ID: 905035130

View in Genome Browser
Species Human (GRCh38)
Location 1:34913120-34913142
Sequence CAGAAAATGGAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1483
Summary {0: 1, 1: 1, 2: 17, 3: 148, 4: 1316}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905035122_905035130 -10 Left 905035122 1:34913107-34913129 CCCCTCACTGCCCCAGAAAATGG 0: 1
1: 0
2: 0
3: 30
4: 259
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035113_905035130 28 Left 905035113 1:34913069-34913091 CCCACTCCTTAGGACCCCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 150
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035117_905035130 14 Left 905035117 1:34913083-34913105 CCCCAAGGGAAATCACCTCCTTT 0: 1
1: 1
2: 2
3: 25
4: 224
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035121_905035130 -4 Left 905035121 1:34913101-34913123 CCTTTTCCCCTCACTGCCCCAGA 0: 1
1: 0
2: 2
3: 72
4: 614
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035118_905035130 13 Left 905035118 1:34913084-34913106 CCCAAGGGAAATCACCTCCTTTT 0: 1
1: 1
2: 1
3: 25
4: 234
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035120_905035130 -1 Left 905035120 1:34913098-34913120 CCTCCTTTTCCCCTCACTGCCCC 0: 1
1: 0
2: 10
3: 129
4: 1196
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035111_905035130 29 Left 905035111 1:34913068-34913090 CCCCACTCCTTAGGACCCCAAGG 0: 1
1: 0
2: 1
3: 15
4: 222
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035119_905035130 12 Left 905035119 1:34913085-34913107 CCAAGGGAAATCACCTCCTTTTC 0: 1
1: 0
2: 2
3: 14
4: 275
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035116_905035130 22 Left 905035116 1:34913075-34913097 CCTTAGGACCCCAAGGGAAATCA 0: 1
1: 0
2: 1
3: 11
4: 129
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316
905035115_905035130 27 Left 905035115 1:34913070-34913092 CCACTCCTTAGGACCCCAAGGGA 0: 1
1: 0
2: 1
3: 13
4: 141
Right 905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG 0: 1
1: 1
2: 17
3: 148
4: 1316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905035130 Original CRISPR CAGAAAATGGAGAAGGAAGA AGG Intronic
900788615 1:4665450-4665472 CAAAAAATGCTGAAGGAAGAAGG - Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901329061 1:8390516-8390538 CAGAACTTGGGGAAGGAAGAAGG + Intronic
902176088 1:14652378-14652400 GAGAAACAGGAGGAGGAAGAAGG - Intronic
902185814 1:14724575-14724597 CACAAAACGGAGAAGGAACCAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903636883 1:24825436-24825458 AAGAAAATGGAGAGGGTAAAGGG + Intronic
903857819 1:26346985-26347007 GAGAAAAGGAAGAAGGCAGAAGG + Intronic
903869270 1:26420775-26420797 TAGAAAATGGAGAAGCAAAAGGG - Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906098868 1:43243201-43243223 CAGAAAAGGGGGAAGAGAGAGGG - Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
906706270 1:47897112-47897134 GAGAAAGTGGAGCAGGAACAGGG + Intronic
907063405 1:51454370-51454392 CAGAGAATAGAGTAGGAAAAGGG + Intronic
907185081 1:52602927-52602949 CAGAAAATGAGGACGGGAGAGGG - Intronic
907391861 1:54163393-54163415 CAGCAAAGGGGGTAGGAAGAGGG - Intronic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
907771482 1:57469397-57469419 CAGAAAAAGGAGAAAAAAGTTGG + Intronic
908028562 1:59975857-59975879 CAGAATATAGAAGAGGAAGAAGG - Intergenic
908504997 1:64787975-64787997 GAGAAAATGGAGAACGGACAAGG - Intronic
908889007 1:68821973-68821995 TATAAAATGGAGAAAAAAGATGG + Intergenic
909347649 1:74610896-74610918 AAGAAAATGGTTAAGGAATAAGG - Intronic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909686196 1:78351819-78351841 CAGAGAGTGGAGAATGGAGACGG + Intronic
909897801 1:81095205-81095227 AAAAAAATGGAGCAGGAAAAGGG + Intergenic
910280891 1:85500271-85500293 GAGAAAATGGGAAGGGAAGAAGG - Intronic
910281226 1:85503745-85503767 AAGAAAATAAAGCAGGAAGATGG + Intronic
910283258 1:85524901-85524923 CAGAAAATGGATTAAGCAGATGG + Intronic
910340837 1:86185087-86185109 CAGGCAATGGAGAAGGATCAAGG + Intergenic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
910852200 1:91659527-91659549 TGGGAAATGGATAAGGAAGAAGG - Intergenic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911490255 1:98556181-98556203 CAGGGAATGGAAAAGGAAGAGGG + Intergenic
911592239 1:99761434-99761456 CAGAAAATGAATAAAGAAAATGG - Intronic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912554621 1:110507260-110507282 CAGAAAAAGGGAAAGAAAGACGG - Intergenic
912790612 1:112645971-112645993 AAAAAAATGGAGCAGGAAAATGG + Intronic
912980818 1:114369950-114369972 AAGAAAATGGAGAAGGCACCAGG + Intergenic
913008868 1:114662964-114662986 AGGAAAAGGAAGAAGGAAGAGGG + Intronic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913476661 1:119244701-119244723 GAGAGAATGGAAAATGAAGAGGG - Intergenic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
914206753 1:145538080-145538102 CAGAAAATGGATTAAGCAGATGG - Intergenic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
914992818 1:152513633-152513655 AAGAAAATGGGAAAGGAAGAAGG - Intronic
915257091 1:154641896-154641918 AACAAAAAGGAGGAGGAAGAGGG - Intergenic
915537128 1:156543549-156543571 GGGAATATGGAGCAGGAAGATGG + Intronic
915579650 1:156805784-156805806 CAGAGAATGGGGAAGCAAGAGGG + Intergenic
915725234 1:158012600-158012622 CAGACAATTGGAAAGGAAGATGG - Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
916817565 1:168368479-168368501 GAGATAATGGGGAAGGAAGGAGG + Intergenic
916843096 1:168620560-168620582 CAGCAAATGAAGTAGGTAGAAGG + Intergenic
917174735 1:172221063-172221085 GAAAAAATGAAGAAGGAAAAGGG - Intronic
917304093 1:173608980-173609002 GGGAAAAGGGAGAAGGGAGAAGG + Intergenic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918587155 1:186201346-186201368 CAAAGAATGGAGGAGGAAAATGG + Intergenic
918659268 1:187069882-187069904 CAGAATATGGATAAAGAAGTAGG + Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
919426914 1:197444327-197444349 AAGAAAATGGATGAGTAAGAAGG - Intronic
919453505 1:197798660-197798682 CAGAGAATTGAGAGGGAACATGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919739179 1:200972214-200972236 CAGAAAATTATCAAGGAAGAGGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920110891 1:203586347-203586369 CAGAAACGGGAGAAGTAAGTGGG - Intergenic
920127113 1:203702144-203702166 AGGAAAAGGGAGAAGGAAGATGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920176056 1:204102616-204102638 GAGCAGATGGAGGAGGAAGAGGG + Intronic
920341552 1:205278273-205278295 GAGAAAATGAAGAAGAAGGAAGG - Intergenic
920362327 1:205427767-205427789 CATGAAATGGAGAAGGAATGAGG + Intronic
920431628 1:205922541-205922563 CAGAAAATGGAGAAGGGCCTTGG + Intronic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920536251 1:206738445-206738467 CAGAAAATGGAATAGCATGATGG + Intergenic
920619389 1:207529186-207529208 AACAAAATGGAAAAGAAAGAAGG - Intronic
920621171 1:207547741-207547763 AACAAAATGGAAAAGAAAGAAGG - Intronic
920813824 1:209312152-209312174 AAGAAAAGGGGAAAGGAAGAAGG - Intergenic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921485846 1:215714612-215714634 GGGGAAATGGAGAAGGAAAAAGG + Intronic
921568838 1:216754163-216754185 CAGAATATTTGGAAGGAAGAAGG - Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922235582 1:223720147-223720169 CCAAAAACGGAGAAGGAAGGAGG + Intronic
922354349 1:224761816-224761838 CAGAATATGGACAGGGAATACGG - Intergenic
922358500 1:224798975-224798997 CAGAAAATAGGAAAGGAAGGGGG + Intergenic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
923256714 1:232227877-232227899 CAAAAAGAGGAGAATGAAGAAGG + Intergenic
923515121 1:234690704-234690726 CTGAAAATTGATATGGAAGAAGG + Intergenic
923988416 1:239407872-239407894 CATAAAGTGGAAGAGGAAGATGG + Intronic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924254448 1:242168936-242168958 AAGAAAAGGGAGAAGAGAGAAGG + Intronic
924421833 1:243917183-243917205 GAGAAAAGGGAAAAGCAAGACGG - Intergenic
924519738 1:244795611-244795633 CAGAAACAGGAGAGGGCAGAGGG - Intergenic
924634331 1:245771251-245771273 CAGCAAAGGGAAAAAGAAGAAGG + Intronic
924802889 1:247340469-247340491 CAGCTAATAGAGGAGGAAGAAGG - Intergenic
924827937 1:247561623-247561645 TAATAAATGGAGAAGGAAAATGG - Intronic
1062945543 10:1458576-1458598 CCCCAAGTGGAGAAGGAAGAAGG - Intronic
1063211276 10:3883336-3883358 CACAAGCTGGAGGAGGAAGAAGG - Intergenic
1063268408 10:4479493-4479515 CTGAAAAGGGAGATGGATGAGGG + Intergenic
1063303485 10:4875188-4875210 CGGAAAATCAAGAAGGAAAAAGG - Intergenic
1063602965 10:7498640-7498662 CAGAAAACGGAGAGGGCAGTTGG + Intergenic
1063706568 10:8436575-8436597 CAAAAAATGGAGAGGAAAGCAGG - Intergenic
1063832982 10:9977886-9977908 TAGACACTGGAGAAGGAGGAAGG + Intergenic
1063937982 10:11098523-11098545 GAAAAAATGGATGAGGAAGAGGG + Intronic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064151709 10:12871125-12871147 TGGAAAATGAGGAAGGAAGAAGG + Intergenic
1064218220 10:13417987-13418009 TCGAAAATGGAGTGGGAAGAGGG + Intergenic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1065219252 10:23479399-23479421 GAGGAAAGGGAGAGGGAAGAGGG - Intergenic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065629705 10:27665951-27665973 CAGAGACTGGAGAGGGAAGGGGG + Intergenic
1065838463 10:29680359-29680381 CAGCCAGTTGAGAAGGAAGAGGG + Intronic
1065977300 10:30853671-30853693 GAGAAAATGAAACAGGAAGAGGG - Intronic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067316092 10:45164473-45164495 TAGATAATGGAGAAGAAACAAGG + Intergenic
1068107630 10:52638848-52638870 CAAAAAATGAAGATGGAAAATGG - Intergenic
1068410629 10:56649598-56649620 CAGAAGCTGGTGAAGAAAGAGGG - Intergenic
1068460898 10:57327045-57327067 TAAAAAAAGGAGGAGGAAGAAGG - Intergenic
1068968622 10:62939094-62939116 GAGAGAATGGGGAAGAAAGAGGG - Intergenic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1069190364 10:65479904-65479926 CAGAAAAAGGATAGGAAAGAAGG + Intergenic
1069770561 10:70896630-70896652 AAGAAAAAAGAAAAGGAAGAGGG - Intergenic
1069809323 10:71146789-71146811 CAGAAATTGGGGAAAGAAAAGGG - Intergenic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070711665 10:78687432-78687454 CAGAGACTGGAGATGGAGGAAGG + Intergenic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1071026925 10:81125760-81125782 GAGAAACTGGAGAATGAAAACGG + Intergenic
1071027095 10:81128002-81128024 CAGAAAAAGGAAAGGAAAGATGG - Intergenic
1071085088 10:81860765-81860787 CAGAAATTTGAGCAGGCAGAAGG - Intergenic
1071092936 10:81941212-81941234 GAGAATATGAAGTAGGAAGATGG + Intronic
1071405925 10:85332414-85332436 CAGAAAAGGAAGAAGGCAGAGGG - Intergenic
1071456309 10:85854048-85854070 CAGAAAATGGAGCTGCAAGGAGG - Intronic
1071578700 10:86750505-86750527 CATTAAATGGAGAATGAATATGG + Intergenic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071847380 10:89535112-89535134 CATAAAATCCAGAAGAAAGATGG + Intronic
1071920739 10:90347194-90347216 CAGACAAGGAAGAAGGAACAAGG + Intergenic
1072041290 10:91609075-91609097 TAGAAAAGGGAGAAGGGAGGAGG + Intergenic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG + Intronic
1072532648 10:96333833-96333855 CAGAAAATGGACAGGGAAAAGGG + Intronic
1072873603 10:99148116-99148138 CAGAACATGCAGAATAAAGAAGG + Intronic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1073155111 10:101340275-101340297 CAGAAAAGGGTGAAAGAAGTGGG + Intergenic
1073811125 10:107153072-107153094 GAGAAAATGAAGGAGGGAGAGGG - Intronic
1073908091 10:108307865-108307887 CAGAAAAGAAAAAAGGAAGATGG + Intergenic
1074022934 10:109603215-109603237 TAGACAACGGAGAGGGAAGAGGG + Intergenic
1074231584 10:111541968-111541990 AAGAAAATGGATAAAGATGATGG + Intergenic
1074615892 10:115067866-115067888 CAGAAAAGAAGGAAGGAAGAAGG + Intergenic
1074704842 10:116121444-116121466 CCTAAAATGGAAAAGGAAAAAGG + Intronic
1074792826 10:116908871-116908893 CAGTAAATGGAGAAAGAAGTTGG - Intronic
1075051212 10:119183560-119183582 GAGAAAATGTAGAAGAAATAGGG + Intergenic
1075052487 10:119193169-119193191 CAGAAGTTGGAGGAGAAAGAGGG - Intergenic
1075112927 10:119602575-119602597 GTGAAAATAGAGAAGGAAGGAGG + Intergenic
1075224390 10:120613293-120613315 CAAAAAAAGGAGGAGGGAGAGGG - Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075554911 10:123423376-123423398 AAAGAAATGGAGAAGGCAGAGGG + Intergenic
1076558756 10:131347220-131347242 GAGATAAGGAAGAAGGAAGAAGG - Intergenic
1076631397 10:131854300-131854322 GAGAGAAGGGAGAAGGCAGAAGG - Intergenic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078248817 11:9600559-9600581 TGTACAATGGAGAAGGAAGAAGG - Intergenic
1078444744 11:11395693-11395715 AAGAAAAGAGAGAAGGAAGGAGG + Intronic
1078797850 11:14611156-14611178 AAGACAATGGAGAAGGTAAAAGG + Intronic
1078849276 11:15149322-15149344 CAGAAAATTGCGTGGGAAGATGG - Intronic
1078928830 11:15897807-15897829 CAGCAAGCCGAGAAGGAAGAGGG - Intergenic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079347241 11:19663642-19663664 GATAAAATGAAGAAGGAAGGAGG - Intronic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079841719 11:25409992-25410014 CAGACACTTGAGAAAGAAGAGGG - Intergenic
1079844092 11:25442435-25442457 CAGAAAAAGGAGATAGTAGAGGG + Intergenic
1079966351 11:26984828-26984850 CAGAAAGTGGAAAGGGAAGCAGG - Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080496233 11:32823108-32823130 AAGAAAAAGGAAAAGGAAAAAGG + Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081220664 11:40456575-40456597 CAAAAAATGGAGAAAAGAGAGGG + Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1081598555 11:44476102-44476124 GAGAAAAGGGACAAGGAACAAGG + Intergenic
1082069908 11:47930960-47930982 CAGAAAAAGGAGGATGCAGAAGG - Intergenic
1082931005 11:58605067-58605089 CAGAAAATGAAAAGAGAAGATGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083060747 11:59868335-59868357 AATAAAATGGTGAAGGAAGGGGG + Intergenic
1083144117 11:60745734-60745756 CAGAAAAGGAAGAAGATAGAGGG + Intergenic
1083186446 11:61020561-61020583 AAGAAAATGAGGAAGAAAGAGGG + Intergenic
1083224125 11:61273930-61273952 AAGAAACTGGCGAGGGAAGAAGG - Intronic
1083544328 11:63537784-63537806 AAGGAAATAGACAAGGAAGAGGG - Intronic
1083875215 11:65519673-65519695 CAAAAAATGGAAGAGGAAGAGGG - Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1084966968 11:72750094-72750116 TAGGAAATGGGGAAGGAAGGAGG - Intronic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1085227893 11:74939020-74939042 TAGAAAATGTAGAAGGAATGAGG - Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086168949 11:83813564-83813586 CAGAAAATGGAGACTGAGTAAGG + Intronic
1086229200 11:84548190-84548212 CTGGCAGTGGAGAAGGAAGAAGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087139520 11:94751633-94751655 GAGAGAATGGAGTAGGAAGGGGG + Intronic
1087594733 11:100238423-100238445 AAAAAAAAGGAGAAAGAAGAAGG + Intronic
1087932258 11:103991327-103991349 AAGAAGATGGAGAAGGGAGGAGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088042405 11:105403214-105403236 CAGAAAAAGGAAAAAGAAAAAGG + Intergenic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088203748 11:107368040-107368062 AAGAAACTAGAGAAGCAAGAAGG + Intronic
1088681824 11:112249977-112249999 AAAAAAAAGGAAAAGGAAGAAGG + Intronic
1088728685 11:112661653-112661675 CAGACAGTGGAAAAAGAAGAGGG - Intergenic
1088765241 11:112969127-112969149 CATTAGATGGAGCAGGAAGAAGG + Intronic
1089141619 11:116289250-116289272 AAGAAAATGGAGACAGCAGAAGG - Intergenic
1089627312 11:119759619-119759641 GAGAAAATGGAGCAGGAAGAAGG + Intergenic
1089746918 11:120623989-120624011 CGGAAAGGGGAGGAGGAAGAGGG - Intronic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1090072005 11:123551864-123551886 CGAAAAATTGAGAAGGATGATGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090573897 11:128079214-128079236 CAGAAAATGCAGTATTAAGAGGG + Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1091011515 11:132005632-132005654 ATGAAAATGGAAAAGGGAGATGG - Intronic
1091074925 11:132606560-132606582 CAGAAAGTGGAGGTGGGAGACGG - Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091515345 12:1174620-1174642 CAGATGATGGAGTAGAAAGAAGG + Intronic
1091928255 12:4373221-4373243 CAATAAGTAGAGAAGGAAGAGGG - Intronic
1091996304 12:4996785-4996807 GAGAAAAGGGAGGAGGAAGAGGG + Intergenic
1092159356 12:6307575-6307597 CAGTAAATGTGGAAGGAAGGGGG + Intergenic
1092586490 12:9906211-9906233 CAGAAAACCAAGAAGGAAAATGG - Intronic
1092857137 12:12684782-12684804 AAGAAAATAGAGAAGGAAGGAGG - Intronic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1094115334 12:26905503-26905525 CAGAAAATGGAAAAGCCAGCCGG - Exonic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094239458 12:28205193-28205215 GAGAGAAGGGAGAATGAAGAGGG + Intronic
1094363169 12:29651836-29651858 CAGAAAATGAAGAACAAAAAAGG + Intronic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096584727 12:52612499-52612521 CAGAAAGCAGAGAAGGCAGAAGG + Intronic
1096673585 12:53214558-53214580 AAGAAAGAGGTGAAGGAAGAAGG - Exonic
1096730142 12:53603495-53603517 CAGCAAATTTAGAAGGAAGCAGG - Intronic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097493337 12:60297124-60297146 CAGGAAAGGGAGAAGTAAAATGG + Intergenic
1097960927 12:65531420-65531442 CAGAAAAGATAGAAGGAATAGGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098240906 12:68466012-68466034 AAGAAAAGGGGGAGGGAAGAAGG + Intergenic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099195754 12:79613843-79613865 CAGAAAATGGACAAGGCCGGGGG + Intronic
1099909623 12:88813680-88813702 CAGAATATGGAGAAAGACCAGGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100610234 12:96185877-96185899 CTGAAATTGGACAGGGAAGAGGG - Intergenic
1100839558 12:98598672-98598694 CCCAAAATGTATAAGGAAGAAGG + Exonic
1101469354 12:104982183-104982205 CAGAAAATGGAGGTGGTAAATGG - Intergenic
1101709492 12:107251609-107251631 TAGAAAAAGCAGACGGAAGAAGG - Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102260567 12:111440747-111440769 CGAAAGATGGAAAAGGAAGAGGG + Intronic
1102282333 12:111628185-111628207 TAGAAAAGGGAGAAAGAAGCTGG + Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102781285 12:115567201-115567223 CAGAAATATGAGAAGAAAGATGG + Intergenic
1102819254 12:115894094-115894116 AAGAAAATGGATATGAAAGAGGG + Intergenic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102847715 12:116205128-116205150 CAGAAAATGGTGAACAAAAACGG + Intronic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103164306 12:118757105-118757127 AAGAAAGGGGAGAAGGAAGGAGG + Intergenic
1103399977 12:120637225-120637247 CAGAAACTGGAGAGGAAAGCAGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103710939 12:122912192-122912214 CAGAAAAAGGAAAAGCAAGAGGG - Intergenic
1104181943 12:126390307-126390329 AAGAAAATGGAAAAGAGAGAGGG + Intergenic
1104236906 12:126947692-126947714 GAGAAAAGGAAGAAGGAAGCTGG - Intergenic
1104349845 12:128035697-128035719 AAGAAAATGCAGAAAGGAGATGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104781260 12:131422026-131422048 GAGAAAAAGGAGGAGGGAGAAGG - Intergenic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105836082 13:24213096-24213118 GAGAAGTTGGAGGAGGAAGATGG + Intronic
1105984607 13:25553187-25553209 CAGAGAATGGGGGAGGGAGAGGG - Intronic
1106120755 13:26858436-26858458 CAGAAAATGGAGCTGGAGCAGGG + Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106722286 13:32447680-32447702 CAGAAAGTGGAAAAAAAAGAGGG + Intronic
1107193859 13:37623338-37623360 AAAAAAATTGAGTAGGAAGATGG - Intergenic
1107335756 13:39353372-39353394 CAGAAAATGTAGAAGTAAAACGG + Intronic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1108038822 13:46320601-46320623 GAGAAAAAGGACAATGAAGAGGG + Intergenic
1108097058 13:46913643-46913665 TAGAAAATGGAGGAAGGAGATGG - Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1109522136 13:63527523-63527545 CTGAATATGGCCAAGGAAGAAGG + Intergenic
1109555390 13:63968008-63968030 GAGAAAAAGGAGGAAGAAGAGGG - Intergenic
1109665140 13:65524796-65524818 TGGAAGAGGGAGAAGGAAGAGGG - Intergenic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1110025387 13:70531541-70531563 TAGAGAAGGGAAAAGGAAGATGG - Intergenic
1110239863 13:73255018-73255040 GACAAAATAGAAAAGGAAGAAGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110403389 13:75120596-75120618 AAGGAAATGAAGAAGGAAAAAGG + Intergenic
1110541954 13:76716236-76716258 AAGAAAAAGGATAAGGAACAGGG + Intergenic
1110761777 13:79238626-79238648 AAGAAAGAGGAGGAGGAAGAGGG + Intergenic
1111213843 13:85117406-85117428 CAGAAAATGATGCAGGAATAGGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111878208 13:93922093-93922115 AAAAAAATGAAGAAGAAAGAGGG + Intronic
1111996477 13:95170454-95170476 CATGAAATGGAGGAAGAAGAAGG + Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1112612963 13:100974827-100974849 AAGAAGATGGATAAGGCAGATGG + Intergenic
1112667542 13:101593748-101593770 CAGAGACGGGAGGAGGAAGATGG + Intronic
1113392163 13:109908308-109908330 CAGAAAAGAGAGAGAGAAGAGGG + Intergenic
1113429732 13:110239717-110239739 CAGGAAGTGCAGAAGGTAGAAGG + Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113789116 13:113018048-113018070 CAGACAATGGAGGGAGAAGACGG - Intronic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114667846 14:24391019-24391041 CAAAAAGTGGAGGAGGAGGATGG + Intergenic
1114866137 14:26597734-26597756 GAGAGAGTGGAGAAGGGAGAGGG + Exonic
1115055731 14:29124172-29124194 CAGTAAATGCACAAGGAAAAAGG + Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115160179 14:30384944-30384966 CAGAAATTTGAGCAGGAACAGGG + Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1116141176 14:40995874-40995896 TAGAAGATGTAGAAGGAAAATGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116730322 14:48612854-48612876 AAGAAATTGAAGAAGAAAGAAGG + Intergenic
1117124463 14:52606938-52606960 CAGCAAATGCAGCAGCAAGAGGG - Intronic
1117131587 14:52692793-52692815 AAAAAAATGGAGAAAGAAAAGGG - Intronic
1117172718 14:53117148-53117170 CAGAAAATCTAGAAGAAATAGGG + Intronic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1117710325 14:58521718-58521740 AAGAAAATTGAAAAGGAACAGGG + Intronic
1118077318 14:62314248-62314270 AAGAAAATGGAGGAGACAGAAGG + Intergenic
1118425750 14:65659674-65659696 CAGAAAGGGGAAGAGGAAGAGGG - Intronic
1118465098 14:66023671-66023693 GAGACAGAGGAGAAGGAAGATGG - Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118672130 14:68140284-68140306 CAGGAAAAGGAAAAGCAAGATGG - Intronic
1118686103 14:68292669-68292691 CAGAAAGTGGAAAGGGAGGAGGG - Intronic
1119225299 14:72940556-72940578 AAGAAAACGGGGATGGAAGAAGG - Intronic
1119335851 14:73833054-73833076 AAGAAAAGGGAGAAAGAAGGAGG + Intergenic
1119535334 14:75398412-75398434 CAGAAAAGGAAAAGGGAAGAAGG + Intergenic
1119562591 14:75603031-75603053 AAGAGAAGGGATAAGGAAGAAGG - Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119857464 14:77911279-77911301 AGGGAAATGGAGAAGGTAGAGGG - Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1120027302 14:79600863-79600885 AAGAAAATGCAGAAAGAAAAAGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120454074 14:84709166-84709188 CACAGAATGGGAAAGGAAGAAGG + Intergenic
1120605941 14:86578045-86578067 AAGAACATGGGGAAAGAAGAGGG - Intergenic
1120955688 14:90079930-90079952 CTGAAAGTGGAGAAGGAAACAGG + Intronic
1121067660 14:90983644-90983666 AAGAAAAAGAAAAAGGAAGAAGG + Intronic
1121082432 14:91119204-91119226 CAGAAAAGGGAGCAACAAGATGG - Intronic
1121575343 14:94980428-94980450 AAGAAAATAAAGCAGGAAGAGGG - Intergenic
1121906515 14:97751007-97751029 CAGGAACTGGAGAAGGCTGAGGG + Exonic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122572895 14:102719641-102719663 CGGAAAATGCATCAGGAAGAGGG + Intronic
1122754400 14:103966686-103966708 CTAAAATTGGAGAAGGAAAAAGG - Intronic
1123792327 15:23734258-23734280 AAGAAAAAGAAGAAAGAAGAGGG + Intergenic
1124069547 15:26378627-26378649 GAGAAAATGAAGGAAGAAGAAGG - Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125072776 15:35575322-35575344 TAGAAAATGGAGAGGCAAAAAGG + Intergenic
1125387488 15:39153840-39153862 CAGAAAGTGGAGAAGAGAGCAGG + Intergenic
1125478696 15:40065040-40065062 CAGAGATGGGAAAAGGAAGAAGG + Intergenic
1125714054 15:41809254-41809276 TAGGAAATGGAGAAAGAAGGAGG + Intronic
1125786485 15:42322855-42322877 AAGAAAATGGAGAGAGGAGAAGG + Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126342258 15:47654094-47654116 CCTAAAATGAAGAAGAAAGAAGG + Intronic
1126482267 15:49138474-49138496 CAGTAATTGGAGCAGGGAGAGGG - Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128225488 15:65998624-65998646 CAGAAGTTGGAGACGTAAGAGGG + Intronic
1128262510 15:66242433-66242455 AAGAAAAAGAAGAAGAAAGAAGG + Intronic
1128681917 15:69658643-69658665 CAGGAAACAGAGAAGGCAGAAGG - Intergenic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1128768573 15:70265723-70265745 TGGAGAATGGAGAAGGAAGATGG + Intergenic
1128955286 15:71935248-71935270 AAAAAAATGAAGAAGGAAGATGG - Intronic
1128992578 15:72272834-72272856 GAGGCAGTGGAGAAGGAAGAGGG + Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129376545 15:75137334-75137356 GAGAAAATGGAGATGGACGCAGG - Intergenic
1129599275 15:76988828-76988850 CAGAAACAGGATGAGGAAGAAGG - Intergenic
1129683436 15:77671291-77671313 GAGAAGAGGGAGAAGGTAGAGGG + Intronic
1130139325 15:81210576-81210598 AAGAAAATGAATAACGAAGAAGG - Intronic
1130819840 15:87483289-87483311 AGGAAAATGGAGAAAGAAAATGG + Intergenic
1130879182 15:88040456-88040478 CAAAAAATGAAGGAGGAAAAAGG + Intronic
1131224403 15:90611985-90612007 GATAAGAAGGAGAAGGAAGATGG - Intronic
1131252688 15:90840580-90840602 AACAAAATGGACAAGAAAGACGG + Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1131833303 15:96367832-96367854 GAGAAAATTCAGAAGGAAGGGGG + Intergenic
1132474427 16:126566-126588 CAAAGAAGGGAGCAGGAAGACGG + Intronic
1132982206 16:2744051-2744073 CAGAACATGGAGAGGCAACAGGG + Intergenic
1133802213 16:9092583-9092605 CACAAAATGGCGAAGGGAGACGG + Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134898608 16:17913464-17913486 AAGATGATGGAGAAGGAACATGG + Intergenic
1135247395 16:20868796-20868818 AAGAAAAGGCAGAAGAAAGAAGG + Intronic
1135344634 16:21678540-21678562 CAGAAAAAGGAATAGGAAAAGGG - Exonic
1135500341 16:22990671-22990693 CAAAGAAGGGAGAAGGGAGAAGG - Intergenic
1135718745 16:24795918-24795940 CAAAAAAAGGAGAAGGGAAAGGG + Exonic
1136081336 16:27854307-27854329 GAGGAAAAGGAGAAGGAAAAGGG + Intronic
1136403245 16:30029745-30029767 CCACAAATGGGGAAGGAAGAAGG - Intronic
1136958521 16:34815590-34815612 CAGGAAATAGAAAATGAAGAAGG - Intergenic
1137512566 16:49114583-49114605 AGGAAAGTGGAGGAGGAAGAAGG - Intergenic
1137530597 16:49276549-49276571 CAGCAGGTGGAGAAAGAAGAGGG + Intergenic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137572103 16:49573363-49573385 CAGAAAATGGAGTAAGACAATGG - Intronic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137966570 16:52940055-52940077 CAGAAAAGGGAGAAGGCCTATGG - Intergenic
1138218690 16:55229379-55229401 CAGAAAATGGGAAAGAAATATGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138403846 16:56772190-56772212 CAGAAAAAGGATAAAGAACATGG + Intronic
1138618621 16:58193795-58193817 GAGAAAAAGGAGGAGGAAAATGG - Intronic
1138690395 16:58762430-58762452 CAGAAAAAGAAGAATGAAGTTGG - Intergenic
1138754956 16:59472698-59472720 AAGAAAATGAAGAAGAAAAAAGG - Intergenic
1138813071 16:60173503-60173525 GAGAAAATGGAGCATGAAGTTGG - Intergenic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1139057900 16:63208503-63208525 CAGAAAAAGAAGAAAGAAAAAGG + Intergenic
1139193467 16:64891595-64891617 GAAAGAAAGGAGAAGGAAGAGGG + Intergenic
1139256054 16:65544117-65544139 AAGAAAACAGGGAAGGAAGAAGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139494507 16:67306554-67306576 GAGAAAATGGAGAGGCAGGACGG - Intronic
1139541467 16:67620548-67620570 CAAATAATGAAGAGGGAAGAAGG + Intronic
1140193400 16:72837168-72837190 GAGAAAATGGAAAAGGATGAAGG - Intronic
1140204791 16:72924938-72924960 CCAAAAACGGAGAAGGCAGATGG + Intronic
1140345517 16:74209315-74209337 CAGACAAAGGAGAAAGAAAATGG + Intergenic
1140416689 16:74778675-74778697 AAGAGAAGGGAGAGGGAAGAGGG - Intergenic
1140530395 16:75660760-75660782 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140536500 16:75714667-75714689 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140752414 16:78037503-78037525 GAGAGAATGGAGAGGGATGAAGG - Intronic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1140980836 16:80107551-80107573 CAGAGACTGGGAAAGGAAGAGGG + Intergenic
1141028905 16:80571021-80571043 CCCAAAATGGGGAAGGAGGAAGG + Intergenic
1141342839 16:83218947-83218969 CAGAAGATGGAGGAAGAACAAGG - Intronic
1141393603 16:83685073-83685095 TGGGAAATGGAGAAAGAAGAGGG + Intronic
1141471899 16:84244385-84244407 CACAAAATGGAGCAAGAAAAGGG + Intergenic
1141633111 16:85299577-85299599 CAGAGAACGGAGTAGGCAGAGGG - Intergenic
1142109433 16:88323414-88323436 CAGAGAAGTGGGAAGGAAGAAGG - Intergenic
1142154161 16:88525695-88525717 GAGAAAATGGTGACGGAGGAAGG - Intronic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143361138 17:6372227-6372249 GGGAGAAGGGAGAAGGAAGAAGG + Intergenic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1143885912 17:10064678-10064700 GAGCCAATGCAGAAGGAAGAGGG + Intronic
1144415453 17:15042279-15042301 CAGGACATGGAGCAGGGAGAAGG - Intergenic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145825809 17:27876558-27876580 CAGTAAATGGTCAATGAAGATGG + Intronic
1145984364 17:29035199-29035221 GAGAAGAAGGAGAAGAAAGAAGG - Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146370525 17:32263266-32263288 AATAAAAGGGAGAGGGAAGATGG - Intergenic
1146375136 17:32288764-32288786 CAGGAAATGGAGTGGGGAGAGGG - Intronic
1146594620 17:34157618-34157640 CTAAAAATGCAGAAGGAAGGGGG + Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1148453880 17:47800503-47800525 AAGAAAATAGAAAAAGAAGAGGG + Intergenic
1148492672 17:48033388-48033410 CAGAAAGGGGAGAAGGAAATAGG - Intronic
1148511004 17:48169777-48169799 TAGATAATGGAGAAGGAGCAGGG + Intronic
1148520004 17:48264617-48264639 CAGGAAATGGGGAGGGAAAAGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148764390 17:50028738-50028760 GAGAAAATGGAGAGGAAGGACGG - Intergenic
1148851143 17:50555936-50555958 GAGAAATGGGAGAAGGCAGAGGG - Intergenic
1148972821 17:51499259-51499281 CAGAAAATGAAGAAAGACTATGG + Intergenic
1149114081 17:53070629-53070651 CAGAGACTGCAGAAGGAAAATGG - Intergenic
1149343339 17:55709461-55709483 GAGAAAATGAAGAAGGCAGAAGG - Intergenic
1149457258 17:56797986-56798008 TAGAAGATGGAGAGGGAAGGAGG - Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150024530 17:61658938-61658960 CAGAAGATAGGGAAGGGAGAAGG - Intergenic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150182730 17:63142131-63142153 CAGAAAATTAAGAAAGAAGTTGG - Intronic
1150421614 17:65041683-65041705 GAGACAAAGGTGAAGGAAGAGGG + Intronic
1150739150 17:67765656-67765678 CAGATGATGGGGCAGGAAGACGG - Intergenic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150924145 17:69514988-69515010 CAGAAAAAGGCAAAGGAAAATGG - Intronic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151826594 17:76527408-76527430 CAGAAACTAGAAAAGGAGGACGG + Exonic
1151853852 17:76708289-76708311 CAGTTAATGGAAAATGAAGAGGG + Intronic
1152047541 17:77947482-77947504 AGGAAAATCAAGAAGGAAGAGGG + Intergenic
1152853940 17:82653225-82653247 CAGAAAGGGGATAAGGGAGATGG - Intergenic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153185227 18:2478801-2478823 GAGAAAGAGGAGGAGGAAGAAGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153400102 18:4675449-4675471 CCAAGAATGGAGAAGGAAAAAGG + Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153471174 18:5447595-5447617 CAGAAAATGTAGGAGGCATAGGG - Intronic
1153600997 18:6781332-6781354 CAGAAACTGGAACAGGACGAAGG - Intronic
1153711269 18:7802089-7802111 CAGAGAAGGGAGAGGGGAGAAGG - Intronic
1155011419 18:21782459-21782481 CAGAAAAAGCAGTAGTAAGAGGG - Intronic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155996692 18:32338102-32338124 CAAAAAATGCAGACGGAGGAAGG + Intronic
1156629595 18:38951110-38951132 GATAAAATAGAGAAGGAAGGAGG + Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1157034887 18:43959744-43959766 AAGAAAATTGAGAGTGAAGACGG - Intergenic
1157115611 18:44860012-44860034 CAGAGAATGGAAAAGTCAGAAGG - Intronic
1157184285 18:45524837-45524859 GAGAAAATGGGGCAGGAAAAAGG - Intronic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157385819 18:47259578-47259600 TAGAAATTGGAGATGGTAGAAGG + Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157463049 18:47918804-47918826 CAGAAAGTAGAAAAGAAAGATGG + Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157638607 18:49188411-49188433 CAGACAATGGAAAAGGAAAATGG + Intronic
1157912571 18:51631315-51631337 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1158286132 18:55885380-55885402 CAGAAAATAGTGAAGGAAATGGG + Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159200357 18:65175498-65175520 CATAACATGGAAAAGCAAGATGG - Intergenic
1159231539 18:65613385-65613407 GAGAAAAGGGGGAAGGAAGGAGG + Intergenic
1159693956 18:71529697-71529719 CAAAAAATTGAGGAGGAGGAGGG + Intergenic
1159952064 18:74491895-74491917 CAGAAAATGTAGATGGAAGTGGG + Intergenic
1159964064 18:74579170-74579192 AAGGAAAGGGAGAAGGGAGAAGG - Intronic
1160039252 18:75330969-75330991 TAGAAAGAGGAGAAGAAAGAAGG - Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1162127676 19:8508059-8508081 CAGAGAATGGAGAAAGGAGGAGG + Intergenic
1162835485 19:13314490-13314512 CAGAAGGTGGAGGAGCAAGAGGG - Intronic
1163177900 19:15577325-15577347 AAGGAAGTGGGGAAGGAAGATGG - Intergenic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163235650 19:16029021-16029043 AAAAAAAAGGAGGAGGAAGAAGG + Intergenic
1163376376 19:16934733-16934755 CAGAAATTTGGGAAGGTAGAAGG - Intronic
1164146724 19:22517262-22517284 AAGAAAAGAGAAAAGGAAGACGG + Intronic
1164403805 19:27923867-27923889 CAGTTAATGGACAAGCAAGAAGG + Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164680398 19:30130738-30130760 GAGGAAAGGGAGAAGGAAGGGGG - Intergenic
1164838330 19:31373371-31373393 TAGAAAATGAAAAAGGAAAATGG + Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165736483 19:38179596-38179618 CAAAAAAGGGAGAAGGAAATAGG - Intronic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166043495 19:40216631-40216653 GAGCCAATGAAGAAGGAAGAGGG - Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166347964 19:42178047-42178069 GAGGAAAAGGAGAAGGGAGAGGG + Intronic
1166572257 19:43804704-43804726 CAGAAACTGGAGAATCAGGAAGG - Intronic
1167123336 19:47532071-47532093 CTGGAAATGGAGGGGGAAGAAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167507242 19:49877380-49877402 TACAATATGGAGAAGGAAGTGGG + Exonic
1167607426 19:50488915-50488937 AAGAAATGGGAGAGGGAAGAAGG + Exonic
1168225757 19:54993836-54993858 CAGAAGTTGGAGAAGTAAAAAGG - Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
924992112 2:321137-321159 CAGAAAAATGAGAAGTGAGATGG - Intergenic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925053314 2:834228-834250 TAGAACAGGGAGAAGGGAGAAGG + Intergenic
925069330 2:954198-954220 GTGGAAATGGAGAAGGAAGGAGG + Intronic
925115918 2:1378310-1378332 CAGAAACTGGAGAGGGAACCAGG - Intronic
925465063 2:4099960-4099982 GAGAAAATGCATAATGAAGAAGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925781232 2:7383623-7383645 AAAAAAATGGAGAAGGGAGGAGG + Intergenic
926001856 2:9339733-9339755 CAGATAGTGAAGAAGGAAGAGGG - Intronic
926230851 2:11002788-11002810 CAGAGAATGGGTCAGGAAGAGGG + Intergenic
926230949 2:11003446-11003468 CAGAAACTGGAATAGGATGAAGG + Intergenic
926276981 2:11411447-11411469 CAGAATAGTGAGAAGGAAAAGGG - Intergenic
926313133 2:11688892-11688914 CAGTTAATGGTGAAGCAAGACGG + Intronic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926562860 2:14436471-14436493 GAGGAAAGGGAGAAGGGAGAGGG + Intergenic
926654271 2:15383329-15383351 CATAAAAAAGACAAGGAAGAGGG + Intronic
926691277 2:15735716-15735738 GAGAGCATGGAGAATGAAGAAGG - Intronic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928019304 2:27689446-27689468 CAGCAAAGGGAGAAGGAACATGG + Intronic
928096573 2:28408643-28408665 CTGGAAATGGAGAAAGGAGAAGG - Intronic
928109000 2:28491274-28491296 CAGACAATGGAGAAGTAACATGG - Intronic
928200760 2:29246358-29246380 CATAAAATGGAGACAGATGATGG - Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928781895 2:34833350-34833372 GAGAAAAGGTAGAAAGAAGAAGG + Intergenic
928963651 2:36955367-36955389 AAGAAAATCGAGAGGGAGGAGGG + Intronic
929754348 2:44751683-44751705 CAGTAAAGAGATAAGGAAGAAGG - Intronic
929822206 2:45282706-45282728 TGGAAAGAGGAGAAGGAAGATGG - Intergenic
930050742 2:47214423-47214445 CAAAAAAAGAAAAAGGAAGAAGG + Intergenic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
930992072 2:57668321-57668343 GAGAAAATGGAGAAAGGACAAGG + Intergenic
931134616 2:59383671-59383693 CAGACAATTGAGAGGGAAGGAGG + Intergenic
931397711 2:61902553-61902575 TAGAAAATGGACAAGGAAATAGG + Intronic
931503573 2:62898760-62898782 AGGAAAAGAGAGAAGGAAGAGGG + Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931690172 2:64829066-64829088 GGGAAAAGGGAGAAGGAAGTAGG - Intergenic
931959179 2:67462873-67462895 CAGAGGATGGGGAAAGAAGAGGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932117083 2:69061360-69061382 CTGAAATTGGACAAGGAAGAAGG - Intronic
932223778 2:70022869-70022891 AAAAAAATGAAGAAGGAAAAAGG + Intergenic
932435478 2:71700608-71700630 CTGAGAATGGAGAAAGCAGAGGG - Intergenic
932777849 2:74539174-74539196 CGCAAAAAGGAGAAGGAAGTTGG + Intronic
932925488 2:75968849-75968871 AAGAACATAGACAAGGAAGATGG + Intergenic
933461252 2:82588686-82588708 GAAAAAGAGGAGAAGGAAGATGG + Intergenic
933496248 2:83053635-83053657 GAGAAAGAGGAGGAGGAAGAGGG + Intergenic
934535313 2:95128556-95128578 AAGAAAAAGAAGAAAGAAGAAGG + Intronic
934919005 2:98326809-98326831 CAGAAAATGGGGGAGGAATAGGG + Intergenic
935084851 2:99835150-99835172 CGGGAAAAGGAGAAGCAAGAGGG - Intronic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935548284 2:104423894-104423916 CAGAAAACGCATAAGGAAGAAGG - Intergenic
935605454 2:104968651-104968673 TAGAAAATGGAAAAGAAAGGTGG + Intergenic
935728863 2:106048190-106048212 AAAAAAATGAAGAAGGAAGTTGG - Intergenic
935856171 2:107276828-107276850 CAAAGAATGGAGAAGGTTGATGG + Intergenic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938003207 2:127763420-127763442 TAGAAAATAGAGAAGGAACATGG - Intronic
938079544 2:128362457-128362479 CAGTAGATGGAGACGGCAGATGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938143808 2:128817701-128817723 CAGAAAATAGAGAAAGAAACCGG - Intergenic
938325221 2:130393876-130393898 CACAAAACAGAAAAGGAAGAAGG + Intergenic
938847690 2:135227835-135227857 CCAAAAATTGAGAAAGAAGACGG - Exonic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939462299 2:142512876-142512898 TACACTATGGAGAAGGAAGAAGG + Intergenic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
939679387 2:145111583-145111605 AAGAAAATGTAGGAGGAACAAGG + Intergenic
939706822 2:145465172-145465194 CAGGAAAAGAAGAAGAAAGAAGG + Intergenic
939818481 2:146926257-146926279 AAGAAAGAGGAGAAGAAAGAAGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940195638 2:151091411-151091433 CAGGAAATGAAGGAGGGAGATGG + Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940419347 2:153461274-153461296 CAAAAAATGGAGAAGAAATTTGG + Intergenic
940554772 2:155209881-155209903 AAGAAAATGGAAGAGAAAGAAGG + Intergenic
940932738 2:159453917-159453939 TAGAAAATGCAGCAGGAAAAGGG - Intronic
940988199 2:160070939-160070961 AAGAAAATAGAGAAGGTAGCAGG - Intergenic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941281378 2:163555861-163555883 CAAAAAACAGAGAAGGGAGAAGG + Intergenic
941507968 2:166371346-166371368 GATAAAGTGGGGAAGGAAGAGGG - Intronic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941684208 2:168430992-168431014 CAGAATCTGGAAAATGAAGAGGG - Intergenic
941743828 2:169065220-169065242 CACAAAATGGAGAGGGAATACGG - Intronic
941853397 2:170206715-170206737 GGGAAAAGGGAGAGGGAAGAGGG - Intronic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
942339373 2:174927079-174927101 CAGATATTGGGGAAGGAGGAAGG - Intronic
942515227 2:176745658-176745680 CAGAAAACTGAAAAGGAAGAGGG + Intergenic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
942762200 2:179412327-179412349 GAGAAATTGGAGAAGGGGGAGGG - Intergenic
942905854 2:181179815-181179837 CAGGAAATGTAAAAGGAAGTGGG - Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943340677 2:186676976-186676998 AAGAAAAGGGAAAGGGAAGAAGG + Intronic
943425149 2:187722391-187722413 AAAAAAAAGAAGAAGGAAGAAGG - Intergenic
943579585 2:189669727-189669749 TAGAAATTGGGGAAGGAAAAGGG + Intronic
943719050 2:191183655-191183677 CAGTAAATGGGGAAGCAAGAAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944214098 2:197236633-197236655 CATTAAATGGAGAAAGAAAATGG - Intronic
944497164 2:200318763-200318785 CAGACAATGGAAACGGAAAATGG + Intronic
944638340 2:201696371-201696393 TAGAAAATTGAAAAGGGAGATGG + Intronic
944657721 2:201892553-201892575 CAGCAATTGAAGAAGGGAGAAGG + Intronic
944793282 2:203155414-203155436 CAAAAAAAGGAAAAGAAAGAAGG - Intronic
944824637 2:203469195-203469217 GAGTAAATAGAGAACGAAGAGGG + Intronic
944833178 2:203553471-203553493 CAGAAAATGCTGGAGGAAAAAGG - Intergenic
944900992 2:204215984-204216006 AAGAAGATGGAGGAGGTAGAAGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945358915 2:208871856-208871878 GATAAAAGGGAAAAGGAAGACGG + Intergenic
945378750 2:209113059-209113081 GCGAAAGTGGAGAAGGGAGACGG + Intergenic
945405236 2:209439139-209439161 AATAAAATGGAGAACAAAGAGGG + Intronic
945426162 2:209705860-209705882 CAGAAAATCCAGAATGTAGATGG + Intronic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945654427 2:212605702-212605724 AAGAAACTGGAGAAGGGTGAGGG + Intergenic
945777569 2:214126184-214126206 CGGAGAAGGGAGAAGGGAGAAGG + Intronic
945779152 2:214146335-214146357 CTGAAATGGGAGAAAGAAGAAGG + Intronic
945950576 2:216035197-216035219 GAGACATTGGAGGAGGAAGAGGG + Intronic
946035209 2:216736562-216736584 CACCAAATTGAGAAGGAAGGGGG + Intergenic
946049750 2:216852621-216852643 CAGAAAATGGGGTACGAAGGAGG - Intergenic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946823664 2:223655160-223655182 CAGAAAAGGGAGAAAGAATAGGG - Intergenic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
946994366 2:225374374-225374396 GTGAAAATAGAGAAAGAAGAAGG + Intergenic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947348358 2:229217475-229217497 CAGAAAATGGAGAGAGATGGAGG + Intronic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
947478201 2:230471250-230471272 CAGAAAAATGAGAAGTGAGAAGG + Intronic
947690538 2:232132150-232132172 GGGAAAAGGGAGAAGGGAGAGGG - Intronic
947761014 2:232604073-232604095 AAGAAAATCAAGAAGGAAGGAGG - Intergenic
947878611 2:233485391-233485413 CAGAGAATGGATAAAAAAGAGGG - Intronic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
949072444 2:242033675-242033697 CAGAAAATGGGCTAGGAGGAGGG - Intergenic
1169054719 20:2611169-2611191 CAGACATTGGAAAAGGCAGAGGG + Intronic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1169300144 20:4435106-4435128 AAGAAAATGGAGTGGGAAGAAGG + Intergenic
1169553907 20:6729829-6729851 AAGAAAATAGAGAAGACAGAAGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170412631 20:16107573-16107595 CAGCATGTGGAAAAGGAAGAAGG + Intergenic
1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG + Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171951449 20:31426265-31426287 GAGAAAAGGGAGAGGGGAGAGGG - Intergenic
1171997083 20:31739754-31739776 CAGAAACTGAGGAAGGAGGAAGG + Intronic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172999252 20:39093650-39093672 CAAAATGTGGAGAAAGAAGAGGG + Intergenic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173227191 20:41168842-41168864 CAGAATGTGGAGAAGCAAGAGGG + Exonic
1173299293 20:41786871-41786893 CAGAAATTGGGGAAGGTAGAAGG - Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173460602 20:43240226-43240248 CAGAAAGTGGAGAAAGTATATGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173858290 20:46265307-46265329 GAGAAAGAGGAGGAGGAAGAGGG - Intronic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174660538 20:52209149-52209171 GAAAAAAGGGAGAAGAAAGAAGG + Intergenic
1174681468 20:52412810-52412832 CAGAAAATGGACTAAGAAAATGG + Intergenic
1174720644 20:52808427-52808449 GAGAAAGAGGAGGAGGAAGAGGG - Intergenic
1174831135 20:53813275-53813297 GAGAAAATGGTGAGAGAAGAAGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175298804 20:57928504-57928526 GAGAAAAGGGAGGAGGAAGGGGG - Intergenic
1175298817 20:57928537-57928559 GAGAAAAGGGAGGAGGAAGAGGG - Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175522567 20:59611558-59611580 CAGCAAATGGTGGAGGAAGGAGG + Intronic
1175564017 20:59958558-59958580 CTGAAAAGGGAGGAGCAAGATGG + Exonic
1175616175 20:60400693-60400715 CAGAAAATGGATAAGTGACAGGG - Intergenic
1175642693 20:60644043-60644065 AATAAAATGGAGAGGCAAGAAGG + Intergenic
1176293372 21:5058129-5058151 CAGAAAACCCAGAAGGGAGATGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177168611 21:17630636-17630658 AAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1177294919 21:19161593-19161615 GAAAAAATGAAGAAGGATGATGG - Intergenic
1177350684 21:19937293-19937315 CAAAAAATGGAGTATGTAGAAGG + Intergenic
1177403184 21:20632724-20632746 GAAAAAATAGAGAGGGAAGAGGG - Intergenic
1177516193 21:22154272-22154294 AAGAAACTGGACAAAGAAGAAGG - Intergenic
1177681688 21:24379448-24379470 CAGAAAAAGGTTAAGGGAGAAGG - Intergenic
1177718819 21:24877779-24877801 CAGAAAGTAGAGAGGCAAGAAGG + Intergenic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178566026 21:33686542-33686564 CTGAAAATGGAGAGGCCAGAAGG - Intronic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179116691 21:38499778-38499800 GAAAAAATGGAGAAGGAGAAAGG + Intronic
1179174676 21:38999852-38999874 CAGAAGATGGATAAGGACAAGGG - Intergenic
1179283977 21:39960366-39960388 CCCAAAAAGGAGAAGAAAGAGGG - Intergenic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179396218 21:41042817-41042839 AAGAAAAATAAGAAGGAAGACGG - Intergenic
1179826864 21:43971192-43971214 CAGAGAATGGGGAAAAAAGAGGG + Intronic
1179863888 21:44205519-44205541 CAGAAAACCCAGAAGGGAGATGG - Intergenic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1180867059 22:19125754-19125776 CACAAACCAGAGAAGGAAGACGG + Intergenic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181494364 22:23279631-23279653 GAGGAAGTGGAGAAGGAAGACGG - Intronic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182403539 22:30103620-30103642 CAGAAAAAGAAAAAGAAAGAGGG - Intronic
1182603379 22:31484942-31484964 CAGTACATAGACAAGGAAGAAGG + Intronic
1182679872 22:32070308-32070330 CAAAGAAAGTAGAAGGAAGAAGG - Intronic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1183021723 22:35032837-35032859 AAGAAAGTGGAGAAGGGGGAGGG + Intergenic
1183546882 22:38459073-38459095 GAGAGAATGGAGAATGGAGATGG - Intergenic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
1185159655 22:49215567-49215589 GAAAAAAATGAGAAGGAAGAAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949376124 3:3392304-3392326 AAGAAAAAGGCAAAGGAAGATGG + Intergenic
949614303 3:5737053-5737075 GAGCAAATGGAGAAGGATGCAGG + Intergenic
949641755 3:6043839-6043861 AAGCAAAGGGAGCAGGAAGAAGG + Intergenic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
949900270 3:8808531-8808553 CACAAAAGCTAGAAGGAAGAAGG + Intronic
949996906 3:9625110-9625132 CAGAAAGTGGAGACAGAAGAGGG - Intergenic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950352470 3:12369940-12369962 GAGAAAATGCAGGAGGAAGAAGG - Intronic
950704877 3:14773442-14773464 AAGAAGATGGAGGAGGGAGAAGG + Intergenic
950850176 3:16054747-16054769 CAGATAAAGGAGAAAGAAAATGG - Intergenic
950898623 3:16476190-16476212 CTCAAGATGGAGAAGGCAGAGGG + Intronic
950979974 3:17292121-17292143 GATAAAAGGGAGTAGGAAGAAGG + Intronic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951640970 3:24834966-24834988 CAGAAAGTGAAGAAAGAAAAAGG - Intergenic
951781207 3:26364685-26364707 CAAAACAGGGAGAAGGAAAAAGG - Intergenic
951884733 3:27513256-27513278 AAGAAAATGGAGGAAGAAGCTGG + Intergenic
951934006 3:28001702-28001724 GAGAAACAGGAGCAGGAAGAGGG + Intergenic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
952482532 3:33776245-33776267 GAGAAAGAGGAGAAAGAAGAAGG - Intergenic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
953027261 3:39152468-39152490 CAAGATGTGGAGAAGGAAGAGGG + Intronic
953078081 3:39589675-39589697 AAGAAAATGGAGGATGAAAATGG + Intergenic
953094487 3:39761544-39761566 CAGAAAAGGGCTAAGGAAGGCGG + Intergenic
953124647 3:40078950-40078972 GTGAAACTGGAGAAGGAAGAGGG - Intronic
953287518 3:41626882-41626904 CAGAAAATAGAGAAAGACCAAGG - Intronic
953417621 3:42732009-42732031 CAGTAAAGAGAGCAGGAAGATGG - Intronic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
953784158 3:45897755-45897777 CAGACAAGGAAGAAAGAAGAAGG - Intronic
953801601 3:46028158-46028180 CAGACACTGGAGAGTGAAGAAGG - Intergenic
953850169 3:46459924-46459946 CATGAAATGGAGAGGGAAGGAGG - Intronic
953903684 3:46857648-46857670 AAAAAAAGGGGGAAGGAAGAAGG + Intergenic
954093904 3:48307461-48307483 ATGAAAATGGAGAAAGAAGAGGG - Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954520817 3:51224679-51224701 GAGAAAATGGCAAAGGAAAATGG - Intronic
955062831 3:55507938-55507960 AAGAAAAGGGAGAAAGAAAAAGG + Intergenic
955094275 3:55781887-55781909 AAAAAAACGGAAAAGGAAGAGGG + Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955206447 3:56900012-56900034 CCCAAAAAGGGGAAGGAAGAAGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955713710 3:61806419-61806441 CAGAACCTGGATAAGGATGATGG - Intronic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
955993192 3:64650509-64650531 GAGAAAAGGGAGAGGGAAGAGGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956259651 3:67324809-67324831 TAGGAAATGGAAAAAGAAGATGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956633243 3:71336865-71336887 CAGGAGATAGAGAAGGCAGAGGG + Intronic
957538188 3:81533002-81533024 CAATAAATGGAAAAGGAACAAGG - Intronic
957666770 3:83241972-83241994 CTGGAAATTGAGGAGGAAGAAGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958047445 3:88303172-88303194 GAGAGAAGGGAGAAGGGAGAAGG - Intergenic
958430419 3:94033551-94033573 TAGTAAATGCAGAAGGAATATGG + Intronic
958479506 3:94628537-94628559 CAGAAAGCTGAGAAGGAAGTAGG + Intergenic
958952094 3:100427720-100427742 AAGAAAATGGAAAAGGCATATGG + Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959150269 3:102599548-102599570 CAGAAAATGAATAAGGGTGAGGG - Intergenic
959235301 3:103713824-103713846 AAGAAAATAAAGAAAGAAGAGGG + Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959554904 3:107705532-107705554 CAGAAACTGAAAAAGAAAGATGG - Intronic
960025666 3:113006420-113006442 CAGGAAATGAACAAGGAAAAAGG + Intronic
960212276 3:114984436-114984458 CAGAAAATGGTGACGGAGCAGGG - Intronic
960223401 3:115143860-115143882 CAGAAGTTTGAGAAGGAGGAAGG - Intronic
960272455 3:115689771-115689793 TAGAAAATGGAGAAAAAAGTGGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960603938 3:119485836-119485858 CTGAAAATGAAGAAGGGAGCAGG + Intronic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961348706 3:126284363-126284385 CAGAATGTGGAGGTGGAAGATGG - Intergenic
961745827 3:129062887-129062909 GAGAAAAAGGAGAGAGAAGACGG - Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961983998 3:131113259-131113281 TAGAATATGGAGAGAGAAGAAGG + Intronic
962208490 3:133455804-133455826 GAGAAATTGGACAAGAAAGACGG - Intronic
962276377 3:134017758-134017780 GAGAAGAGGGAGAATGAAGAGGG + Intronic
962308574 3:134310206-134310228 GAGAAAAGGGAGGAGGAAGGGGG + Intergenic
962462590 3:135628371-135628393 CAGGAAGTGGGGAAGGAGGAAGG - Intergenic
962464273 3:135642196-135642218 GAGAAAATGGAGGAGGGGGAGGG - Intergenic
962497646 3:135958151-135958173 CAGCAAATGTAGTAGGAAGAGGG - Intergenic
963235804 3:142954438-142954460 CATAAAATGCAGCAGGCAGAAGG - Intronic
963248276 3:143082860-143082882 AAGGAAATGGGGAAGGAAGAAGG - Intergenic
963441820 3:145349574-145349596 TAGAAAATTGAGAAGCAAGCAGG + Intergenic
963659178 3:148102908-148102930 CAGAAAAAAGGAAAGGAAGAAGG - Intergenic
963688225 3:148464943-148464965 AAGAAAATGAAGAGGAAAGAGGG - Intergenic
963708850 3:148722742-148722764 CAGAAAACAGAGACGGAAAATGG - Intronic
963749889 3:149165763-149165785 CAGATAATGGGGAAGGGAGTGGG - Intronic
963769891 3:149378936-149378958 CAGAAAATAGAAAAGGACCAAGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964346971 3:155763754-155763776 TAAAAAAAGGAGAAGGAATATGG - Exonic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
964565347 3:158044796-158044818 CAGAAAATGGAAAAGGTAAGTGG + Intergenic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
965149675 3:164954106-164954128 TAGAAATTGAAGTAGGAAGAGGG - Intergenic
965367224 3:167815688-167815710 AAGAAAATGGACAAATAAGAAGG - Intronic
965424620 3:168506592-168506614 GAGAAAATGGTTAAGGAGGAAGG - Intergenic
965545833 3:169915501-169915523 AGGAAAAAGGAGAAGGAAAAAGG - Intronic
965783525 3:172313061-172313083 GAGAAAAAGGGGAAAGAAGAGGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966027607 3:175304327-175304349 AAGATAATGGAAAAGAAAGAAGG - Intronic
966071254 3:175881204-175881226 CAGGAAAAGGAGAAAAAAGAGGG - Intergenic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
966574709 3:181487410-181487432 TGGCTAATGGAGAAGGAAGAAGG + Intergenic
967112273 3:186304365-186304387 GAGAGAATGAAGCAGGAAGAAGG - Intronic
967251116 3:187539842-187539864 GAGAAAGGGGAGGAGGAAGAGGG + Intergenic
967278867 3:187803211-187803233 AAGAAACTGGAAAAGGAAAAAGG + Intergenic
967316863 3:188157966-188157988 TGGAAAATGGAGAAAGAAGAGGG + Intronic
967732056 3:192916340-192916362 AAGAAAACCTAGAAGGAAGAAGG + Intronic
968360345 3:198142670-198142692 CATAAAGTGGAGAAGGAGCAGGG - Intergenic
969096467 4:4736265-4736287 TGGAAAATGAAGAAGGAAGTTGG + Intergenic
969154815 4:5201269-5201291 CAGAAACAGGAGAAGGGACAAGG - Intronic
969202393 4:5616300-5616322 CAGAAAGGGCTGAAGGAAGAGGG + Intronic
969353466 4:6611526-6611548 AAGAAAATGGAGAAGATACAGGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970110100 4:12628235-12628257 TAGTAAAGGGAGAAGGAAAAAGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970855251 4:20643933-20643955 GAGAGAATGGAGAAGTGAGAGGG + Intergenic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971106095 4:23525252-23525274 CAGAACATTGAGAGGGAACATGG + Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971145998 4:23976959-23976981 GAGGAAAAGGAAAAGGAAGAAGG + Intergenic
971189708 4:24415629-24415651 CAGAACACTGAGAAAGAAGAGGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971234547 4:24829416-24829438 CAGAAGATGGAGAAAAAAGATGG + Intronic
971340462 4:25764026-25764048 TAGCAAATGTAGAAGGAATAAGG + Intronic
971675122 4:29616656-29616678 TAGAAAATGAAGAAGGCATAGGG - Intergenic
972064811 4:34928307-34928329 AAGGAAATGGAGAAAAAAGAAGG + Intergenic
972210623 4:36832139-36832161 GAGAAGATGGAGTAGGATGAGGG - Intergenic
972238284 4:37159971-37159993 CTAAAAATGGAGAATGAATAAGG - Intergenic
972257178 4:37369708-37369730 AAGAAAATGCAAAAGGTAGAGGG + Intronic
972263224 4:37432836-37432858 AAGCAAATGAAAAAGGAAGAGGG + Intronic
972316344 4:37929875-37929897 AAGAAAAAGGAGGAGAAAGATGG + Intronic
972353362 4:38258365-38258387 CAGGAAATGAAGAAGGCAGAGGG - Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972840753 4:42927752-42927774 CAGAAAATAGAGTAGAAATATGG + Intronic
973570204 4:52231111-52231133 CAGAAAAGAGAAGAGGAAGAAGG + Intergenic
973643414 4:52925979-52926001 CAGTAAATGGAGAAGAGTGAGGG - Intronic
973835323 4:54803648-54803670 TGGAAAATGGAAAATGAAGAGGG - Intergenic
973936296 4:55850210-55850232 CAGCAGATGGAGAAGCCAGAAGG + Intergenic
974106588 4:57476619-57476641 CAGAAAATGTAGAAAGGATATGG + Intergenic
974212359 4:58795583-58795605 CTGTAAATTGAGAAGAAAGAAGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974292621 4:59952457-59952479 CAGAAAAAGGTGAAGAGAGATGG - Intergenic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
974919925 4:68226082-68226104 GAGAAGATGGAGGAGGTAGATGG - Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
975445459 4:74459034-74459056 AAAAAAATGAAGAAGGAAGGAGG - Intergenic
975523784 4:75327796-75327818 AAGACAATGCAGCAGGAAGAAGG - Intergenic
976168748 4:82282411-82282433 AAAAAAATGGAGGAGGAGGAAGG + Intergenic
976323092 4:83738162-83738184 TAGAAAATGAATAATGAAGACGG + Intergenic
976433798 4:84993813-84993835 CAAAAAATAAAAAAGGAAGAGGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
976835814 4:89372035-89372057 CAAAAAATGGAGACAAAAGAAGG - Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
977609421 4:99016935-99016957 AAGAAAATACAGAAGGGAGATGG - Intronic
977815789 4:101412248-101412270 CCGAAAATGGAGGAGAAACAAGG + Intronic
978059030 4:104312925-104312947 CAGAAAAAGCAGAACTAAGAGGG + Intergenic
978367217 4:107995045-107995067 CAGATAAGAGAGAAGGGAGAGGG - Intronic
978591905 4:110332923-110332945 CAATAACTGGAGAAGGCAGAGGG - Intergenic
978609690 4:110523732-110523754 CAAAAAAAGGACATGGAAGAGGG + Intronic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979021348 4:115502815-115502837 CAGAAGATGGAGATGGTAGGAGG - Intergenic
979292529 4:118993566-118993588 AGGAAAGTGGAGAAGGAAGGAGG - Intronic
979384517 4:120048835-120048857 AAGAAAATAGAAAAGAAAGAGGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979451939 4:120882449-120882471 GACAAAATGAAGATGGAAGAAGG - Intronic
979518919 4:121643588-121643610 CAGAAAATGGAAATGGGAAAAGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
979860078 4:125682805-125682827 CAGAAGATGGGGAAGCCAGAGGG + Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980232326 4:130060942-130060964 CAGAAAGGGGAGAAGAAATAGGG - Intergenic
980948406 4:139346870-139346892 CAGAAAAGGTAGAAGATAGAGGG + Intronic
981092129 4:140742839-140742861 GAGAAAAGAGAGAAGAAAGAAGG + Intronic
981184622 4:141786349-141786371 AGGGAAATGGAGAAGTAAGATGG + Intergenic
981227878 4:142318230-142318252 GAGAAAATGAAGAGGAAAGAGGG + Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981239145 4:142454118-142454140 AAGAAGATGGGAAAGGAAGAAGG - Intronic
981274997 4:142888772-142888794 CAGCTAATGAATAAGGAAGAGGG + Intergenic
981340084 4:143611531-143611553 CAGAAATATGAGAAGGAACAGGG + Intronic
981341611 4:143628110-143628132 GAAAAAATGGAGGAGGCAGAGGG - Intronic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981562598 4:146063931-146063953 AAGGAAATGAGGAAGGAAGAAGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982035845 4:151344939-151344961 GAGAAAATCAAGAAGGAAGAAGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982340476 4:154293075-154293097 CAGCCAAGGGTGAAGGAAGAGGG - Intronic
982926245 4:161340298-161340320 TAAAAAATGTAGAAGGAAGGGGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983498124 4:168467787-168467809 CAGAAAATAGAAGAGGAAAATGG + Intronic
983552567 4:169032466-169032488 AGGAAAAGGAAGAAGGAAGAGGG - Intergenic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
984883197 4:184428353-184428375 AGGAATTTGGAGAAGGAAGAGGG + Intronic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986023933 5:3831935-3831957 CAGAAAATGTAGTAAGTAGATGG + Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986143542 5:5054682-5054704 AAGAAAAAGAAGAAAGAAGAAGG + Intergenic
986233961 5:5890609-5890631 CAGAAAATGAAGAAAGGAGTGGG + Intergenic
986472737 5:8092182-8092204 GACAAGATGGAGAAGGCAGATGG + Intergenic
987042081 5:14072394-14072416 GTGAAAATGGAGATAGAAGATGG - Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987190887 5:15477204-15477226 GAGAAGAGGGAGAAGGAAAATGG - Intergenic
987542001 5:19268110-19268132 AAGAAACTGGAGAAATAAGAAGG + Intergenic
987569011 5:19630889-19630911 CAAATAATGGCTAAGGAAGAAGG + Intronic
988284962 5:29201661-29201683 GAGAAAACAGAGAAGCAAGAAGG + Intergenic
988337986 5:29930864-29930886 GAGAAAAATGAGAAGGAAAAAGG - Intergenic
988464947 5:31480853-31480875 AAGAAAGGAGAGAAGGAAGATGG + Intronic
988658979 5:33243582-33243604 CAGTATGTGGAGAAGAAAGAAGG - Intergenic
988868068 5:35357145-35357167 GACAAAATGGAGAAGAAGGAGGG - Intergenic
989136767 5:38163574-38163596 AAGAAAATACAGAAGGGAGAGGG - Intergenic
989249551 5:39294048-39294070 CAGAAAAGGCAGTAGTAAGAGGG + Intronic
989258441 5:39392266-39392288 CAGAACTTTGAGAACGAAGAAGG + Intronic
989332297 5:40274370-40274392 CAGAAAGTGGAGGCTGAAGAGGG - Intergenic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
990153675 5:52849464-52849486 ATGAAAATGAAGAAGGAAAATGG + Exonic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990540109 5:56764124-56764146 CAGGAAATGGAGAAGAAATGTGG - Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
990979847 5:61592722-61592744 AAGAAAATGGTGAAGGATGCTGG + Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991613279 5:68469979-68470001 CTGAAAATGGAGAATCATGAAGG - Intergenic
991748249 5:69769177-69769199 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991799829 5:70349022-70349044 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991828768 5:70661016-70661038 CTTAAAAAGGAGAAGGAAAAAGG + Intergenic
991892187 5:71348453-71348475 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
992089494 5:73304346-73304368 CAGAAAATCGGAAAGGCAGAAGG + Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992253166 5:74895902-74895924 CAAACAATAGAGAAAGAAGAAGG - Intergenic
992263642 5:74995234-74995256 TAGAAAATGGACAAAGAATAGGG - Intergenic
993239869 5:85368756-85368778 CAGACACTGGAGAATGAACAAGG - Intergenic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
993552024 5:89285036-89285058 GAGAAAATGGATGAGGGAGAAGG - Intergenic
993601584 5:89932569-89932591 CATAAAATTGAGAGAGAAGAAGG + Intergenic
993659421 5:90613259-90613281 CACAAAATGGAAGAGGGAGAAGG - Intronic
993765362 5:91849596-91849618 CAGAAAAAGGAAAAGCAAGATGG - Intergenic
994079317 5:95688712-95688734 CAGAAAGGTGAGAAGGTAGAAGG + Intronic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994279103 5:97878674-97878696 AAGAAAATAGAGACAGAAGAAGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
994970630 5:106731807-106731829 CAGAATATGGATAAGAATGAAGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995654846 5:114414083-114414105 CAGAAAATCCAGCAGGAAGTAGG - Intronic
995663229 5:114509942-114509964 CAGAAAAAGAAAAAGAAAGACGG + Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
995868979 5:116724542-116724564 CAGCAAATGGGGCAGCAAGAAGG - Intergenic
996063045 5:119052860-119052882 GTGAAAATGTAGAAGGCAGAGGG + Intronic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996109672 5:119550433-119550455 AAGCAAAAGGAGAAGGAAAAAGG + Intronic
996361195 5:122649109-122649131 CAGAAAATAAAGAAGAAATATGG - Intergenic
997022939 5:130023333-130023355 CAGAAATTACATAAGGAAGAAGG + Intronic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
997875976 5:137547390-137547412 GAGAAAATGGCAAAGGAACAAGG + Intronic
998265957 5:140668075-140668097 CTGAAAATGGAGAAATGAGATGG + Intronic
998706201 5:144764316-144764338 CAGACAAGAGAGAAGGTAGATGG - Intergenic
998735571 5:145136096-145136118 CAGAGACTGGAGAGGGTAGAGGG - Intergenic
998778386 5:145628966-145628988 CAGAAAATGGGCAAGGAAGGTGG + Intronic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999450008 5:151670890-151670912 CTGAAGATGGAGAAGCCAGATGG + Intronic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
999972949 5:156883187-156883209 GAGACAGTGGAGAAGGAAGCAGG + Intergenic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000026742 5:157365306-157365328 CAAAAAATGGAAAAGTAAAATGG - Intronic
1000096483 5:157975591-157975613 CAGCAAATGGAAAAAGAAGGTGG - Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000636339 5:163647926-163647948 AAAAAAATGGAAAAGGAGGAAGG - Intergenic
1000749505 5:165076096-165076118 TAGAAAATGGAGAAAGAATTTGG + Intergenic
1000831876 5:166111982-166112004 AAGATAAAGGAGAAGGCAGAAGG - Intergenic
1000867220 5:166528609-166528631 AACAAAATGGATAAGGAAAAGGG + Intergenic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1001107216 5:168864878-168864900 TAGAAAATGGATAAGGACGGTGG + Intronic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001224537 5:169932409-169932431 GAGAGAATGGGGAAGGAAGATGG + Intronic
1001281344 5:170388555-170388577 GAGAAGATGGAGAAGGACAAAGG + Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001770935 5:174295277-174295299 AAGAAATAGGAGGAGGAAGAGGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002380198 5:178822142-178822164 CAGAAAATTAACAAGGAAGCTGG - Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003199282 6:3943992-3944014 CAGCAAAGGGAGGAGAAAGATGG + Intergenic
1003256162 6:4476741-4476763 AAGAAAATTTAGAGGGAAGAAGG - Intergenic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003951132 6:11116803-11116825 CAGAATATGGACAAGCAATAGGG - Intronic
1003957054 6:11173846-11173868 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1004126738 6:12881576-12881598 GATGAAATGGAGAGGGAAGAGGG - Intronic
1004170837 6:13294452-13294474 AAGAAAATGGTGCATGAAGATGG - Intronic
1004595863 6:17099129-17099151 CAGAAAATAGAAAAGAAAAATGG - Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1005433405 6:25782213-25782235 CAGTAAGTGGAGAAAGAAAAAGG + Intergenic
1005551732 6:26926231-26926253 CAGAAAGTGGAGAATCAATATGG + Intergenic
1006054428 6:31372487-31372509 CCCAAAAGAGAGAAGGAAGAAGG + Intergenic
1006113207 6:31761300-31761322 GGGAAAATGGAGGAGGATGAAGG + Intronic
1006146021 6:31960217-31960239 CAGAAAATGGCAGAGGAAGACGG + Exonic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006744129 6:36329862-36329884 GAGAAAAGAGAGAAAGAAGAAGG + Intronic
1006798305 6:36744463-36744485 CAGAAAAGGGGGTAGGGAGAGGG + Intronic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1006912964 6:37576007-37576029 CAGAAAACAGACAAAGAAGAAGG - Intergenic
1006947807 6:37797068-37797090 CAGACAAGGGAGAAGGCAAAAGG - Intergenic
1007271215 6:40638629-40638651 CAGAAAATGAATAAGGGAGAAGG + Intergenic
1007394564 6:41570219-41570241 AAGAAAAAGGAGAATGCAGAAGG - Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008201952 6:48601618-48601640 CAGAAAAAGGAACAGAAAGATGG - Intergenic
1008242080 6:49126292-49126314 AAGAAAATGGGGAAGTCAGAAGG + Intergenic
1008261495 6:49371076-49371098 TAGAAAGTGGAGAGGGAAAATGG + Intergenic
1008779781 6:55089650-55089672 AAGAGGATGGAGGAGGAAGAAGG - Intergenic
1008978689 6:57457917-57457939 AAGAAAATGAACAAGGAAGATGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009166824 6:60350876-60350898 AAGAAAATGAACAAGGAAGATGG - Intergenic
1009404183 6:63291948-63291970 CAGAAAAGGGATGTGGAAGAAGG + Intronic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1010050229 6:71495408-71495430 CAAAGAATGGGGAAGGAAGGTGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010899468 6:81408409-81408431 CAGATGATGGAAATGGAAGAAGG - Intergenic
1011125420 6:84002386-84002408 CAGCAAATGGGGAAGGAAGAGGG - Intergenic
1011285217 6:85715576-85715598 CAGACAATGGAGAGTGAACAAGG + Intergenic
1011509341 6:88082735-88082757 CAGAAAATTGAGTAAGAGGATGG + Intergenic
1011521017 6:88206443-88206465 GAGAATATGGAGAATGCAGAGGG + Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1011801605 6:91022178-91022200 CAGAAGATGGGGAAGCCAGAAGG - Intergenic
1011896558 6:92234421-92234443 CAGATCATGAAGAAGGAAAAGGG - Intergenic
1012051948 6:94357880-94357902 GAGGAAATGGAGAAGGAAAAAGG - Intergenic
1012198250 6:96372184-96372206 GAGGAAATGGAGAAGGATTAAGG + Intergenic
1012362640 6:98402703-98402725 CAGATAATGGAGTTGGAAAATGG - Intergenic
1013033371 6:106357921-106357943 AAGAAAAGGGAAAGGGAAGAAGG - Intergenic
1013272256 6:108556193-108556215 GAAGAAATGGAGAAGGAACAAGG + Intergenic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1014014785 6:116517818-116517840 CAGACCTTGGGGAAGGAAGAGGG + Exonic
1014030558 6:116697418-116697440 TAGAAAAATGAAAAGGAAGAAGG + Intronic
1014380446 6:120734234-120734256 GAGAAACTGAAGAAGGAACAGGG + Intergenic
1015002087 6:128230161-128230183 CAGGAAATGGAGAGGAAAGAGGG + Intronic
1015197355 6:130537755-130537777 CAGAGAACTGAGAAGGAACATGG + Intergenic
1015354003 6:132255608-132255630 CCAAAAATGAAGAAGAAAGAGGG - Intergenic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016290618 6:142525132-142525154 TAGGAAAAGGAAAAGGAAGAAGG - Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016681438 6:146833650-146833672 GAGATAATAGAGAAGGCAGAAGG + Intergenic
1016833486 6:148455073-148455095 GAGGGAATGGAGAATGAAGATGG + Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017095333 6:150799855-150799877 CGCAAAATGTAGAAGGAAGCAGG - Intronic
1017147144 6:151244627-151244649 ATGGAAATGGAGAACGAAGATGG + Intronic
1017268316 6:152477353-152477375 CAGAAAAGGGTGGATGAAGAGGG + Intronic
1017744418 6:157434129-157434151 AAGAAAATAGAGAAGAAAAACGG + Intronic
1017781469 6:157718865-157718887 GAGAAAAGAGAGGAGGAAGAAGG - Intronic
1018164856 6:161083690-161083712 AAGAAAATGGAAAAGGCGGAAGG - Intronic
1018299740 6:162388726-162388748 CAGATACTGGAGAAGAGAGAGGG - Intronic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1018490673 6:164289403-164289425 CAGAACATGGAAAAGCAAAATGG - Intergenic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019259657 7:73962-73984 CATAAAGTGGAGAAGGAGCAGGG + Intergenic
1019574658 7:1731345-1731367 CAGAAAAGGGAGAATGATGAAGG + Intronic
1019860448 7:3653585-3653607 CAGGAAATGGAGAGGGAAGGAGG + Intronic
1019937738 7:4267331-4267353 GAGAAAAGGAAGAAGGAATAGGG - Exonic
1020059722 7:5143410-5143432 GAGAAAATTGAGTAGGGAGACGG - Intergenic
1020500107 7:8907566-8907588 CATAAAGTGGAGATGGCAGAAGG - Intergenic
1020565983 7:9796158-9796180 CATAAAATGGAGGAAGAGGAAGG - Intergenic
1020571344 7:9866954-9866976 AAGAAAATTCAGAAGAAAGACGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020665231 7:11032892-11032914 CAGGTAATGGTTAAGGAAGATGG + Intronic
1020919828 7:14249377-14249399 CAAAAAATGGAAGAAGAAGAAGG - Intronic
1021035737 7:15795794-15795816 TAGAAAATGGAAATGGAAGATGG + Intergenic
1021372891 7:19871957-19871979 CACAAACTGGAGAGGGGAGATGG - Intergenic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1022037809 7:26550568-26550590 AAGAAAAATGAGGAGGAAGAGGG + Intergenic
1022313942 7:29226876-29226898 TACAAAATGGAGAATGAAAAAGG + Intronic
1022320988 7:29287311-29287333 GAGAAAGTGGAGATGGGAGATGG + Intronic
1022399095 7:30018964-30018986 TAGAAAGAGGAGTAGGAAGAAGG + Intronic
1022955167 7:35374067-35374089 AAGACAGAGGAGAAGGAAGAGGG - Intergenic
1023160223 7:37289753-37289775 GAGAAAATAGAGAAGATAGAGGG - Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023552184 7:41382271-41382293 GAGAAAATGGAAAAGGAAGGAGG - Intergenic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023664209 7:42504248-42504270 CATAAAATGGAGAGGGTATAGGG - Intergenic
1023740586 7:43277663-43277685 TGGTAAATGGAGAAGGAAGTGGG - Intronic
1023800999 7:43834750-43834772 CAGGAAAAGGAAAAGGAAAAGGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024364619 7:48506905-48506927 CATATAATAGAGAAGGGAGATGG - Intronic
1024409466 7:49023495-49023517 GAGAAAAATGAGAAGCAAGAAGG - Intergenic
1024669737 7:51583620-51583642 CAGAAGGTGGAAGAGGAAGAGGG + Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1024750476 7:52459542-52459564 GATAAAATGAAAAAGGAAGAGGG + Intergenic
1024839033 7:53562670-53562692 CAGAAAATTGATAAGAAAGTAGG - Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026222845 7:68415414-68415436 AAGACGATGGAGAGGGAAGAGGG + Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026321481 7:69271718-69271740 CAGAAAAAGAGGAAGGAAAAAGG - Intergenic
1026364355 7:69632608-69632630 AAGAAAACAGAGAGGGAAGAGGG - Intronic
1026484777 7:70808452-70808474 TAGACACTGGAGAAGGAAGAAGG + Intergenic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1026605218 7:71810134-71810156 CAGAATTTGGAGGAGAAAGATGG + Intronic
1027224091 7:76233312-76233334 CAAAAAATGAACAAAGAAGAAGG + Intronic
1027379851 7:77595970-77595992 TAGCAACTGAAGAAGGAAGAGGG - Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1028179805 7:87705915-87705937 AAGAAAATGAAAAAGCAAGAAGG - Intronic
1028483939 7:91337836-91337858 AAGAAAATGGTAAAGGAAGTGGG + Intergenic
1028572361 7:92304944-92304966 CAGAAGATTGAGAAGGGAAAGGG + Intronic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1030014930 7:105209553-105209575 AAGAAAATAGAAAAGGAAAAAGG + Intronic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030631013 7:111895887-111895909 CAGATAAGGGGGCAGGAAGAGGG - Intronic
1030779430 7:113581051-113581073 CAGAAATTGATGAATGAAGAGGG - Intergenic
1030807544 7:113936387-113936409 AAGGAGATGGAGAAGGAAGTTGG - Intronic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030981928 7:116196363-116196385 CAAGATGTGGAGAAGGAAGATGG - Intergenic
1031132877 7:117853273-117853295 TAAAAAATGAAAAAGGAAGAGGG - Intronic
1031185228 7:118471330-118471352 CAGAGGATGTAGAAGAAAGAAGG + Intergenic
1031216672 7:118901390-118901412 CAGAAAATGGGGAATGAAGGTGG - Intergenic
1031330690 7:120459978-120460000 AAAAAAATGTAAAAGGAAGAAGG - Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031650983 7:124289610-124289632 CAGAAAGTGGCGAAAGAAAATGG + Intergenic
1031854624 7:126907280-126907302 AAGAAAGGGGAGGAGGAAGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032003658 7:128283136-128283158 TTTAAAATGGAGAAGAAAGAAGG + Intergenic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032451780 7:132037486-132037508 TAGAAAATGGAGATGGAGAATGG - Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032669383 7:134069354-134069376 GAGAAGAGGGAGGAGGAAGAAGG - Intergenic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033088772 7:138366170-138366192 CAAGGAATGGAGAAGGAAGTGGG - Intergenic
1033168457 7:139062475-139062497 CAGAAAATGGAGGAGTCAGTGGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1033498876 7:141927428-141927450 CAATAAAGGGAGAAGGATGAAGG + Exonic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033611785 7:142970295-142970317 CAGCAAAAGGAGCAGGAAAAGGG + Intergenic
1033830853 7:145250608-145250630 AAGGAAATGGATAGGGAAGAAGG - Intergenic
1033874737 7:145801608-145801630 CAGAAACCAGAAAAGGAAGAGGG - Intergenic
1033897484 7:146091775-146091797 CATAAAATGGAGAGATAAGATGG + Intergenic
1034031592 7:147772664-147772686 GTGACAATGGAGAAGAAAGAAGG - Intronic
1034051562 7:147989547-147989569 AGGAACATGGAGCAGGAAGATGG - Intronic
1034070455 7:148179694-148179716 AAGAAAAGGGAGGAGAAAGAGGG + Intronic
1034195414 7:149242944-149242966 AAGAAAGTAGAGAAGAAAGATGG + Intronic
1034239166 7:149596630-149596652 GAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035521868 8:281074-281096 AAGAAGACGGAGAAGGAAAATGG + Intergenic
1036121490 8:6021960-6021982 CATAAAGGGGAGAAGGAACATGG + Intergenic
1036141933 8:6216814-6216836 GACAGAATGGAGAAAGAAGAGGG + Intergenic
1036536050 8:9653774-9653796 CAGAGAATGAAGCAGAAAGAAGG - Intronic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1036706456 8:11050516-11050538 CAGAAAAGGGAGAAAAGAGAGGG + Intronic
1037128151 8:15374736-15374758 CAGAAAACGGATATGGCAGAGGG - Intergenic
1037188017 8:16088190-16088212 CAGAAAAGGGTGGAAGAAGAGGG + Intergenic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1037501399 8:19489049-19489071 TAGAAAATGGAGATGAGAGATGG + Intronic
1038087008 8:24209464-24209486 AAGAAAATGACAAAGGAAGAAGG + Intergenic
1038865084 8:31430830-31430852 CACAAAATGGACAAGACAGATGG + Intergenic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039097788 8:33905100-33905122 AAGATAACAGAGAAGGAAGAAGG - Intergenic
1039144141 8:34426597-34426619 CTGAAACTGAAGAAGGCAGATGG - Intergenic
1039157818 8:34581589-34581611 AAGAAAAAGGAAAAGAAAGAAGG + Intergenic
1039172950 8:34769429-34769451 TAGAAAATGGGGAAGTAAGTGGG - Intergenic
1039216895 8:35281883-35281905 CAGAAAATGTAAAAGCAAAAAGG - Intronic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1039996832 8:42541574-42541596 CAGGAAATGACGAAGGCAGAGGG + Intronic
1040077676 8:43255710-43255732 AAGAAAGTGAGGAAGGAAGAAGG + Intergenic
1040428093 8:47309630-47309652 GAAAAGATGGAGAAGAAAGAGGG - Intronic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1041014626 8:53579897-53579919 CAAAAAATGCAGAGGAAAGAGGG + Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041145346 8:54870246-54870268 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041528041 8:58830653-58830675 CAGAAAAGAAGGAAGGAAGAAGG - Intronic
1041642178 8:60214989-60215011 CAGAAAAAGGAGGAAGAAAAGGG + Intronic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1042055399 8:64759050-64759072 GAGAAAAGGAAGGAGGAAGAAGG + Intronic
1042226310 8:66517482-66517504 CAGAACATAGAGAAGGACCAAGG + Exonic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042456641 8:69012814-69012836 CATAAAATGTAGAAGAAAGTGGG - Intergenic
1042482428 8:69319314-69319336 TAGAAGAGGGAGAAGGAAAAGGG - Intergenic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1042603938 8:70527540-70527562 CAGAGAATGGGGAATCAAGATGG - Intergenic
1042709703 8:71703290-71703312 CACAAAATGGAGATTGAATATGG - Intergenic
1042889348 8:73590069-73590091 AAGAAAGAGGAGAAGGAAGTAGG + Intronic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043588670 8:81799531-81799553 TAGAAAATGGAGGGGGAAAATGG + Intergenic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1043756869 8:84014850-84014872 AAGAAAATGTAGAAGAAAAATGG - Intergenic
1043950250 8:86300856-86300878 AAGGAAAGGGAGGAGGAAGAAGG + Intronic
1044080879 8:87881853-87881875 CACAAAAGGGAGGAGAAAGATGG + Intergenic
1044305715 8:90638353-90638375 GAGTAAATGGAGTGGGAAGAAGG - Intronic
1044337788 8:91008037-91008059 CAGCAAAAGGAAAAGGCAGATGG - Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044736209 8:95281343-95281365 CAGAAAATTGGGAAGTCAGAAGG - Intergenic
1044817183 8:96125204-96125226 CTGAAAAGGGAGGTGGAAGAGGG + Intergenic
1044821864 8:96160642-96160664 CAGAAAACTGATGAGGAAGACGG + Exonic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044914170 8:97094562-97094584 CAGAAAATAAAGAATGAAAATGG - Intronic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1044968687 8:97598520-97598542 CAGACAATGAAAAAGGAAGGAGG - Intergenic
1045355176 8:101380633-101380655 AAGAAAAAGGAGAAGTAAAAGGG - Intergenic
1045634692 8:104170987-104171009 CAGAAAATTTACAAGGCAGAAGG - Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045818899 8:106311738-106311760 CAGAAAAGGGTGCAGGAATAGGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046157098 8:110306214-110306236 GAGACAAAGGAAAAGGAAGAAGG - Intergenic
1046172207 8:110525280-110525302 CAAAAAATGCACAATGAAGAAGG + Intergenic
1046302955 8:112321995-112322017 GAGAAAATGGAGAAGATAGGGGG + Intronic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1046520676 8:115321060-115321082 AAGAGAATAGAGCAGGAAGAAGG - Intergenic
1046601761 8:116325365-116325387 GAGGAAAGGGAAAAGGAAGATGG + Intergenic
1046652100 8:116847360-116847382 AAAAAAATGAAGAAGGAAAAAGG + Exonic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047056539 8:121170819-121170841 CAGAAAATGGGCATGAAAGAAGG - Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047835783 8:128689149-128689171 GAGGAAATGGAGTAGGAAGCTGG + Intergenic
1047908631 8:129501151-129501173 CAGAAAATAGTGGATGAAGAGGG - Intergenic
1047985816 8:130232357-130232379 GAGAAAATGGGAAAGGGAGAGGG + Intronic
1048102491 8:131368936-131368958 TTGAAAATGGAGAATGAAAAAGG - Intergenic
1048130096 8:131686398-131686420 TAGAAATTGGAGGAGGAAGACGG - Intergenic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048391030 8:133964658-133964680 GAGGAAAGGGAGAAGGAAGGAGG - Intergenic
1048468722 8:134688529-134688551 GAGAAAGGGGAGAAGGAAGGTGG + Intronic
1048608827 8:135999800-135999822 CAGCAGATAGAGAAGGAAGTAGG - Intergenic
1048928570 8:139292403-139292425 CAGAAATGGATGAAGGAAGAAGG - Intergenic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1050381767 9:5038380-5038402 CAAAAAATAGAAAAGGAAGGAGG + Intronic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051704660 9:19864282-19864304 CAAAAAATAGAGGAGGCAGAGGG + Intergenic
1051765244 9:20515499-20515521 GAGAAAATGGGGGAGGAGGAAGG + Intronic
1051903636 9:22069824-22069846 CAGAGACTGGGGAAGCAAGAAGG - Intergenic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1052062497 9:23977951-23977973 CAGAAAATAGAAAAGAAAAAGGG + Intergenic
1052387686 9:27841264-27841286 ATAAAAAGGGAGAAGGAAGAAGG - Intergenic
1053836457 9:42141419-42141441 CAGAAACAGGAGAAAGAAGGAGG + Intergenic
1054952583 9:70869352-70869374 CTGAAAATGGAAAAAGAAAAAGG - Intronic
1054952992 9:70873877-70873899 TAAAAATAGGAGAAGGAAGAAGG - Intronic
1055073509 9:72191405-72191427 AGGAAAATGGAGGAAGAAGATGG + Intronic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1055151893 9:73010401-73010423 CAGAAATAAGAGAAGGAACATGG - Intronic
1055266060 9:74497499-74497521 AAGAAGAGGGAGAAGGAACAAGG - Exonic
1055583167 9:77729714-77729736 CATAACATGGAGAACTAAGAAGG - Intronic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055882898 9:81023293-81023315 CAGAAAATGGAGTAAGGACAGGG + Intergenic
1056251904 9:84757143-84757165 AAAAAAAAGAAGAAGGAAGAGGG - Intronic
1056432983 9:86547122-86547144 TGGAAAATGGAGAAGCTAGAAGG - Intergenic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1056648159 9:88432896-88432918 AAGAAAATGGGGGAGGAAGAGGG - Intronic
1056806583 9:89733499-89733521 AAGGAAATGAAGAGGGAAGAAGG - Intergenic
1057602703 9:96472396-96472418 CAGAAAATGAAAGAGGACGATGG - Intronic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1057923021 9:99114570-99114592 CTTAAACTGGAGAAGAAAGATGG - Intronic
1058217085 9:102248178-102248200 CACAAAATGGAGAATGAGGAAGG - Intergenic
1058274164 9:103019264-103019286 AAAAAAATGGAGTAGTAAGATGG - Intergenic
1058376743 9:104330799-104330821 GAAAAGATGAAGAAGGAAGAAGG + Intergenic
1058379080 9:104358945-104358967 CAGCAAATGGCTAAGGAACATGG + Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058716507 9:107727095-107727117 GAGAAAAAGGAGAGGAAAGAAGG - Intergenic
1058889979 9:109353242-109353264 AAGAAAGTGGGAAAGGAAGAGGG + Intergenic
1058931286 9:109721702-109721724 CAGACAATGGAGAAAGAAGCGGG - Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061423309 9:130483890-130483912 CAGAAAGTGGAGGAGTAAGGAGG - Intronic
1062724073 9:138061402-138061424 GAGGAAATGGTGAAAGAAGAAGG - Intronic
1062730822 9:138107474-138107496 CAGAAATGGGATAAGGAAGGAGG - Intronic
1062745044 9:138206500-138206522 CATAAAGTGGAGAAGGAGCAGGG - Intergenic
1185479215 X:433677-433699 AAGGCAATGAAGAAGGAAGAAGG + Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186611402 X:11140998-11141020 CTGAAACTGGAAAAGGAAAATGG + Intronic
1187025810 X:15434275-15434297 AAGAAAGAGGAGAAAGAAGAAGG + Intronic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1187609138 X:20921267-20921289 GAGAAACTGCAGAAGCAAGAAGG + Intergenic
1187794790 X:22991853-22991875 CAGAAGATAGAAAAGGAGGAGGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187929769 X:24283416-24283438 GAGAAAATGGAGTAAGAAAATGG + Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188218049 X:27502994-27503016 AAGAAAGAGGAGAAAGAAGAGGG + Intergenic
1188265251 X:28065743-28065765 AAGAAAAGGGAAAAGGGAGAAGG + Intergenic
1188600232 X:31954731-31954753 CAGAAATAGGAGTAGGGAGAGGG + Intronic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1189450693 X:41126430-41126452 TATAAAATGAAAAAGGAAGAGGG - Intronic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189686499 X:43569458-43569480 CAGAAGATGGGAAGGGAAGAAGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190260388 X:48793505-48793527 GAGGGAATGGAGAAGGAAGGAGG - Intronic
1190644272 X:52510296-52510318 AAGAAAATGAAGAAAGAAAAAGG - Intergenic
1191109611 X:56794360-56794382 CAGGAAATGGAGAAAGACGAAGG - Intergenic
1192143956 X:68668213-68668235 GAGAAAAAAGAGAAAGAAGAAGG - Intronic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1193319181 X:80099941-80099963 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1193738380 X:85186891-85186913 CAGAAAAAGGTGGAGCAAGATGG - Intergenic
1193796200 X:85877446-85877468 TGGGTAATGGAGAAGGAAGAGGG + Intronic
1194199936 X:90941926-90941948 CATAAAAGGGAGAAAGAATACGG - Intergenic
1194395129 X:93373840-93373862 GAGAAAATGCAGAAGCAATATGG + Intergenic
1194721628 X:97346988-97347010 AAGGAAACAGAGAAGGAAGAAGG - Intronic
1194755162 X:97730759-97730781 AAGAAAAGGGGGAATGAAGAAGG - Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195093991 X:101488813-101488835 CAGAAACTGGAGCAAGAAGTGGG + Exonic
1195240177 X:102943728-102943750 CATAAAATAGAGAGGGAACAGGG + Intergenic
1195260200 X:103124406-103124428 CTGGAAGTGGAGTAGGAAGATGG - Intergenic
1195319477 X:103710031-103710053 TAGAGAATGGGGAATGAAGAGGG + Intronic
1195747631 X:108134821-108134843 CAGAAAATGCTGAATGAACAGGG - Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196128944 X:112131727-112131749 GAGAAATTGGAAAAGAAAGAGGG + Intergenic
1196281596 X:113829022-113829044 GAGAAAAAGGAAAAGAAAGAAGG + Intergenic
1196334285 X:114512840-114512862 CAAAAAATGGAGAAGGTAGAGGG + Intergenic
1196560034 X:117135254-117135276 CAGTAAGTGAAGAAGGAAAAGGG - Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1196934275 X:120714088-120714110 CAGAAAATGGGGAAGGCAGAAGG - Intergenic
1197366644 X:125572132-125572154 CAGGAAAGGGAGAATGAAGGGGG + Intergenic
1197383296 X:125771739-125771761 TAGAAAATGGACAATGAAAATGG + Intergenic
1197673268 X:129302240-129302262 CAGAAAAAGGACAAGGACAAAGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198647964 X:138830088-138830110 CAGAAAATGGGTAATAAAGACGG + Intronic
1198718606 X:139590613-139590635 CAGAAAATGATGAAAGAAAATGG - Intronic
1199059817 X:143341641-143341663 TTCAAAATGCAGAAGGAAGATGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199328588 X:146531453-146531475 AAGAAAAAGGAGAATGAATAAGG + Intergenic
1199386879 X:147233192-147233214 GAGAAAGGGGAGAAGGGAGAGGG - Intergenic
1199612941 X:149633103-149633125 CAGAGGATGGGAAAGGAAGATGG - Intergenic
1199728502 X:150607674-150607696 CTGACAATGGAGAAAAAAGAGGG - Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1201431624 Y:13908546-13908568 GAGAAAATGGGGAAAGAGGAAGG - Intergenic
1201571516 Y:15420579-15420601 CAGAAAGTGGAGCATGAAAAAGG + Intergenic
1201575862 Y:15460862-15460884 CAGAAAATGAGGAAGAAAGGAGG - Intergenic