ID: 905034659

View in Genome Browser
Species Human (GRCh38)
Location 1:34909903-34909925
Sequence CAAGATAAGGACAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905034659_905034667 16 Left 905034659 1:34909903-34909925 CCAGCCTCCTTGTCCTTATCTTG 0: 1
1: 0
2: 4
3: 39
4: 408
Right 905034667 1:34909942-34909964 GAGGCCACATGATTCCATTTTGG 0: 1
1: 0
2: 4
3: 19
4: 148
905034659_905034664 -3 Left 905034659 1:34909903-34909925 CCAGCCTCCTTGTCCTTATCTTG 0: 1
1: 0
2: 4
3: 39
4: 408
Right 905034664 1:34909923-34909945 TTGGCCTCCTTTGTAACTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905034659 Original CRISPR CAAGATAAGGACAAGGAGGC TGG (reversed) Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
900699010 1:4032420-4032442 CAAAATAAGAACACGGAAGCAGG - Intergenic
900720166 1:4170849-4170871 CCAGGAAGGGACAAGGAGGCAGG - Intergenic
901106572 1:6760912-6760934 CAAGAAAAGGAAAAAGGGGCCGG + Intergenic
901651580 1:10746187-10746209 GAAGAGAGTGACAAGGAGGCAGG + Intronic
901911541 1:12462821-12462843 CCAGATAAGGCTAAGGTGGCAGG - Intronic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903889037 1:26557547-26557569 CCAGATAAGTACACGGAGGCCGG - Intronic
904455379 1:30644834-30644856 AAAGAAAAGGAAAAGGAGGGAGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905387357 1:37613914-37613936 GGAGAGAAGGACAAGGAGGAGGG + Intronic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
906291720 1:44623736-44623758 CAAGATAAGGTCCAGGAGGCAGG + Intronic
906561747 1:46763353-46763375 AAAGATAAAGCCAAGGAGGGTGG + Intronic
907043208 1:51281915-51281937 CCAGATAAGGACAATTAGTCTGG - Intergenic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
908741772 1:67336266-67336288 ACAGCTGAGGACAAGGAGGCTGG - Intronic
908822170 1:68099789-68099811 CAAGGTAAGGACATGGATTCTGG + Intronic
909308490 1:74114088-74114110 CAATAAGAGCACAAGGAGGCAGG + Intronic
911042345 1:93600708-93600730 CAAGACAAAGGCATGGAGGCAGG - Intronic
911427798 1:97742268-97742290 CAAAAGAATGACAAGGAGACTGG - Intronic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
913403520 1:118462385-118462407 AAAGATAAGGCCAGGGAGGGAGG - Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
916889867 1:169105151-169105173 CAGGATAAGGACAAGCATCCTGG + Intergenic
917191642 1:172424685-172424707 AGAGATAAGAACAAGGAGGCCGG - Intronic
919777485 1:201203709-201203731 CCAGAAAAGGAAGAGGAGGCGGG - Intronic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
920694820 1:208174326-208174348 CAAGAATAGAACAAGCAGGCAGG - Intronic
921713182 1:218393460-218393482 CAAGATCAGTAGAAGGAAGCCGG - Intronic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
922963569 1:229668395-229668417 GGAGCTAAGGAAAAGGAGGCTGG - Intergenic
1063068639 10:2636660-2636682 CTAGATAAGGAAAGGGAGTCTGG - Intergenic
1063435999 10:6031288-6031310 AAAGATAAGCATAAGGAAGCTGG + Intronic
1063503796 10:6579093-6579115 AAAGAAAAGGTCAAAGAGGCCGG + Intronic
1063917880 10:10902959-10902981 GAAGATAAGGAGAAGAAGGGAGG + Intergenic
1065492921 10:26300534-26300556 AAAGTCAAGGACAAGGTGGCAGG + Intronic
1066299094 10:34081149-34081171 CAAGACCAGAACACGGAGGCGGG - Intergenic
1067291321 10:44945403-44945425 AAAGATAAGGACAGGGAGCAGGG - Intergenic
1067513589 10:46916193-46916215 CAATATAAGTACTATGAGGCTGG - Intronic
1067648663 10:48135641-48135663 CAATATAAGTACTATGAGGCTGG + Intergenic
1068926191 10:62541721-62541743 CAAGATAAGGAACAAGAGGAAGG + Intronic
1069607695 10:69750093-69750115 CGAGAGGAGGTCAAGGAGGCGGG - Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1070215446 10:74374640-74374662 CATGACAATGACAAGCAGGCTGG - Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070719892 10:78749071-78749093 GAAGATCAAGACAAAGAGGCGGG + Intergenic
1071953864 10:90735500-90735522 CAAGAATAGGATGAGGAGGCAGG + Intergenic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072167001 10:92823441-92823463 GAAGATAAAGAAAAAGAGGCCGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1078927438 11:15887193-15887215 CAAGGTAATGGCAGGGAGGCTGG - Intergenic
1079442541 11:20529656-20529678 TAAAATAAGGACAATTAGGCTGG - Intergenic
1079759287 11:24309197-24309219 CAAGCGAAGGACCTGGAGGCAGG + Intergenic
1079759558 11:24311174-24311196 CAAGGGAAGGACCAGGAGGGAGG + Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1081862579 11:46341953-46341975 GAAGGTCAGGCCAAGGAGGCTGG + Intronic
1082821080 11:57545131-57545153 TAAGAAAGGGACAAGGAGGCCGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083300530 11:61737644-61737666 GAAGCTAAGGCCAAGGGGGCGGG - Intronic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083614778 11:64021011-64021033 CAAGATAAGCACCTGGGGGCCGG - Intronic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1086155367 11:83659644-83659666 CATGATATAGACAAGGAAGCTGG + Intronic
1086338041 11:85818966-85818988 AGAGATAAGGACACCGAGGCAGG - Intergenic
1087128368 11:94647845-94647867 CAAGATGAGGCTAGGGAGGCAGG + Intergenic
1087414707 11:97839309-97839331 GAAGAAAAGGAAAAGGAGGGTGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088818268 11:113435805-113435827 AAAGTAAAGGTCAAGGAGGCTGG - Intronic
1088888616 11:114027409-114027431 CAAGGTAGGGACCAGGAGCCTGG - Intergenic
1089148224 11:116345892-116345914 CAAGAAAAGGGACAGGAGGCAGG - Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1091004275 11:131938467-131938489 CAAGATGAGGTCACGGAGGTGGG + Intronic
1092341882 12:7683915-7683937 CAATATAAGCCCAAGGAAGCAGG + Intergenic
1092545012 12:9444507-9444529 TAAGATAAGGACGTGTAGGCTGG - Intergenic
1094346012 12:29469873-29469895 CAAGATGGGGTCAGGGAGGCAGG + Intronic
1094507938 12:31077549-31077571 TAAGATAAGGACGTGTAGGCCGG + Intronic
1097158187 12:57027842-57027864 AAAGATAATGACAATGACGCAGG + Intronic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1101091287 12:101288591-101288613 CATGGTCATGACAAGGAGGCTGG - Intronic
1101555718 12:105807243-105807265 CATGAGAAGGACAATGAGGGAGG - Intergenic
1101725957 12:107388423-107388445 AAAGAGAAAGACAAGGAAGCAGG - Intronic
1101875116 12:108592342-108592364 CAACAGAAGGATGAGGAGGCTGG + Exonic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1103801176 12:123538497-123538519 TAAGTTAAAGACAGGGAGGCAGG + Intergenic
1103865488 12:124048660-124048682 TAATATAAGGACAATGTGGCTGG - Intronic
1104613936 12:130253277-130253299 TAACATCAGCACAAGGAGGCAGG + Intergenic
1104904988 12:132208319-132208341 GAAGATCAGGTGAAGGAGGCCGG + Intronic
1105206366 13:18228904-18228926 CATGACAAAGAAAAGGAGGCCGG + Intergenic
1107112372 13:36711874-36711896 CAAGAGAAGGAGAAGGTTGCGGG - Intergenic
1107416976 13:40209994-40210016 CTAGAAAAGGAAAATGAGGCCGG + Intergenic
1107486086 13:40828799-40828821 CAAGAAAAGAAAAAGGAGGGTGG + Intergenic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1110143534 13:72160688-72160710 CAAAATAAATCCAAGGAGGCTGG - Intergenic
1112185157 13:97120894-97120916 CAATATAAGAACAAAGAGGCTGG - Intergenic
1112505684 13:99974095-99974117 CAAGAGTTGTACAAGGAGGCGGG - Intergenic
1113840358 13:113355830-113355852 CCAGCTGAGTACAAGGAGGCCGG + Intronic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1116394495 14:44431130-44431152 CCTGATAAGAACAAGAAGGCAGG + Intergenic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1116991738 14:51284522-51284544 AGAGATAAGTAAAAGGAGGCAGG - Intergenic
1117215323 14:53545601-53545623 GAAGATTAGGAAAAGGAGGTGGG + Intergenic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118704544 14:68468706-68468728 CAAGATAACCAGAAGGAGTCAGG - Intronic
1119413782 14:74456122-74456144 CAAGAACAGGACAAGAAGCCAGG - Intergenic
1120846049 14:89126008-89126030 AAGGAAAAGGACAAGGATGCAGG - Intronic
1121651787 14:95564186-95564208 GAAAATAAAGACAAGGATGCTGG + Intergenic
1122671969 14:103379487-103379509 CAGGACAAGGACAAGGACCCTGG + Intergenic
1127029440 15:54845487-54845509 AAAGAGCAGGAAAAGGAGGCGGG + Intergenic
1127954643 15:63842760-63842782 AAAGATAATCATAAGGAGGCTGG + Intergenic
1128055703 15:64698652-64698674 CAAGAAAGGGACAAGTAGGCAGG - Intronic
1128156327 15:65394131-65394153 CCAGATAAGGAAACTGAGGCAGG + Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1130079496 15:80720094-80720116 CAACAAAAAGAAAAGGAGGCTGG - Intronic
1130956281 15:88629515-88629537 GAAGAGAATGACAAGGAGGCTGG - Intronic
1132080554 15:98861352-98861374 AAAGAGAAGGACTAGGAGGGCGG - Intronic
1132610185 16:812002-812024 CAAGAGCAGGACAAGGAGAATGG + Intronic
1133643379 16:7739499-7739521 GAAGATCTGGACAAGGTGGCTGG + Intergenic
1133718678 16:8473918-8473940 CAAGATAAGGGCTTGTAGGCTGG + Intergenic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134821982 16:17254272-17254294 CAACATAAAGACAAGGATGAAGG + Intronic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136358693 16:29763586-29763608 CAAGAAAAGCACCAGCAGGCTGG + Intergenic
1136464317 16:30431548-30431570 AAAGATAAGGAAACTGAGGCCGG + Intergenic
1136510834 16:30737464-30737486 CAAGATATGGACAGGGAGAATGG - Exonic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1138990997 16:62391209-62391231 CAGGATGATGACAAGGAGTCAGG - Intergenic
1139555673 16:67708378-67708400 CAAGCTAAGGCCCAGTAGGCTGG + Intronic
1140676083 16:77331538-77331560 GAATATAATGATAAGGAGGCTGG - Intronic
1140837820 16:78811665-78811687 TAAGAAGAGGACAAGGGGGCTGG - Intronic
1141901972 16:86996864-86996886 AAAGATGAGGGCACGGAGGCCGG - Intergenic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1143547133 17:7604131-7604153 CAAGAAAGGGATGAGGAGGCCGG + Intronic
1143556260 17:7662918-7662940 CAAAATAATGACAATAAGGCCGG - Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144456517 17:15423287-15423309 CAAGTTAAGGATAAGGAAGCTGG + Intergenic
1144612859 17:16739400-16739422 CAAGAAAGTGAAAAGGAGGCTGG - Intronic
1144899926 17:18576187-18576209 CAAGAAAGTGAAAAGGAGGCTGG + Intergenic
1145132518 17:20369478-20369500 CAAGAAAGTGAAAAGGAGGCTGG - Intergenic
1145292874 17:21563693-21563715 CAAGAAAAGGGCAAGAAGGGAGG + Intronic
1145303522 17:21656773-21656795 CTAGACAAGGACAATGAGGAGGG + Intergenic
1145346521 17:22045076-22045098 CTAGACAAGGACAATGAGGAGGG - Intergenic
1145387087 17:22422238-22422260 CAAGAAAAGGGCAAGAAGGGAGG - Intergenic
1146490245 17:33275928-33275950 CAAGATAAGGCCAAGCACCCAGG - Intronic
1147332167 17:39705567-39705589 GCAGATAAGGACAAAGAGGGAGG - Intronic
1147351665 17:39852416-39852438 CAAGATAAGGACAAAGAGTGTGG - Intronic
1147636089 17:41965236-41965258 CAAGATCAGGAGAAACAGGCAGG + Exonic
1148548295 17:48533216-48533238 CATGATCGGGAAAAGGAGGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1150588264 17:66538097-66538119 CAAGAAAAAGAAAAGGAGTCAGG - Intronic
1151425006 17:74025302-74025324 CAAGATGAAGTCATGGAGGCGGG - Intergenic
1151560791 17:74868540-74868562 GAAGATAAGGACAGAGAGGTTGG - Intronic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152795972 17:82306522-82306544 CAAGAAAATGAGAACGAGGCCGG - Intergenic
1153378873 18:4412983-4413005 CATGATATTCACAAGGAGGCAGG + Intronic
1153939995 18:9969191-9969213 GAAGATGAGGAGAAGCAGGCGGG - Intergenic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1157495117 18:48151528-48151550 AAAGATAAGGAAACGGAGGCTGG + Intronic
1158011848 18:52737645-52737667 GAAGACAGGGACAAGGAGGGAGG + Intronic
1158024125 18:52875816-52875838 GAAGATAAAGGCAAGGAAGCTGG + Intronic
1158071053 18:53470839-53470861 CAAGAGAAGGACAAAGTGGGAGG - Intronic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1159507599 18:69357033-69357055 CAAGAGAAGCATAAGGATGCTGG - Intergenic
1159689678 18:71470788-71470810 CAAGAAAATGACAAATAGGCCGG - Intergenic
1159903772 18:74072200-74072222 CCAGATGAGGACTAGGAGTCAGG - Intergenic
1160228854 18:77031458-77031480 AAAGCTAAGAAAAAGGAGGCAGG + Intronic
1160758313 19:769894-769916 ACAGATAAGGACACTGAGGCTGG - Intergenic
1160824512 19:1073474-1073496 AGAGATAAGGACAAGGAGGTGGG - Intronic
1160949726 19:1659690-1659712 CCTGAAAAGGACAAGGGGGCTGG - Intergenic
1161383405 19:3978340-3978362 CCAGACAAGGACAAGGAGCAGGG + Intronic
1161999536 19:7734621-7734643 CAAGACAAAGGCAAGGGGGCAGG + Intergenic
1162873636 19:13604396-13604418 AAAGAGAAAGACAAAGAGGCCGG + Intronic
1163505548 19:17703935-17703957 CAAGAGGAGGAGACGGAGGCAGG + Intergenic
1165677907 19:37744248-37744270 AGAGATTAGGAAAAGGAGGCTGG + Intronic
1165683452 19:37797311-37797333 CCAAATAAGAACAAAGAGGCTGG + Intronic
1166617375 19:44262299-44262321 CAAGAGAAGGACAGGGAAGCTGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167260387 19:48454662-48454684 CAAGCTGAGGACAGGGATGCTGG - Exonic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1167839010 19:52098532-52098554 AAAGATAACGCCAAGGAAGCAGG + Intergenic
1167861030 19:52284300-52284322 CATGAATAGGTCAAGGAGGCAGG - Intronic
1168164346 19:54536478-54536500 CAAGATAAGAACAGCGAGGCTGG + Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925259423 2:2517062-2517084 CAAGTTCAGGAAAAGGAGGAAGG - Intergenic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
927342692 2:22000384-22000406 TAAGTTCAGGACTAGGAGGCAGG + Intergenic
928077183 2:28275504-28275526 CAAGCTAAAGACCAGCAGGCAGG + Intronic
928225865 2:29447561-29447583 AAAGATAAGAACATGGAGTCAGG + Intronic
929171551 2:38937484-38937506 CCAGATAAACTCAAGGAGGCTGG + Exonic
929217169 2:39427246-39427268 CAAAATAAAGACAATGAGGAGGG + Intronic
929489208 2:42381558-42381580 AAAGATCATGACAAGCAGGCAGG - Intronic
930741976 2:54841083-54841105 AGAGATCAGGACAAGGAGGGGGG + Intronic
931428902 2:62194996-62195018 AGAGATAAGGACCAGGGGGCGGG + Intergenic
932686710 2:73876598-73876620 CAAGATGAGGATAGGGAGGCTGG + Intergenic
933839418 2:86274654-86274676 CAAGATAGGGATGAGGAGCCTGG + Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934161329 2:89252439-89252461 AGAGATAAAGACAGGGAGGCTGG + Intergenic
934205950 2:89929976-89929998 AGAGATAAAGACAGGGAGGCTGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
935241870 2:101185911-101185933 AAATATGAGGACAAGGAGGCTGG - Intronic
935639140 2:105274275-105274297 CAAGGAAAGGACAGTGAGGCAGG + Intronic
936071635 2:109375265-109375287 GGCGAAAAGGACAAGGAGGCAGG - Intronic
936192789 2:110345062-110345084 CAAGCTCAGGACAAGGACTCAGG + Intergenic
936949340 2:117962345-117962367 CCAATTAAGGACAAGTAGGCTGG + Intronic
937701465 2:124867294-124867316 CAAGAAAAGGACAAAGAGAATGG - Intronic
937729444 2:125209932-125209954 CAAGATAAAGTAAAGGAGGCTGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938189196 2:129259517-129259539 CAAGATAATGACAGTGAGCCAGG - Intergenic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
939527385 2:143314000-143314022 CAATAAAATTACAAGGAGGCTGG - Intronic
939866324 2:147476566-147476588 TAAGATGAGGACAAAGAGGTAGG - Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
941700754 2:168601844-168601866 TAAGATAAGGCCAAGAGGGCTGG - Intronic
942262310 2:174181012-174181034 CAAGGAATGTACAAGGAGGCTGG + Intronic
943334750 2:186600143-186600165 CAAGATAAGGTCAAGGAGCCTGG - Intronic
943786345 2:191882087-191882109 CCAGACAAGAACAAGGAGCCCGG - Intergenic
945690040 2:213022298-213022320 CAAGACAAAGACAAGAAGACAGG + Intronic
945897950 2:215505697-215505719 GTAGATAAGGACAAAGAGGTGGG + Intergenic
946004067 2:216507926-216507948 GCAGATAAGGAGAATGAGGCTGG - Intronic
946085100 2:217162915-217162937 CAAGATGAGGATCAGCAGGCAGG - Intergenic
946148421 2:217748129-217748151 CAAGAGCAAGACAAGGGGGCTGG - Intronic
946224632 2:218257621-218257643 CAAGCTAAGGATAAGGAGCTTGG + Intergenic
946322486 2:218961875-218961897 AAAGCTAAGGATAAGGAAGCGGG - Exonic
946433717 2:219638821-219638843 CAGGATGAGGACGAGGAGGGCGG - Exonic
948660077 2:239501636-239501658 TGAGCTAAGGACAAGGAGACAGG + Intergenic
948777848 2:240299167-240299189 CAAGGAAGGGACAAGGAAGCTGG - Intergenic
948815855 2:240510097-240510119 GAAGACAAGGGCAAGGAGGCAGG - Intronic
948825551 2:240571997-240572019 CATGGTCAGGAAAAGGAGGCTGG - Intronic
1170654389 20:18272654-18272676 GAAGATAAGGACAATGAGACAGG - Intergenic
1170947860 20:20908057-20908079 CAACATGAGGTCAAGGAAGCTGG - Intergenic
1171059906 20:21946078-21946100 AAAGAGAAGGACCAGAAGGCAGG + Intergenic
1171521044 20:25774458-25774480 CTAGACAAGGACAATGAGGAGGG + Exonic
1171555880 20:26082021-26082043 CTAGACAAGGACAATGAGGAGGG - Intergenic
1172038530 20:32027726-32027748 CAATTTAGAGACAAGGAGGCAGG + Intronic
1172829462 20:37820975-37820997 CAAGAGAAGGCCAAAGGGGCAGG - Intronic
1172991611 20:39040907-39040929 CACGAGAAGGACAGGGTGGCAGG + Intergenic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1173559296 20:43991199-43991221 TAAGATAAGGACAAGGAACCAGG + Intronic
1173614660 20:44394899-44394921 CAGGCTAAGGACAGGGAGGGAGG + Intronic
1174466695 20:50723295-50723317 CAAGGTGAGGACAGTGAGGCAGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174607364 20:51770489-51770511 CAAGAGAAGACCAAGGAGGCCGG + Intergenic
1176654893 21:9579576-9579598 CTAGACAAGGACAATGAGGAGGG + Intergenic
1176857749 21:13985483-13985505 CAGGATCAGGGCCAGGAGGCTGG - Intergenic
1177148367 21:17430345-17430367 CCACTGAAGGACAAGGAGGCTGG - Intergenic
1177839006 21:26216071-26216093 CAAGAAAAGGACAAGGGGAAAGG - Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179519548 21:41933069-41933091 CAAGACAGGGACAAGGCCGCCGG - Intronic
1181366011 22:22377574-22377596 CCAGATCAGGAGAAGCAGGCTGG - Intergenic
1181901861 22:26162664-26162686 CAAGATAAGGCCAAACAGGGAGG + Intergenic
1181935275 22:26433809-26433831 CACGAAGAGGACCAGGAGGCAGG - Exonic
1183079836 22:35449334-35449356 CACGATAGGGGCAAGGAGCCTGG - Intergenic
1183452161 22:37902636-37902658 CAAGTAAACAACAAGGAGGCCGG - Intergenic
1183606593 22:38870141-38870163 CAAGATGAAGAAAAGGAGACAGG + Intronic
1183941748 22:41299733-41299755 AAAGAAAAGGGCCAGGAGGCTGG - Intergenic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
949996858 3:9624440-9624462 CAAGATAAAAAAGAGGAGGCAGG - Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950280940 3:11707450-11707472 CAAGATAAGGACAATACAGCTGG + Intronic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950930357 3:16783231-16783253 GATGATACGGACATGGAGGCAGG + Intergenic
950991349 3:17441527-17441549 GAAAATAAGGCCAAGGTGGCTGG + Intronic
951144213 3:19206918-19206940 CAAGACAAAGACAGGGAGACTGG + Intronic
951860054 3:27242108-27242130 CCATGTAAGGCCAAGGAGGCAGG + Intronic
951914082 3:27781140-27781162 CAAGAGAAGCACAAGGAGACAGG + Intergenic
951937844 3:28041726-28041748 CAGGATAAAGACTAGGAGTCTGG + Intergenic
955305343 3:57825292-57825314 CAAGAACAAGACAAGGATGCCGG - Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960303714 3:116035455-116035477 CAAGAGAAGGAAAAGGGGGTGGG + Intronic
960696910 3:120405482-120405504 TGAGAACAGGACAAGGAGGCTGG - Intronic
960969502 3:123129651-123129673 AAAGTTCAGGACAAGGTGGCTGG - Intronic
964351932 3:155811713-155811735 TAAGAAAAGGAAAAGAAGGCCGG + Intergenic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964729857 3:159853182-159853204 CAAGGAAAGGCCAGGGAGGCTGG + Intronic
965400346 3:168205988-168206010 CAAGATGGGGAAAAGGGGGCCGG - Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966685585 3:182691129-182691151 ATAGATAAGGAAAAGGAGGGGGG + Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
969184831 4:5467362-5467384 CCAGCGAAGGACAAGGGGGCCGG - Intronic
971261657 4:25062793-25062815 CAAGATAGGAACAAGGATGGTGG + Intergenic
971483411 4:27134705-27134727 AAAGACAAAGACAAGGAGGCCGG + Intergenic
972422591 4:38903458-38903480 AAAAATGAGGTCAAGGAGGCTGG - Intronic
973551204 4:52038024-52038046 CAAGCTAGGGACCAGGAGCCAGG - Intronic
974426613 4:61750466-61750488 CAAGGTAAGGAAAAGCAGGATGG + Intronic
975735549 4:77377431-77377453 GAAAAGAAGGACAAGGACGCTGG - Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976851901 4:89557335-89557357 AAAGATAAGGAGGAGCAGGCAGG + Intergenic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
979283001 4:118888689-118888711 CGAGATAAGGGAAAGGAGGACGG - Intronic
979736060 4:124086020-124086042 CGAGATAAGGACAATTATGCAGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
981123334 4:141077681-141077703 AAACATAAGGAAAAGAAGGCTGG - Intronic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981915951 4:150033417-150033439 CAAGAAAAGGACAAGAGAGCTGG - Intergenic
984509564 4:180662111-180662133 TAAAATGAGGACAGGGAGGCAGG - Intergenic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
989120178 5:37997282-37997304 CAAGAGGAGAAAAAGGAGGCAGG - Intergenic
989262359 5:39432509-39432531 CCAGAGAAGGACAAGGAGCCTGG - Intronic
989491906 5:42066426-42066448 CAACATAACGAATAGGAGGCAGG + Intergenic
989535225 5:42555802-42555824 GAAGAGAAAGACAAGGAGCCTGG + Intronic
989706116 5:44332882-44332904 CAAGAGAATGAGAAGGAGACGGG + Intronic
990156376 5:52882202-52882224 CAAGAGAAGGATAAGAAGGATGG - Intronic
994520008 5:100821994-100822016 TAAGACAATGACAAGGTGGCAGG + Intronic
995338080 5:111025700-111025722 CAAAATAAGGCCAAGGGGACTGG + Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997211339 5:132078795-132078817 GGACATAAGGACAAGCAGGCTGG - Intergenic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
998251310 5:140555169-140555191 CAAGATAGAGACAAGGGGCCAGG - Intronic
998909560 5:146944050-146944072 AGAGATAAGGATGAGGAGGCTGG - Intronic
999048677 5:148497712-148497734 TGAGACAAGGACAAAGAGGCTGG + Intronic
999265961 5:150267077-150267099 CAAGCTAGGGATAAGGAGGTGGG + Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1000278359 5:159760351-159760373 CCACATACGGACAAGGTGGCTGG - Intergenic
1000558683 5:162758602-162758624 TCAAATAAGGACAAGGAGGTAGG + Intergenic
1001454652 5:171851468-171851490 CAAGTTAAAGAAAAGGAAGCAGG - Intergenic
1002554091 5:180020717-180020739 CAAGAGAAAGAAAAGGGGGCAGG + Intronic
1003154544 6:3579672-3579694 CAAGAGAAGGAACATGAGGCCGG - Intergenic
1003250423 6:4424851-4424873 CAAGAAAAGGGAAAGAAGGCCGG + Intergenic
1003547112 6:7068651-7068673 CAAGAAAAAGAAAAAGAGGCTGG - Intergenic
1003560977 6:7180071-7180093 AAAGATGTGGACAAAGAGGCTGG + Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004392346 6:15220397-15220419 CAAGAGAAGGAAAAGGAAGTTGG + Intergenic
1005089200 6:22038549-22038571 GAAGAAAAAGACAAGGAGGAGGG - Intergenic
1005598738 6:27405526-27405548 CAAGATAAGGCCATGGGGCCTGG - Intergenic
1006596092 6:35193416-35193438 CAAGATAAGAACTTGGAAGCAGG + Intergenic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007586341 6:42992353-42992375 CAAGAAAAGGGCAAGGGGGCCGG - Intronic
1007778511 6:44237676-44237698 CCTGGTAAGGACGAGGAGGCGGG - Intergenic
1008940091 6:57037616-57037638 CAAGAAAAGGAAAAACAGGCTGG - Intergenic
1009887442 6:69640612-69640634 CAAGATAAAGACCAGGAAGAGGG + Intergenic
1011777333 6:90746398-90746420 CAAGATAGGCACAAGAAGGCTGG - Intergenic
1012520170 6:100111800-100111822 CAGGATATGGGCCAGGAGGCTGG + Intergenic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013829900 6:114258656-114258678 CAAGAGCAGGACAAGGAGAAGGG - Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015565297 6:134563729-134563751 CAATCTAAGGTCAAGGAGGCTGG + Intergenic
1016058367 6:139602673-139602695 TGAGATAAGGAATAGGAGGCAGG - Intergenic
1018515894 6:164579781-164579803 TAAGATGAGGAAAAGCAGGCCGG - Intergenic
1019101550 6:169634947-169634969 CAAGATCAGAAAGAGGAGGCAGG + Intronic
1019737882 7:2659480-2659502 GAAGAAAAAGAAAAGGAGGCAGG - Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1022222074 7:28323375-28323397 CAAGATAGGAACACGGAGGAAGG - Intronic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1024161798 7:46683521-46683543 CAAGAAAAGGATAAGGAGTTTGG + Intronic
1024183429 7:46921839-46921861 GAAGAAAAGGAAAAGGAGGAAGG + Intergenic
1025281518 7:57629406-57629428 CTAGACAAGGACAATGAGGAGGG + Intergenic
1025303212 7:57836109-57836131 CTAGACAAGGACAATGAGGAGGG - Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1025873063 7:65453009-65453031 GGAGATAAGGCCAAGGTGGCTGG - Intergenic
1026470405 7:70690104-70690126 CTAGATAAGGAAACTGAGGCAGG + Intronic
1027470286 7:78565086-78565108 GAAAAGAAGGTCAAGGAGGCCGG - Intronic
1028864515 7:95692321-95692343 CAAGAGAAAGACCAGTAGGCCGG + Intergenic
1029411132 7:100411563-100411585 CAAGATAAGGTAATTGAGGCTGG - Intronic
1032285856 7:130538049-130538071 CAAGTTGAGGACATGGAAGCTGG + Intronic
1032842333 7:135724168-135724190 CAAGTTAAGGGGAAGGAGGTGGG + Intronic
1032870733 7:135981835-135981857 TCACTTAAGGACAAGGAGGCCGG + Intergenic
1033185507 7:139224420-139224442 GAAGAGAAGGACAGGGAGGGAGG + Intergenic
1033590289 7:142802974-142802996 CAAGATGAGGACAGAGAGGAAGG + Intergenic
1033652545 7:143353759-143353781 CAACACAAGGACAAGAAGGAAGG + Exonic
1034435672 7:151061745-151061767 AAAGAGAAGAACAAGGAGACAGG - Intronic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1037147666 8:15592840-15592862 AAAGATGAGGAAAACGAGGCAGG + Intronic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1037779094 8:21855591-21855613 CGAGAGAAGGACCTGGAGGCAGG - Intergenic
1037900012 8:22682615-22682637 CATGATAAGGATCAGGAAGCAGG + Intergenic
1038835523 8:31116986-31117008 CAAAGTATGGACAAAGAGGCAGG + Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041187130 8:55312859-55312881 CAAGACAAGGAGAAAGAGACTGG + Intronic
1041277981 8:56182785-56182807 CATGCTGAGGACAAAGAGGCGGG + Intronic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1042070847 8:64931503-64931525 CAAGAGAAGCACAAGGGGTCAGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042555893 8:70033468-70033490 CAAGAAAGTGACAAGGAGGTGGG + Intergenic
1043264079 8:78240496-78240518 CCAGATATGGAAAAGAAGGCTGG + Intergenic
1046927972 8:119813599-119813621 CCAGAGAAGGACAAAGAGGATGG + Intronic
1047187220 8:122644888-122644910 CAATAAAAGGCCCAGGAGGCAGG + Intergenic
1047371322 8:124258297-124258319 CAAGTTAGGGGGAAGGAGGCTGG - Intergenic
1047661134 8:127038246-127038268 AAAGAGAAGGACAAGCAGCCAGG - Intergenic
1050013796 9:1211723-1211745 CAGGTTAAGGACATGGAGACTGG - Intergenic
1051728207 9:20110543-20110565 CAAGAAAAGGAAGAGGAGACTGG - Intergenic
1051858838 9:21601041-21601063 CAAAGGAAGGACAAGAAGGCTGG + Intergenic
1051947824 9:22593094-22593116 AAATATAAGGACAACGAGCCTGG - Intergenic
1052519193 9:29522664-29522686 AAAGATAAGGAAACCGAGGCAGG - Intergenic
1055261797 9:74445536-74445558 CAAGGAAAGGACAAAGAGCCTGG + Intergenic
1056514294 9:87335256-87335278 GAAGATAAAGGCAAGGAGACTGG - Intergenic
1059014820 9:110504415-110504437 GAAGAAAAGGAGAAGGAAGCAGG - Intronic
1059138406 9:111829512-111829534 GAAGATAAGGAGAAGAAGGGAGG - Intergenic
1059953864 9:119495892-119495914 CAAAATAAGGCCAGTGAGGCTGG + Intronic
1060801772 9:126549589-126549611 CAAGAGAGGGACTGGGAGGCTGG - Intergenic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1061859578 9:133460944-133460966 CCAGAAAAGGACAAAGAGGGAGG + Intronic
1062028370 9:134350868-134350890 ACAGATGAGGACAAGGCGGCAGG - Intronic
1062261430 9:135665040-135665062 CAAGCCAATGACAAGGAGGGAGG + Intronic
1203632618 Un_KI270750v1:83029-83051 CTAGACAAGGACAATGAGGAGGG + Intergenic
1186335309 X:8580644-8580666 GAAGATAAGGACAAGAAGTTTGG + Intronic
1187972783 X:24675149-24675171 CAAGATAAGAATAAGGATGAGGG - Intergenic
1188801864 X:34542260-34542282 CAAGATAATAATTAGGAGGCTGG + Intergenic
1189890278 X:45593908-45593930 CAAGTTAAGCACAGGAAGGCAGG - Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190915115 X:54805833-54805855 GAAGAGAAGGGCAAGGAGGAGGG - Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1194235651 X:91380573-91380595 CAGGATAAAGACAATCAGGCAGG - Intergenic
1194717068 X:97298912-97298934 TAAGAAAAGGACTAAGAGGCTGG - Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1198035436 X:132797046-132797068 CTTGCTAAGGACAAGCAGGCAGG - Intronic
1198160105 X:133999737-133999759 GGAGATAAGGCCAAGGCGGCTGG + Intergenic
1199523883 X:148769763-148769785 CAAGTTAAGGAGAAGGGGTCTGG - Intronic
1200101160 X:153689564-153689586 CAAGGTCAGGAGAAGGATGCTGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201428184 Y:13877300-13877322 AAAGATAAGGACAAAAAGTCTGG - Intergenic
1201454648 Y:14156493-14156515 AAAGATAATGACAAGAAGCCAGG - Intergenic