:42094393-42094415 CTGAGAAAGAGCAGCCATGGAGG - Intergenic
1157224018 18:45846604-45846626 ATGAGGAAAAGCCCCCAGGGAGG + Intergenic
1158070957 18:53470017-53470039 CTGAGGAGGAGCAGCCAGAAGGG - Intronic
1158162997 18:54507295-54507317 CTGAGGATGCCGAGCCAGGGAGG + Intergenic
1158498085 18:57974592-57974614 CTGAGGATTTCCAGCCATGGAGG + Intergenic
1158797125 18:60860152-60860174 CTGAGATGAAGCATCCAGGGAGG + Intergenic
1159915220 18:74182463-74182485 CTGAGGCTCAGCAGCCCAGGAGG - Intergenic
1160515650 18:79478074-79478096 CTGGGGATGGGCAGGCAGGGGGG - Intronic
1160846599 19:1168787-1168809 CTGGGGAGGGGCAGCCAGGGAGG - Intronic
1160895560 19:1400451-1400473 GAGAGGATGACCAGCCAGGGAGG + Intronic
1161615024 19:5265295-5265317 CTGAGGTCACGCAGCCAGGGAGG - Intronic
1161980327 19:7626882-7626904 GTGGGGAGAAGCAGGCAGGGTGG - Intronic
1162123201 19:8485094-8485116 CTGAGGAAATGCAGCCAGAGTGG + Intronic
1167202719 19:48077602-48077624 CTGAGGCCACGCAGCCAGGAGGG - Intronic
1167457028 19:49601707-49601729 CTCAGGAGGAGCAGCCAGTGGGG - Exonic
1168445197 19:56405619-56405641 CAGAGGACAAGCAGCCAGCGTGG - Intronic
925413541 2:3654079-3654101 CAGAGGATCAGCTGCCAAGGTGG + Intergenic
925930669 2:8705349-8705371 CTGAGCATAAGCAGCTAGACAGG - Intergenic
926360873 2:12085391-12085413 CTGAGAACTAGCAACCAGGGTGG + Intergenic
926934596 2:18074267-18074289 CTGAGGATGAGGGGACAGGGAGG - Intronic
927464985 2:23330039-23330061 CAGAGAATAGGCAGGCAGGGTGG - Intergenic
927518342 2:23685019-23685041 CTGGGGAAAAGCAGCCCCGGGGG - Intronic
927899900 2:26811767-26811789 CTCCTGAGAAGCAGCCAGGGAGG + Intergenic
932575439 2:72960062-72960084 CCAAAGACAAGCAGCCAGGGTGG - Intronic
933699570 2:85244886-85244908 CTGAGAAGGAGCAGCCAGAGAGG + Intronic
935812515 2:106812629-106812651 CTGAGGATAAGCAGTCAAGCTGG + Intronic
936886178 2:117311778-117311800 CTGAGAATATGCACCCAAGGTGG - Intergenic
937447494 2:121971218-121971240 CTGAGGGTGAGTAGCCAGGAGGG - Intergenic
938239808 2:129734738-129734760 CTGAGGCTAAGCAGCCAGAGAGG + Intergenic
938337310 2:130511363-130511385 CTGAGGAGCAGCAGGGAGGGAGG - Intergenic
938352528 2:130609372-130609394 CTGAGGAGCAGCAGGGAGGGAGG + Intergenic
939090973 2:137780023-137780045 CTGTGGATAGGCACCCAGGAGGG - Intergenic
939685551 2:145194728-145194750 CTGGGGGTAAGCAGCTAAGGTGG + Intergenic
940305203 2:152218055-152218077 ATGAGGAGAAGCAGCCAGAGGGG + Intergenic
940965160 2:159828991-159829013 CTGAGGACTAGGAGACAGGGAGG + Intronic
942749860 2:179275481-179275503 CTGAGGAGAAACAGCCAGTGAGG + Intergenic
945868778 2:215204688-215204710 CTGATGACATGCAGCCAAGGCGG - Intergenic
946596354 2:221309895-221309917 CTGAGCATAAGCGTCCCGGGGGG - Intergenic
947626527 2:231622632-231622654 CTGAGGACAAGCAGAGAGAGTGG - Intergenic
947875753 2:233467371-233467393 CAGAGGGGAAGCAGGCAGGGTGG - Intronic
948118657 2:235512739-235512761 CTGAGCAGAGGCAGGCAGGGTGG - Intronic
1168787486 20:552428-552450 CTGAGAAGGAGCAGCCAGTGGGG + Intergenic
1169069317 20:2713134-2713156 CTGACGAGAAACAGCCAGGAGGG + Intronic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1170033823 20:11969655-11969677 CTGAGGTCAAGCAGCAAGGTGGG - Intergenic
1170042884 20:12056996-12057018 CTCTGGCTAAGCTGCCAGGGAGG - Intergenic
1170385523 20:15811974-15811996 CTGAGGACAGGTAGCCAGGAAGG + Intronic
1170849780 20:19994279-19994301 CTGAAGCTATGCAGCCTGGGAGG + Intronic
1172111469 20:32547842-32547864 GGGAGGAGAAGCAGCCAGGGAGG - Intronic
1172895771 20:38299031-38299053 CTGAGCAAAAGAAGCCAGAGAGG + Intronic
1173769675 20:45646328-45646350 CAGATGATAGGCAGCCAGGCAGG + Intergenic
1173859388 20:46272564-46272586 CTGAGAAGAAGCTGCCAGTGAGG + Intronic
1174550280 20:51357065-51357087 CAGAGCCTGAGCAGCCAGGGAGG + Intergenic
1176078349 20:63259398-63259420 CCGAGAATAAGAAGACAGGGTGG - Intronic
1178429249 21:32504603-32504625 CTTAAGATAAGCAGAGAGGGTGG - Intronic
1179200846 21:39219131-39219153 ATAAGGAGAAGCAGGCAGGGTGG + Intronic
1180124388 21:45779024-45779046 CTGAGGATAAGAACCAAGTGAGG - Intronic
1180183455 21:46128179-46128201 CACAGGGAAAGCAGCCAGGGAGG + Intronic
1182686380 22:32123659-32123681 CCCAGGAAATGCAGCCAGGGTGG + Intergenic
1183373207 22:37447439-37447461 CAGAGGCTAGGCAGCTAGGGAGG + Intergenic
1183540858 22:38428532-38428554 CTGAGCATAGGGAGCCACGGAGG + Intronic
1183991553 22:41600377-41600399 CTGAGGAAAGGCAGCCTCGGGGG + Exonic
1184241710 22:43214455-43214477 CTGAGGTGCAGCAGCCAGAGGGG - Intronic
949445637 3:4131317-4131339 CTGGGGAAGAGCAGGCAGGGTGG - Intronic
954371536 3:50171698-50171720 CTGTGGGTGAGCAGCCAGGCGGG + Intronic
954705811 3:52479976-52479998 CCGAGGTCATGCAGCCAGGGAGG - Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955769177 3:62372242-62372264 CTTGGGGTGAGCAGCCAGGGCGG + Exonic
955786946 3:62550927-62550949 CTAAGGAGCAGCAGCCAGGATGG - Intronic
956733240 3:72215990-72216012 CTGAGGAGGAGTGGCCAGGGAGG - Intergenic
957544773 3:81623294-81623316 CTGAGAATAAGCAAACAGTGAGG - Intronic
961879051 3:130047531-130047553 CTTAAGATAAGCAGAGAGGGGGG + Intergenic
962438881 3:135393716-135393738 CTGAGGAGAAGCAGCCTTGATGG + Intergenic
965913786 3:173815587-173815609 CTGAGACGAAGCAGTCAGGGAGG - Intronic
968812222 4:2805211-2805233 CGGAGGGTCAGCAGCCAGGCTGG + Intronic
969579755 4:8057886-8057908 CTCAGGATGACCAGGCAGGGTGG + Intronic
969624256 4:8294360-8294382 CTGAGGATAAGCTGTCCTGGGGG - Intronic
969694011 4:8724774-8724796 CTGAGAATACCCATCCAGGGAGG - Intergenic
971945113 4:33265423-33265445 CTTAGGATACAAAGCCAGGGAGG + Intergenic
972121494 4:35709950-35709972 CAAAGGATATTCAGCCAGGGTGG + Intergenic
974061176 4:57037569-57037591 CTGAGGACAAGCACTCAGGGAGG + Intronic
974123982 4:57673190-57673212 CTGAGGATTAACAGCCAGCTGGG + Intergenic
981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG + Intronic
984693423 4:182754791-182754813 ATCTGGAGAAGCAGCCAGGGAGG - Exonic
986169406 5:5303537-5303559 GTCAGGATAAGCACCCAGTGAGG - Intronic
986919674 5:12666583-12666605 CTGGCGAGAAGCAGCCTGGGAGG + Intergenic
987123950 5:14793588-14793610 CAAAGGACAAGCAGCCAGGCCGG + Intronic
988228794 5:28448388-28448410 CTGAGGAAGAGAAGGCAGGGTGG - Intergenic
989509777 5:42272093-42272115 CTGAGGATATGCAGCTAGTAAGG + Intergenic
990336191 5:54774998-54775020 TTGGGAAGAAGCAGCCAGGGTGG - Intergenic
990977683 5:61573661-61573683 CCAAGGACAAGCAGCCATGGTGG + Intergenic
990999790 5:61771266-61771288 CTTAGGACAAGCAGGCGGGGAGG - Intergenic
991253177 5:64586149-64586171 CTGAGGATAACCTGCCAAAGGGG + Intronic
991946172 5:71900405-71900427 CTGGGGAAAAGAAGGCAGGGTGG - Intergenic
992150228 5:73895295-73895317 CAGAGGATGAGAGGCCAGGGTGG + Intronic
992794567 5:80244135-80244157 CTGAGGAACTGAAGCCAGGGAGG - Intronic
993543104 5:89176682-89176704 ATGAAGAAAAGCAGCCAGAGAGG - Intergenic
993900341 5:93580345-93580367 CAGAGTCTAGGCAGCCAGGGCGG - Intergenic
997222376 5:132180220-132180242 CTGATGAAAAGGAGCCAGGGAGG + Intergenic
997902014 5:137775451-137775473 GTGAGAAAAAGCAGCCAGTGAGG + Intergenic
998661038 5:144237977-144237999 CTGATGCTAAGCAACCAGAGTGG - Intronic
999647782 5:153736151-153736173 CTGAGAAGGAGCAGCCAGTGAGG + Intronic
1001704301 5:173730719-173730741 CAAAGGATAAGAAGCCAGTGAGG - Intergenic
1001858209 5:175031121-175031143 CCGAGAAGGAGCAGCCAGGGAGG + Intergenic
1003934488 6:10961130-10961152 TTGGGGATGAGCAGGCAGGGAGG + Intronic
1006056397 6:31387971-31387993 CTGAGGAGGAGCAGCCAGTTGGG - Intergenic
1006866067 6:37209951-37209973 CTGAGGAGAAGGGGCCAGTGCGG + Intergenic
1006873749 6:37277376-37277398 CAAAGGAGAAGCAGCCATGGTGG + Intronic
1007710657 6:43821931-43821953 CTAAGGAGGAGCATCCAGGGAGG + Intergenic
1007743214 6:44025321-44025343 TTGTGGATACGCAGCCTGGGAGG + Intergenic
1008147732 6:47911953-47911975 CTGAGAAGCAGCATCCAGGGAGG + Intronic
1008758560 6:54826741-54826763 CTGAGAAGCAGCAGCCAGTGAGG + Intergenic
1010938883 6:81892427-81892449 TTGAAGAGAAGCAGGCAGGGTGG - Intergenic
1011356070 6:86474315-86474337 CTCAGGGTGAGCAGCCAGGCGGG + Intergenic
1012914670 6:105156677-105156699 CTGAGGAAGAGCAGCCAATGAGG - Intergenic
1012930422 6:105310610-105310632 CTGAGAAGCAGCAGCCAGGGAGG - Intronic
1014204605 6:118644272-118644294 CTGAGAAGGAGCAGCCAGGGTGG - Intronic
1018777407 6:167030524-167030546 CTGATCATAAGCAGTCAGGAGGG - Intronic
1019215169 6:170438774-170438796 CTGGGGATCAGCAGGCTGGGGGG + Intergenic
1019526928 7:1484723-1484745 CTGAGGATGCGAAGCCACGGGGG - Intronic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1021081193 7:16367325-16367347 CTAAGCAAAAACAGCCAGGGAGG + Intronic
1021381166 7:19968153-19968175 CTGAGAAGGAGCAGCCAGTGAGG - Intergenic
1024359580 7:48454613-48454635 CTGAGGAAAAGCAGGCCGTGGGG + Intronic
1026664963 7:72334359-72334381 TTGAGGGTCACCAGCCAGGGTGG - Intronic
1027689490 7:81325051-81325073 CAGAGGATCAGGAGCCAGGGGGG - Intergenic
1028642549 7:93059217-93059239 CTAAGGATGAGCAGCCAGTGAGG + Intergenic
1028940871 7:96520916-96520938 CTCAGGACAATCAGCCATGGAGG - Intronic
1029491280 7:100871617-100871639 CGCAGGTGAAGCAGCCAGGGTGG - Exonic
1030300235 7:107967139-107967161 CTGAGGATAAGAAGTCAGTGTGG - Intronic
1030692546 7:112551111-112551133 GTGAGGAGAATCAGGCAGGGAGG - Intergenic
1030769329 7:113454800-113454822 CTGAGGAAAAGCAGTCAAAGAGG - Intergenic
1032153074 7:129446694-129446716 CTGGGGGAAAGAAGCCAGGGTGG + Intronic
1034286360 7:149885579-149885601 CTGAGGTTAGGGAGCCAAGGCGG - Intergenic
1034433517 7:151052322-151052344 CTGAGGAGAAACAGGCAGGAGGG + Intronic
1034817677 7:154187095-154187117 CTAATGATCTGCAGCCAGGGTGG + Intronic
1035269604 7:157711668-157711690 CTGAGGACAAGCCCCCGGGGTGG + Intronic
1036406015 8:8455833-8455855 CTGAGGACAGGCACCCAGGGTGG - Intergenic
1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG + Intergenic
1039395491 8:37222149-37222171 CTGAGGTTAAGGTCCCAGGGAGG - Intergenic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1041165752 8:55090780-55090802 CTGAGGATGGGCAGCCTGGTGGG - Intergenic
1045716741 8:105055923-105055945 CTGAGGATCATGAGCCTGGGAGG - Intronic
1045817391 8:106292742-106292764 TAGAGGATAAGAAGACAGGGAGG + Intronic
1047024468 8:120811455-120811477 CTGGGGATCAGCATCAAGGGGGG - Exonic
1047492007 8:125382819-125382841 CTGTTGATAAGCAGAAAGGGTGG + Intergenic
1048134011 8:131728373-131728395 CTGTGGTCAAGCAGCAAGGGAGG + Intergenic
1048325936 8:133438947-133438969 CAGAGTATAAGAAGCCAGGTAGG - Intergenic
1048327569 8:133451089-133451111 GTTAGAAGAAGCAGCCAGGGAGG - Intergenic
1049254910 8:141608639-141608661 CTGAGGATGAGCTCCCAGGTTGG + Intergenic
1049661112 8:143820126-143820148 CAGAGGCCACGCAGCCAGGGCGG - Intronic
1050747393 9:8892173-8892195 CTGAGGAAAAGCAGCGTGGATGG - Intronic
1053011926 9:34638365-34638387 CTGAGGGTTATCAGCAAGGGAGG + Intronic
1053036650 9:34832281-34832303 CTGAGGGTTAGGAGCTAGGGTGG + Intergenic
1058522348 9:105823210-105823232 ATGGGGATTAACAGCCAGGGTGG - Intergenic
1058809685 9:108627379-108627401 CTGAGGAGAAGAAGCCAGAGTGG - Intergenic
1058903207 9:109459835-109459857 CTGAGAAGGACCAGCCAGGGAGG - Intronic
1060072587 9:120563262-120563284 CTGAGGAACAGCAGCCTGTGTGG + Intronic
1060250553 9:121983552-121983574 CTGAGAAGCAGCAGCCAGGGAGG + Intronic
1060658579 9:125389282-125389304 CTGAGGAGGAGCAGGTAGGGTGG - Intergenic
1061078813 9:128357747-128357769 CAAAGGGTGAGCAGCCAGGGAGG - Intronic
1061145306 9:128794239-128794261 CTGAGGAGCAGCACCCAGGGTGG - Intronic
1061412931 9:130430919-130430941 CAGAGGGAAAGCAGTCAGGGAGG + Intronic
1061884380 9:133584222-133584244 CTGAAGGTAAGCACTCAGGGAGG - Intronic
1061927663 9:133813946-133813968 CTGAGGTTAAACAGCCAGCAAGG + Intronic
1062044861 9:134420280-134420302 CTGAGGCTAAGAAGCCAGCCTGG + Intronic
1062122180 9:134839688-134839710 CGGAGGAGAGGCAGGCAGGGTGG + Intronic
1062158864 9:135068895-135068917 CTGGGGAGGAGCAGCCAGGGAGG + Intergenic
1062315589 9:135965545-135965567 CAGAGGAGGTGCAGCCAGGGCGG - Intergenic
1062367462 9:136218091-136218113 CTGAAGAGGACCAGCCAGGGAGG - Intronic
1062426966 9:136510550-136510572 CTGGCCATAAGCACCCAGGGAGG - Intronic
1062549679 9:137080295-137080317 CTGAGGGTAAGCAGCCCCTGAGG + Intronic
1062615662 9:137394656-137394678 CTGAGGATAAACAGCCCGAGGGG - Intronic
1062691423 9:137844019-137844041 CTGAGGAGGAGCAGTCTGGGAGG - Intronic
1185817320 X:3168365-3168387 CTGAGGACATGCATCCAAGGTGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1189660025 X:43286678-43286700 CTGACTAGAAGCAGCCAGTGGGG - Intergenic
1190461418 X:50680133-50680155 CTGAGGAGAAGTGGCCAGTGAGG - Intronic
1192534772 X:71917869-71917891 CTCAGAATAAGCCCCCAGGGTGG + Intergenic
1194179565 X:90695677-90695699 CTGAGGGAAAGAAGGCAGGGTGG + Intergenic
1195006756 X:100692742-100692764 CTGAGAAGCAGCAGCCAGTGAGG - Intronic
1195087376 X:101425120-101425142 CTGGGAAACAGCAGCCAGGGAGG + Intronic
1195219030 X:102729075-102729097 CTGAGGATCTGCAGTCAGGGAGG + Intronic
1195695909 X:107667273-107667295 GTGAGGAACAGCAGCCAGTGAGG - Intergenic
1198432265 X:136579268-136579290 TTGAGGAAAAGCAGCCAAGTGGG - Intergenic
1200326727 X:155248372-155248394 CTGAGAAGGAGCAGGCAGGGAGG - Intergenic