ID: 905033275

View in Genome Browser
Species Human (GRCh38)
Location 1:34901809-34901831
Sequence TCGATTATGAAGGACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905033275 Original CRISPR TCGATTATGAAGGACATGGA AGG Intronic
902202262 1:14842518-14842540 TCGATGATGTAGGACAACGAGGG - Intronic
904440734 1:30527874-30527896 TGGAAGATGAAGGACAGGGAGGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
909148924 1:71975413-71975435 TAGATTAGGAAGGACATGATAGG + Intronic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
914244197 1:145873512-145873534 TCCAGTATGAAGTCCATGGAAGG - Exonic
921431365 1:215069816-215069838 GGGATAATGAAGGTCATGGAGGG + Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
1065162664 10:22939109-22939131 TTGATTGTGAAAGACAAGGAAGG + Intronic
1075884568 10:125887127-125887149 TAGATTATGAATGATATCGATGG - Intronic
1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG + Exonic
1080265225 11:30393218-30393240 TCTATTAGGAAGGACACAGAGGG - Intronic
1080721592 11:34854519-34854541 ATTATTATGAAGGACATAGAGGG + Intronic
1083861140 11:65420850-65420872 TCGCTTTTGAAGGCCATGGTGGG - Intergenic
1089902039 11:121996589-121996611 TTGATTATGTAGTTCATGGAGGG - Intergenic
1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG + Intronic
1091239936 11:134045662-134045684 TAGATTATGTAGGACTTGGGGGG - Intergenic
1092297455 12:7211747-7211769 TGTATTATGAATTACATGGAAGG + Intronic
1094300101 12:28955010-28955032 TCAATTTTCAAGGTCATGGAAGG - Intergenic
1095736262 12:45559581-45559603 TGCATTATGAAGGAACTGGAGGG + Intergenic
1096067833 12:48755201-48755223 GAGACTATGAAGGACATGTAGGG - Intergenic
1099916904 12:88906231-88906253 TCTCTTATGAATTACATGGAAGG + Intergenic
1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG + Intronic
1119531856 14:75367330-75367352 TTGACTCTGAAGGACATGGTGGG + Intergenic
1122684249 14:103492399-103492421 ATGATTATGAAAGACATGCATGG - Intronic
1123206258 14:106716135-106716157 GAGAATATGAAGGATATGGATGG - Intergenic
1123211340 14:106763544-106763566 GAGAATATGAAGGATATGGATGG - Intergenic
1126409044 15:48353151-48353173 TGGAGTATAAAGGACATGTAGGG + Intergenic
1127816009 15:62609397-62609419 TTCATTATAAAGGACATGGCTGG - Intronic
1133468610 16:6052210-6052232 CCTACTATGAAGGAAATGGAAGG - Intronic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1138274337 16:55721361-55721383 TCTATTAAGAAGGACAAAGAAGG + Intergenic
1144537400 17:16104227-16104249 TGGATTATAAAGTACATGAATGG + Intronic
1149018796 17:51939210-51939232 TCTATTAGTATGGACATGGAGGG - Intronic
1159234452 18:65652817-65652839 TCAATTATGAAGGTGATGAACGG + Intergenic
1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG + Intronic
1167134347 19:47608409-47608431 TCGAGGATGAAGGAAATGGAGGG - Intronic
931297269 2:60939732-60939754 TTGACTATGAAGGACACTGATGG + Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
935319940 2:101876729-101876751 TGGATTATTAAGGAAATTGATGG + Intronic
935547769 2:104418892-104418914 TGGATTATGTAAGACATGAAAGG - Intergenic
938418727 2:131126057-131126079 TAGATTATGAACCACATGGTCGG + Intronic
941985860 2:171511059-171511081 TATATTATGAAGGACATAAAAGG + Intergenic
946137575 2:217660488-217660510 TGGATTCTGAAGGATTTGGAAGG - Intronic
1169070090 20:2721030-2721052 TTGATTATGATGTACATTGATGG + Intronic
1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG + Intergenic
1175972591 20:62694250-62694272 TTTATTATGAAGGACATTGCAGG + Intergenic
950062763 3:10085856-10085878 TCGGCTACTAAGGACATGGAGGG - Exonic
956665216 3:71636081-71636103 TCGTTTATGAATAAGATGGACGG + Intergenic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
957487864 3:80886321-80886343 TCTATCATGAAGGTCATGAAGGG + Intergenic
958693407 3:97497435-97497457 TAGTTTATGAAGGACCTGAAAGG - Intronic
970068872 4:12131272-12131294 TGCATTATGAAAGACATAGAAGG + Intergenic
971603685 4:28629837-28629859 TGGATTTTGGAGGACATTGAAGG - Intergenic
972046138 4:34666735-34666757 TTGATTATGGAGGCCATGGAGGG + Intergenic
972053185 4:34765774-34765796 TTAATTATAAAGGAAATGGAAGG - Intergenic
972144982 4:36012584-36012606 TACATTTTGAAGAACATGGATGG - Intronic
976586955 4:86809304-86809326 TCTATTAAGAAAAACATGGAAGG - Intronic
977539174 4:98294994-98295016 TAGATACTGAAGGACATGAAGGG + Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984719393 4:182955824-182955846 TGGTTTGTTAAGGACATGGAAGG + Intergenic
986571917 5:9174547-9174569 TGCATTCTGAAGGACATGGAAGG - Intronic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
987739491 5:21887688-21887710 TCATATATGAAGGACCTGGAGGG - Intronic
989676838 5:43982632-43982654 TGGATGATGAGGGACTTGGAAGG - Intergenic
993618531 5:90141371-90141393 GCGCTTAAGAAGGAAATGGAGGG - Intergenic
996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG + Intronic
997389864 5:133505543-133505565 TTGATTAAGAAGGACTTGTAAGG - Intronic
1000908152 5:166988729-166988751 TCCAGTGTGAGGGACATGGAGGG - Intergenic
1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG + Intergenic
1004319058 6:14618329-14618351 TGGATTATGGGGGACACGGATGG + Intergenic
1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG + Intergenic
1011933645 6:92745914-92745936 CAGAGTATGAAGGACATGCATGG - Intergenic
1012817978 6:104048594-104048616 TTGATTATGAAGGAGTTGGAGGG - Intergenic
1013922508 6:115424876-115424898 TCTATTAGGAAGGATTTGGAGGG + Intergenic
1017410590 6:154163414-154163436 TTAATTAGGAAGGACATGAAAGG - Intronic
1018143790 6:160864384-160864406 TAGATTAGGGAGGACATGGCGGG - Intergenic
1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG + Exonic
1020146842 7:5650939-5650961 TTAAATATGAAGGATATGGAAGG - Intronic
1021860217 7:24898549-24898571 TGGATTGTGAAGGCCATGGATGG - Intronic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG + Intronic
1033358113 7:140617301-140617323 TTGATATTGAAGGCCATGGAGGG - Intronic
1034857215 7:154563111-154563133 TAGCTATTGAAGGACATGGAAGG + Intronic
1036016686 8:4793157-4793179 TCCATGATCAAGGACATTGAAGG - Intronic
1037046787 8:14315443-14315465 AAGATTATGAAGCAAATGGAAGG + Intronic
1039758996 8:40553703-40553725 TAGATAATGAATGATATGGATGG + Intronic
1040679262 8:49789031-49789053 TGAATTATCAAGGACTTGGAAGG + Intergenic
1047637577 8:126781336-126781358 ATGAATATGAAGGACAAGGAGGG + Intergenic
1049017309 8:139929908-139929930 TCCATTTTACAGGACATGGAAGG - Intronic
1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG + Intronic
1052391494 9:27883478-27883500 TCTAATATGAAGGAGATGAATGG - Intergenic
1057879528 9:98782671-98782693 GCATTTAAGAAGGACATGGAAGG + Intronic
1058069965 9:100591910-100591932 TCTAATATGACAGACATGGAGGG - Intergenic
1062349173 9:136130803-136130825 TGAATTTTGAAGGACATGAAAGG - Intergenic
1188692278 X:33144839-33144861 TCTATGATGAAGGAAATGGTGGG - Intronic
1199935109 X:152565681-152565703 TGGGTTATGAAGAACATGTAAGG - Intergenic
1200300288 X:154967482-154967504 TTGATTATGAGGAACAGGGAAGG + Intronic
1200518189 Y:4175526-4175548 TAAATTGTGAAGAACATGGATGG - Intergenic
1202346394 Y:23932538-23932560 TTAATTAAGAAGGACAAGGATGG - Intergenic
1202524377 Y:25737552-25737574 TTAATTAAGAAGGACAAGGATGG + Intergenic