ID: 905035880

View in Genome Browser
Species Human (GRCh38)
Location 1:34918215-34918237
Sequence CTGTGTCAGTGGATGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905035880_905035887 -9 Left 905035880 1:34918215-34918237 CCTGCCACCATCCACTGACACAG 0: 1
1: 0
2: 2
3: 28
4: 345
Right 905035887 1:34918229-34918251 CTGACACAGGGAGAGAGGAGAGG 0: 1
1: 0
2: 7
3: 73
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905035880 Original CRISPR CTGTGTCAGTGGATGGTGGC AGG (reversed) Intronic
900314228 1:2049228-2049250 ACGTGTGAGTGGGTGGTGGCAGG + Intergenic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900738659 1:4316911-4316933 CAGTGTGAGTGGGTGGTGGCTGG + Intergenic
901534314 1:9872561-9872583 CTGTCTCAGTGTTTGGGGGCTGG - Intronic
901653736 1:10757406-10757428 TGGTGTGAGAGGATGGTGGCTGG - Intronic
901807999 1:11749948-11749970 CTGTCTCTGTGCATGGTGTCAGG + Intronic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
903551845 1:24162622-24162644 CTGTGTCATCCCATGGTGGCAGG + Intronic
903815795 1:26063515-26063537 CTTTATCAGGGGATGGAGGCAGG - Intronic
904606817 1:31702513-31702535 CTGTGCCAGTGGATACTTGCTGG + Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905051192 1:35052548-35052570 CTGTTTTAGTGGATGATGGGAGG + Intergenic
907298811 1:53472363-53472385 CTGTGTCATTGGATGCTTGAAGG + Intergenic
907332801 1:53682260-53682282 CTGTGTCAGCGGCTGCTTGCTGG - Intronic
909001469 1:70221941-70221963 CTGCTTGAGTGGCTGGTGGCTGG + Intronic
909568999 1:77086848-77086870 CTTCCTCAGGGGATGGTGGCTGG + Intergenic
915513686 1:156400772-156400794 CTGTGGCAGCGGGTGGGGGCTGG + Intergenic
915545373 1:156594039-156594061 CGGTGTCAGGGTAGGGTGGCAGG - Exonic
916836014 1:168545826-168545848 GTGTGTGAGTGAATGGTGGAAGG - Intergenic
916838452 1:168574749-168574771 GTGTGTGAGTGAATGGTGGAAGG + Intergenic
916875100 1:168960739-168960761 CTGTGTCACTGGTTCCTGGCAGG + Intergenic
919012493 1:191983260-191983282 CTGCTTCAGTGGAGGGTGGCAGG + Intergenic
919036225 1:192312497-192312519 CTGCCTCAGTAGCTGGTGGCTGG + Intergenic
920666196 1:207964262-207964284 CGGTGAGAGTGGAGGGTGGCGGG + Intergenic
922855357 1:228770400-228770422 CTGTGTCAGTGGAAGGGTGCAGG + Intergenic
924608083 1:245552213-245552235 CTGTGACTGTGGAGGTTGGCGGG + Intronic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1063159790 10:3410761-3410783 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1063203892 10:3812183-3812205 AGCTGTCAGTGGATGGTGGAGGG - Intergenic
1063352280 10:5366625-5366647 GTGTGTGAGTGGCTGGGGGCTGG - Intronic
1064014273 10:11760668-11760690 CTGTGTCAGTGGAGGGTAAGTGG + Intronic
1064952641 10:20871278-20871300 CTGTTACAGAGGATTGTGGCTGG - Intronic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067556644 10:47277751-47277773 ATGTGACAGTGGCTGGTGGTTGG - Intergenic
1068484236 10:57636134-57636156 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1069690434 10:70348252-70348274 CTGTGTTAGTGGCTGGTGATGGG - Intronic
1069745230 10:70710791-70710813 CGCTGTCAGTGGGTGGTGGTTGG + Intronic
1070447082 10:76515798-76515820 CTGTTTAAGAGGATGGGGGCTGG - Intronic
1071473770 10:86007295-86007317 CAGTGTCAGTGGGGGGTGGGAGG - Intronic
1072705206 10:97675921-97675943 CAGTGTCAGGGAATGGAGGCTGG + Exonic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1074056258 10:109924778-109924800 TTGTGTGCGTGGGTGGTGGCAGG - Intergenic
1075403504 10:122178166-122178188 CTGTGTCCTTGCATGGTGGCAGG + Intronic
1075563883 10:123489162-123489184 TTGTGTCTGTGTATGGTAGCTGG + Intergenic
1075663710 10:124216053-124216075 CTGGGGCACTGGATGATGGCAGG - Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078936770 11:15958219-15958241 CTATGTCATTTGATGGTGGTTGG + Intergenic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1079815685 11:25054488-25054510 GTGTGTCTGTGGATGGTGTTAGG + Intronic
1082703236 11:56459941-56459963 CTCTGTCAGTGGATTCTGTCTGG + Intergenic
1082931600 11:58613268-58613290 CTGTGTCAGCCCATGGTGGAAGG + Intronic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083764622 11:64835982-64836004 CTAGGCCAGGGGATGGTGGCTGG - Intronic
1083765246 11:64838482-64838504 CTGGGCCAGCGGATGGTGGCTGG + Intronic
1084557229 11:69882308-69882330 TTGGGTCAGTGGATGGAAGCAGG - Intergenic
1084651193 11:70490426-70490448 CTGTGACCGTGGGTGGGGGCTGG - Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085501806 11:77031146-77031168 CTGTGTCAGTGAGTGGAGACAGG + Intergenic
1085503664 11:77043280-77043302 CTGTGTCACTGCATGGTGGGAGG + Intergenic
1088247131 11:107829472-107829494 CTGTGTCATAGCATGGTGGAAGG - Intronic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1088729516 11:112668440-112668462 CTGCTTCATTGGAGGGTGGCAGG - Intergenic
1089597906 11:119593499-119593521 CTGTGTCATAGCATGGTGGAGGG + Intergenic
1089697981 11:120227514-120227536 AGGTGTCAGTGGAGGGGGGCAGG - Intronic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090515839 11:127425649-127425671 CTGTTTCAGTGGAGGGTTGAGGG + Intergenic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091591920 12:1847459-1847481 CTGTGTCTGTGGGTGGTACCCGG + Intronic
1091779998 12:3207763-3207785 CTGTTTTAGTGGCTGGTGGGGGG + Intronic
1092560038 12:9603102-9603124 CTGTATCAGTGGAGGGGGGCAGG + Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1094447753 12:30550180-30550202 CTGTCTCAGTGGCAGGAGGCAGG - Intergenic
1096063452 12:48721106-48721128 CATTTTAAGTGGATGGTGGCAGG + Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1097178331 12:57156460-57156482 CTGAGTGGGTGGATGGGGGCTGG - Intronic
1098177023 12:67803450-67803472 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1100581024 12:95940636-95940658 CTGTGTCCTTGGATGGTGTGGGG + Intronic
1102703476 12:114860898-114860920 CTCTGTCTGTGGTTTGTGGCTGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103324545 12:120111746-120111768 CAGTGTCAGAGGTTGGTGTCAGG - Intronic
1103636964 12:122314870-122314892 TTGTGTCACTTGATGTTGGCAGG + Intronic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1104884692 12:132099946-132099968 CTGCGTCAGTGTAGGGTGACAGG + Intronic
1105543658 13:21336644-21336666 GTGTGCCAGTGGAGGCTGGCCGG - Intergenic
1105913407 13:24891801-24891823 CTGGGACAGTGGGTGGTGGATGG - Intronic
1107127176 13:36858260-36858282 CTAGGTCAGAGGATGGAGGCAGG + Intronic
1109989955 13:70041603-70041625 CTGTGTCAGTGGATGCCAGATGG - Intronic
1110350048 13:74496163-74496185 CTGGGTCAGGGGGTGGTGACAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110785667 13:79522736-79522758 CTTCCTCAGTAGATGGTGGCTGG + Intronic
1111046979 13:82826895-82826917 GTGTGGCAGTTGATGCTGGCTGG - Intergenic
1112822627 13:103354461-103354483 TTGAGTCACTGGGTGGTGGCTGG - Intergenic
1113414102 13:110114411-110114433 ATCTGTCACTGGAGGGTGGCTGG + Intergenic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1122208652 14:100160817-100160839 CTAATTCAGGGGATGGTGGCTGG - Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1123124605 14:105937525-105937547 CAGTGGCAGTGGGTGCTGGCGGG - Intergenic
1124630705 15:31335465-31335487 GTGTGTGTGTGTATGGTGGCGGG + Intronic
1125753626 15:42047353-42047375 CTGTGTCATTCCATGGTGGAGGG + Intronic
1126508033 15:49430635-49430657 CTGTGTCATTCCATGGTGGAAGG + Intronic
1128016872 15:64355828-64355850 TTGTGTCTGTGGAGGGTTGCGGG - Intronic
1128703563 15:69821866-69821888 CTGTGTCTGAGGACCGTGGCGGG - Intergenic
1129688004 15:77697234-77697256 GTGTGTCAGATGATGGTGGCAGG + Intronic
1129738222 15:77977322-77977344 CCGAGGCCGTGGATGGTGGCTGG + Intergenic
1129847852 15:78776271-78776293 CCGAGGCCGTGGATGGTGGCTGG - Exonic
1130709241 15:86263517-86263539 CTTTTTCAGTGCATGGGGGCAGG - Intronic
1130750369 15:86705125-86705147 CCCTGTCAGTGGCTGGTGGGGGG + Intronic
1131678877 15:94700961-94700983 CTGTGTCAATAGAGGGTGGGTGG + Intergenic
1132010779 15:98274435-98274457 CTGTGACTTTGGATGATGGCTGG - Intergenic
1132086680 15:98914101-98914123 TTGTGTCCTTGCATGGTGGCAGG + Intronic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132731795 16:1366498-1366520 CTGTCTCTGTAGCTGGTGGCCGG - Intronic
1132803476 16:1765293-1765315 ATGTGGCAGTGGACGGTGGGAGG + Intronic
1132864539 16:2086921-2086943 CTGTGTCCCGGGTTGGTGGCAGG + Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1136252473 16:29014927-29014949 CTGTGTCAGCCCATGGTGGAAGG - Intergenic
1136276667 16:29182877-29182899 CTCTGGCCGTGGCTGGTGGCAGG + Intergenic
1137271531 16:46905573-46905595 CTGTGGAAGTGCATGGGGGCTGG - Intronic
1137980684 16:53066784-53066806 CTGTGTCAATGCATGTTAGCGGG + Intronic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1138605411 16:58085364-58085386 TTGTGTCAGAGGATGCTGGGCGG - Intergenic
1138795422 16:59962611-59962633 CTGTGGCTGTGGTTTGTGGCAGG + Intergenic
1139594859 16:67951584-67951606 CAGTGTCAGGGGCTGGTGGCTGG + Intronic
1140283173 16:73574348-73574370 CTGATTCAGTGGATGCTGGGGGG - Intergenic
1140313675 16:73872903-73872925 GGGTGGCAGTGGATGGTGGTGGG + Intergenic
1142285447 16:89169772-89169794 TTGTGTCAGAGGTAGGTGGCAGG - Intergenic
1142478640 17:204644-204666 ATGGGTCAGTGGGTGGTGGAGGG - Intergenic
1142605886 17:1080796-1080818 CTGTGTCTCTGGCTGGTGCCTGG + Intronic
1143150331 17:4803868-4803890 ATGTGGCTGGGGATGGTGGCGGG - Intergenic
1143287916 17:5805002-5805024 CTGTGTCATTCCATGGTGGAAGG + Intronic
1143587539 17:7857972-7857994 TTATCTCAGTGGACGGTGGCCGG + Exonic
1144867616 17:18347010-18347032 CTGTGGCTGTGGATGGTGCCGGG + Intronic
1145728304 17:27153935-27153957 GGGTGTCAGTGGAAGATGGCTGG + Intergenic
1146261665 17:31425995-31426017 CTGGGTCAGTGGAATGTGTCTGG + Intronic
1148345973 17:46903965-46903987 GTGTGTGGGTGGATGGTGGCTGG + Intergenic
1150132649 17:62677567-62677589 GTGTGTCTCTGGATTGTGGCTGG - Intronic
1151897767 17:76991825-76991847 CTGCGTCAGTGGAGGTGGGCAGG + Intergenic
1152222332 17:79075447-79075469 CTGGCTCAGTGGATGCCGGCTGG + Intronic
1152366724 17:79860675-79860697 CAGAGTCTGTGGCTGGTGGCAGG - Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1154025195 18:10700875-10700897 CTGGGTCATTGGGTTGTGGCAGG - Intronic
1154977300 18:21471915-21471937 TTGTGAAAGTGGATTGTGGCTGG - Intronic
1158019467 18:52824416-52824438 GTATGTCACTGGATGCTGGCAGG + Intronic
1159880109 18:73851253-73851275 CAATGTCAGTGCATGGTGACGGG + Intergenic
1159995491 18:74960503-74960525 CTGAGTCAGTGCTTGGTGGAGGG + Intronic
1159995498 18:74960539-74960561 CTGAGTCAGTGCTTGGTGGAGGG + Intronic
1161347644 19:3776215-3776237 ATGTGTGAATGGATGGTGGGTGG + Intergenic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1166706750 19:44912332-44912354 ATGTCTCTGTGGATGGTTGCTGG - Intergenic
1167509485 19:49888537-49888559 CTGTGTCCGTGGAGGGCGGCGGG - Exonic
1168398016 19:56065432-56065454 CTGTGTGTGTGTGTGGTGGCGGG + Intergenic
924997234 2:373312-373334 CTGTGTAACTGGATGGGGGTTGG + Intergenic
925134261 2:1515377-1515399 CTGCGTCTGTGAAAGGTGGCAGG + Intronic
925315399 2:2919132-2919154 CTGTGTCAGTAGATGGGGAGTGG + Intergenic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
926298206 2:11583383-11583405 CTGCGTCAGTGGTTGTTGGGAGG + Intronic
931535597 2:63271980-63272002 CAGTGGCAGTGGTTGGTGGGTGG - Intronic
931841370 2:66153170-66153192 CTGTGTATGTGGATGGTGTTGGG + Intergenic
932347286 2:71004003-71004025 CTGGGGCAGTGGGTGGTGGCGGG + Intergenic
932429306 2:71664435-71664457 GTGTGTACGTGGATGGGGGCTGG + Exonic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932855717 2:75232201-75232223 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934557830 2:95296794-95296816 CTGTGTCTGTGAAGAGTGGCAGG + Intergenic
934847219 2:97669608-97669630 CTGTGTCTGTGGACAGTGACGGG - Intergenic
935430844 2:102974148-102974170 CTGTGTCAGCCCGTGGTGGCAGG + Intergenic
935769241 2:106401207-106401229 CTGTTTCAGTTGATTATGGCTGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935910851 2:107894716-107894738 CTGTTTCAGTTGATTATGGCTGG - Intergenic
935968978 2:108511560-108511582 CTGTTTCAGTTGATTATGGCTGG - Intergenic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936132637 2:109859761-109859783 CTGTTTCAGTTGATTATGGCTGG - Intergenic
936212060 2:110511724-110511746 CTGTTTCAGTTGATTATGGCTGG + Intergenic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936421200 2:112366286-112366308 CTGTTTCAGTTGATTATGGCTGG + Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937260446 2:120582739-120582761 GTGTGTTTGTGGATGGTGGCTGG - Intergenic
937446610 2:121963496-121963518 CTGGGTCAGTGGCTGGGGGGAGG + Intergenic
940737314 2:157467928-157467950 CTTTCTCAGAGTATGGTGGCTGG - Intronic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
943893216 2:193318607-193318629 GTTTGCCAGAGGATGGTGGCTGG - Intergenic
944636681 2:201681824-201681846 CTGTTTCAGTGTAGGGTGGGGGG - Intronic
945583252 2:211624198-211624220 ATGTGTCAGTGAATGGTGAGTGG - Intronic
946397385 2:219449763-219449785 ATGGGTCAGGGGATGGTGCCCGG - Intronic
946400765 2:219467248-219467270 CTGTTTGAGTGCCTGGTGGCGGG + Exonic
948145518 2:235705308-235705330 CTGTGCCACTGGATTCTGGCTGG + Intronic
948444690 2:238023171-238023193 CTGGGTCACTGGATGGTGGCAGG - Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1170765773 20:19289184-19289206 GTGTGCCAGTGGGTGGGGGCAGG - Intronic
1173150268 20:40561378-40561400 CTGTGTCACTAGTTGCTGGCTGG - Intergenic
1173161129 20:40653286-40653308 GTGTGTCTGTGAATGGTGGGTGG - Intergenic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174665844 20:52256983-52257005 CTGTGTCTGTGGGTAGAGGCCGG + Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175126497 20:56756102-56756124 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1175379023 20:58549916-58549938 CTGTTTCAGAGGATTGGGGCAGG - Intergenic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175940121 20:62533909-62533931 CAGTGTCTGTGGGTGGGGGCAGG + Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177805660 21:25872351-25872373 CTTTCTCAGAGCATGGTGGCTGG - Intergenic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1180033359 21:45227829-45227851 CAGTGTCAGGGAATGGTGCCTGG + Intergenic
1181277682 22:21696862-21696884 CTGTGGCAGTGGATGGGGTGAGG - Exonic
1181573541 22:23780542-23780564 CGGGGTCAGTGGCTGCTGGCAGG - Intronic
1182436171 22:30331546-30331568 CAGTGTCAGGGCATGGTGTCAGG + Intergenic
1182517204 22:30865679-30865701 TTGCGTCAGTGGAAGGTGACCGG + Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1183693112 22:39402427-39402449 CTGGGTCAGTGGAGGTTTGCAGG + Intronic
1184021961 22:41826928-41826950 CTCTGTCAGTGGTAGGGGGCTGG - Intergenic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184987000 22:48142517-48142539 CTGTTTCAGGGGCTGGTGACGGG + Intergenic
1185216835 22:49605612-49605634 CTGTGTCAGCCCATGGTGGAAGG - Intronic
949856982 3:8470852-8470874 TTCTCTCAGTGGAAGGTGGCTGG + Intergenic
950440293 3:13006485-13006507 GTCTGCCAGTGGATGCTGGCTGG - Intronic
953413920 3:42704719-42704741 CTGTGTCTGAGGGGGGTGGCAGG + Intronic
954076894 3:48188143-48188165 CCGTGCCTGTGGCTGGTGGCTGG - Exonic
954922370 3:54202985-54203007 CTGTGTCTGGGGATCATGGCTGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956330451 3:68101160-68101182 CTGTATCAGAGGATGGAGGGTGG - Intronic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
957586377 3:82137685-82137707 CTTTGACAATGGATGGTGGTAGG + Intergenic
961026809 3:123565462-123565484 CTGTGTCCTTGTATGGTGGAAGG - Intronic
961087832 3:124084315-124084337 CTGTGACAGGTCATGGTGGCTGG + Intronic
961391604 3:126555650-126555672 CTGTGGCAGGGAGTGGTGGCTGG - Intronic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
962416641 3:135188669-135188691 CTGAGACATTGGATGTTGGCGGG - Intronic
962748303 3:138414091-138414113 CTGTTTGAGTAAATGGTGGCTGG - Intergenic
963320909 3:143807989-143808011 CGGTGAGAGAGGATGGTGGCCGG + Intronic
963860775 3:150308146-150308168 CTGTGGCAGTTGGTGGAGGCAGG + Intergenic
964011878 3:151901402-151901424 CTGTGGCAGTGGGTGCAGGCAGG - Intergenic
964410457 3:156392135-156392157 ATGTTACAGTGGTTGGTGGCAGG - Intronic
966421012 3:179733988-179734010 CTCAGTGTGTGGATGGTGGCAGG + Intronic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967774742 3:193374936-193374958 CTGTGTCATTCCATGGTGGAAGG - Intronic
968286383 3:197511277-197511299 CTGAGTCACTGGCTGCTGGCTGG + Exonic
968586199 4:1417200-1417222 CTGTCTCTGGGCATGGTGGCCGG + Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
971064951 4:23020967-23020989 CTGAGACAGTGGATAGGGGCTGG + Intergenic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
974078941 4:57193535-57193557 TTGTGTTTTTGGATGGTGGCCGG + Intergenic
975905768 4:79210168-79210190 GGGAGTCAGTGGAGGGTGGCGGG + Intergenic
975914976 4:79313770-79313792 CTGTTTCACTGGATTTTGGCTGG + Intronic
983167212 4:164492614-164492636 TTGTGTCAGAGGATGGTTTCAGG - Intergenic
984455343 4:179959538-179959560 ATGCCTCAGTGGATGGTGTCTGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985808871 5:2068672-2068694 GTGAGTCAGTGGAGGGTGGGAGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
986983314 5:13473994-13474016 CTTTTTACGTGGATGGTGGCCGG - Intergenic
987068273 5:14310541-14310563 CTGTATCAGTGGGTGATGGCAGG + Intronic
990622694 5:57577923-57577945 AGGTGACGGTGGATGGTGGCAGG + Intergenic
991936588 5:71808046-71808068 CTTTGTTAGTGGCTGGTGGCAGG + Intergenic
993669888 5:90747523-90747545 CTGTGTCAATGGATGGGGGTGGG - Intronic
994716485 5:103327871-103327893 ATGTGTGTGTGAATGGTGGCTGG + Intergenic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
997647890 5:135493074-135493096 ATGGGTGAATGGATGGTGGCTGG + Intergenic
999256214 5:150211208-150211230 CTGTGGCAGTAGGTGGTGGGTGG + Intronic
999333939 5:150699018-150699040 CGGTGTCAGTGGATGGGCACTGG - Intronic
999705567 5:154269717-154269739 CAGTGTCAGTGGAGGGAGCCTGG + Intronic
1000115576 5:158150417-158150439 CTGTGGCAGTGGCTGGTTGGTGG - Intergenic
1000255828 5:159537365-159537387 GTGTGTCGGTGGATGATGGAGGG + Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1000873861 5:166611212-166611234 CTGTGTATGTGGTTGGGGGCGGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001630425 5:173170897-173170919 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1001652383 5:173325007-173325029 ATATGTCAGTGGATGGGGACTGG + Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001808371 5:174608565-174608587 TGGTGGCAGTGGCTGGTGGCTGG + Intergenic
1001933392 5:175688392-175688414 CTGGGGCAGAGGATGGTGGCTGG - Intergenic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1003408373 6:5841408-5841430 GTGTGCCAGTGGAGGCTGGCTGG + Intergenic
1004461927 6:15845012-15845034 CTGTCTCAGTTCCTGGTGGCAGG - Intergenic
1004696227 6:18035592-18035614 CAGCGTCTGTGGGTGGTGGCAGG - Intergenic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007842846 6:44730810-44730832 CTGTGTCAGTCCAGGGGGGCTGG - Intergenic
1007847635 6:44773153-44773175 CTGAGTCAGTTCTTGGTGGCAGG - Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010158260 6:72820932-72820954 CTGTGTCACTGGAGTTTGGCTGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1015365840 6:132397073-132397095 CTTTGTCACAGCATGGTGGCAGG - Intronic
1015492818 6:133847354-133847376 CTGTGTTAATGGGTGGGGGCTGG - Intergenic
1017555697 6:155564332-155564354 CTGTGTCATTACATGGTGGAGGG - Intergenic
1017755658 6:157526923-157526945 CCGGGGCAGTGGATGGTGGCCGG + Intronic
1019267594 7:127114-127136 ATGTGTCCCTGGATGGTGGCAGG - Intergenic
1019743016 7:2684487-2684509 CTGGGTCAGAGGATGGTGATGGG + Intronic
1020116444 7:5479111-5479133 CTAAGTCAGAGGATGGTTGCAGG + Intronic
1020936473 7:14472366-14472388 CATTGTACGTGGATGGTGGCAGG - Intronic
1021925907 7:25533469-25533491 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022498182 7:30866219-30866241 CTGGGTGAGTGGATAGGGGCAGG - Intronic
1022581360 7:31558158-31558180 CTGTGTCATTCCATGGTGGAAGG - Intronic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023291271 7:38671339-38671361 GTGTGTCAGTGCATGGAAGCAGG - Intergenic
1024978791 7:55138886-55138908 CTGTGTCAATCTATGGTGGAAGG + Intronic
1028770789 7:94618332-94618354 ATGTGTCAGTGACTGATGGCTGG - Intronic
1029335990 7:99899733-99899755 CTGTGTCTGTGTATGGTGGGTGG + Intronic
1029572769 7:101381566-101381588 CTGTGTCATTTTATGGTGGAAGG + Intronic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033616502 7:143021561-143021583 CTGTGTCATTCCATGGTGGAAGG - Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1035888293 8:3316957-3316979 CTGTGTCAGTGGATGTGGGGAGG + Intronic
1036055922 8:5253699-5253721 CTGTCTCAGTGTCTGCTGGCTGG + Intergenic
1037855365 8:22367471-22367493 CTGGGGCAGTGGGTGGGGGCGGG + Intronic
1039252745 8:35684573-35684595 CTCTCTCAGTGAATGGAGGCTGG + Exonic
1040665678 8:49629879-49629901 CTGTGCCAGTCCCTGGTGGCAGG + Intergenic
1041149527 8:54916968-54916990 CTGAGACAGTGGAGGCTGGCCGG + Intergenic
1041719039 8:60959899-60959921 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1041737731 8:61129656-61129678 CTGTGTCCTTGCATGGTGGAAGG + Intronic
1043420450 8:80092306-80092328 ATGTGTCAGTGGGTGGGGGGAGG - Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG + Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1048064143 8:130950477-130950499 CTGTGTCAGGGTTTGGGGGCTGG + Intronic
1049708682 8:144054146-144054168 CTGAGTCACTGGGTGGTGGGTGG - Intronic
1050733926 9:8741509-8741531 CTGTTTGAGTGGAAAGTGGCTGG - Intronic
1053446260 9:38155460-38155482 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
1055130559 9:72769561-72769583 GTGAGGCAGTGGAGGGTGGCTGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057299664 9:93870577-93870599 CTGTGTGAGTGGCTGTGGGCAGG - Intergenic
1057353390 9:94317982-94318004 CCTTGTGAGTGGATGGTGGGAGG + Intergenic
1057643830 9:96854331-96854353 CTGTGTCAGTGGATGCGACCGGG - Exonic
1057654361 9:96939610-96939632 CCTTGTGAGTGGATGGTGGGAGG - Intronic
1058048846 9:100386451-100386473 CTTTGGCAGTGGCTGGTGCCTGG - Intergenic
1058811202 9:108641259-108641281 ATGTGTTAGTGGGTGGAGGCAGG - Intergenic
1059359269 9:113727752-113727774 CTGTGTCCTTTCATGGTGGCAGG + Intergenic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1061667384 9:132168508-132168530 CTGTCACTGTGGGTGGTGGCTGG + Intronic
1061831986 9:133301996-133302018 CAGTGTCAGTGGGTAGAGGCTGG - Intergenic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062463844 9:136672683-136672705 CTGTGTCAGTGGATGGACTGGGG + Intergenic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1186904912 X:14100627-14100649 CGATGGCAGTTGATGGTGGCAGG + Intergenic
1187634672 X:21213517-21213539 GTGTGTCAGGGGATAGTGGTGGG + Intergenic
1188760391 X:34021157-34021179 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1191673246 X:63768793-63768815 CATTTTAAGTGGATGGTGGCAGG - Intronic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194109304 X:89812602-89812624 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1194807285 X:98344954-98344976 CAGTGTCAGTGGCTGCAGGCAGG + Intergenic
1195239406 X:102936195-102936217 GTGTGTCTGTGTATGGGGGCAGG - Intergenic
1195298301 X:103501866-103501888 GTGTGTCTGTGTATGGGGGCAGG + Exonic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1198212043 X:134525465-134525487 CCGTGTCAGTGGTTTGGGGCTGG - Intergenic
1198854932 X:141005711-141005733 CAGAGGCAGTGGATTGTGGCGGG + Intergenic
1198877080 X:141239432-141239454 CAGAGGCAGTGGATTGTGGCGGG - Intergenic
1198907760 X:141581658-141581680 CAGAGGCAGTGGATTGTGGCGGG - Intergenic
1198909031 X:141592766-141592788 CAGAGGCAGTGGATTGTGGCGGG + Intronic
1198918049 X:141695386-141695408 CAGAGGCAGTGGATTGTGGCGGG - Intronic
1199233706 X:145467753-145467775 CTGTGGCAGTGGTGCGTGGCTGG - Intergenic
1199791625 X:151160863-151160885 CTGTCCCAGTGGAGGGAGGCAGG - Intergenic
1200461967 Y:3467344-3467366 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1200938152 Y:8756385-8756407 CGGTGTCAGTGAAAGATGGCTGG + Intergenic
1200963859 Y:9018945-9018967 GGGTGTCAGAGGAAGGTGGCTGG + Intergenic
1201039026 Y:9810605-9810627 AGGTGTCAGTGAATGATGGCTGG + Intergenic
1201382686 Y:13401186-13401208 CTGTGTCAGAACATGGTGGAAGG - Intronic