ID: 905035985

View in Genome Browser
Species Human (GRCh38)
Location 1:34918636-34918658
Sequence GAGAAAATGGAGAAGTAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 0, 3: 52, 4: 629}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905035977_905035985 26 Left 905035977 1:34918587-34918609 CCCAGTCCGATTGGCTGAAAAGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG 0: 1
1: 0
2: 0
3: 52
4: 629
905035978_905035985 25 Left 905035978 1:34918588-34918610 CCAGTCCGATTGGCTGAAAAGTG 0: 1
1: 0
2: 0
3: 5
4: 57
Right 905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG 0: 1
1: 0
2: 0
3: 52
4: 629
905035981_905035985 20 Left 905035981 1:34918593-34918615 CCGATTGGCTGAAAAGTGGGTCA 0: 1
1: 0
2: 1
3: 4
4: 97
Right 905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG 0: 1
1: 0
2: 0
3: 52
4: 629
905035976_905035985 27 Left 905035976 1:34918586-34918608 CCCCAGTCCGATTGGCTGAAAAG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG 0: 1
1: 0
2: 0
3: 52
4: 629
905035982_905035985 -7 Left 905035982 1:34918620-34918642 CCTTTTGAAAAATAGTGAGAAAA 0: 1
1: 0
2: 8
3: 98
4: 881
Right 905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG 0: 1
1: 0
2: 0
3: 52
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905035985 Original CRISPR GAGAAAATGGAGAAGTAGGT CGG Intronic
900103153 1:971354-971376 GAGAAAATGGCCAAGGACGTTGG - Exonic
900733130 1:4276078-4276100 GTGAAATTGCAGAAGGAGGTGGG + Intergenic
900838708 1:5028997-5029019 GAGAAAAAGAAGAATTAGATTGG - Intergenic
901642520 1:10699908-10699930 GAGAGAAGAGAGAGGTAGGTGGG + Intronic
902751442 1:18514397-18514419 CAGAAAATGGGGAGATAGGTGGG - Intergenic
903047747 1:20576890-20576912 GAAAAAAGGGACAAGTAGGCAGG - Intergenic
903405664 1:23093182-23093204 TAGAAAATGGAGAGGTAGAAGGG - Exonic
904444402 1:30556377-30556399 GAGAAAATGGAGATTTATGGAGG + Intergenic
904966176 1:34375749-34375771 GAGAAAAGGGAGTAATAGGAGGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
905613516 1:39376578-39376600 AAGAAACTGGACTAGTAGGTGGG - Intronic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
905988246 1:42308114-42308136 CAGAAAATGGATAGGCAGGTGGG - Intronic
906031036 1:42720279-42720301 GAGAAAATGGAGAGGCAGCTGGG - Intergenic
906415360 1:45617574-45617596 GAAAACATGGAGGAGGAGGTGGG + Exonic
906942799 1:50271216-50271238 GAGGAAGAGTAGAAGTAGGTGGG - Intergenic
907072303 1:51547546-51547568 AAAAAAATGGACAAATAGGTAGG + Intergenic
907981009 1:59480794-59480816 GAGGAAACAGAGAAGTAGGCAGG + Intronic
908387623 1:63657625-63657647 GTGAAAAGGGAGAAGCAGGGAGG - Intronic
908623624 1:66014709-66014731 GAGAACATTTAGCAGTAGGTGGG + Intronic
908764750 1:67544407-67544429 GATAACATGGAAAAGCAGGTTGG - Intergenic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
909862885 1:80631762-80631784 TAAAAATTGTAGAAGTAGGTAGG + Intergenic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
910700065 1:90063805-90063827 AAGAAAATGGAGAACTTGGAGGG + Intergenic
911716270 1:101136966-101136988 GAGAAAATGTTGAAGAAAGTTGG - Intergenic
911803655 1:102177109-102177131 GAAAAAATTGAGGAGTTGGTGGG + Intergenic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
913447508 1:118965315-118965337 GAAAAAATGGAGAAGTTGGAGGG + Intronic
914742322 1:150475241-150475263 GAGAAAATGGGGTGGGAGGTGGG + Intronic
915448866 1:155990766-155990788 GAGAAAATGGGAAAGTGGGAAGG - Intronic
915882965 1:159692443-159692465 GAAAGAATGGAGAAATAGATAGG + Intergenic
916026248 1:160836177-160836199 GAGAAACTGGAGAGGTACCTGGG + Exonic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917166145 1:172115373-172115395 GAGAAAGAGGAGAAGCAGGAGGG - Intronic
917401497 1:174653987-174654009 GAGAAAATAGGGAAGGAGCTGGG + Intronic
918439279 1:184550103-184550125 GACAAAATGTAGTAGTTGGTTGG + Intronic
918498389 1:185165535-185165557 AAGCAAATGCAGAAGTAGGGAGG - Intronic
919067076 1:192706014-192706036 GAGATAATAGATAGGTAGGTAGG + Intergenic
919325287 1:196099610-196099632 GAGAAGATGGAAAAGTGGGGGGG + Intergenic
919587422 1:199456147-199456169 GAGAAGACGAAGAGGTAGGTAGG + Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
920110891 1:203586347-203586369 CAGAAACGGGAGAAGTAAGTGGG - Intergenic
920341552 1:205278273-205278295 GAGAAAATGAAGAAGAAGGAAGG - Intergenic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
920789866 1:209079723-209079745 GGGAAAATGGAGGAGGATGTTGG - Intergenic
920825376 1:209420100-209420122 GGAAAAATGGATAAGTAAGTAGG - Intergenic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921314348 1:213876273-213876295 GGGAAAATTCAGAAGTATGTTGG - Intergenic
921339656 1:214122086-214122108 GAGAAAGATGGGAAGTAGGTTGG + Intergenic
921615937 1:217267717-217267739 GAGAAAATGGAAAAGGATCTTGG + Intergenic
921883130 1:220276303-220276325 AAGAAGATGTAGAAGTATGTGGG + Intergenic
922224185 1:223631042-223631064 AAAAGACTGGAGAAGTAGGTTGG - Intronic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
924291971 1:242545906-242545928 GAAAAAATTGAGAAGTACTTTGG + Intergenic
924749859 1:246876295-246876317 GGAAAAATGGATATGTAGGTAGG - Intronic
924817276 1:247453652-247453674 GAGAAAAGGGAGAAGTTGTAGGG + Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063268477 10:4480074-4480096 GAGAAACTGGGGAAGAAGGGAGG + Intergenic
1063313328 10:4977709-4977731 CAGAAAATGGATAATTAGGGGGG - Exonic
1063314625 10:4990007-4990029 CAGAAAATGGATAATTAGGGGGG + Exonic
1063436040 10:6032394-6032416 AAGAAAATGAAAAAGTAGGCAGG + Intronic
1063829306 10:9933661-9933683 GAGTAAATAGAGAACTAGGTTGG - Intergenic
1064119795 10:12608802-12608824 TAGAAAATGGTTAAGTATGTTGG + Intronic
1064236248 10:13578679-13578701 GATCGAATGGAGAAGTAGATAGG + Intergenic
1066437887 10:35410940-35410962 GAGAATATTGAGAAATTGGTTGG + Intronic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1067392653 10:45878755-45878777 GAGAAAATGATGAAGTAGATGGG + Intergenic
1067860980 10:49847871-49847893 GAGAAAATGATGAAGTAGATGGG + Intronic
1067993591 10:51243490-51243512 AAGAACATGGGGAACTAGGTAGG - Intronic
1069510403 10:69037955-69037977 GAGAAAATGGAAAGGAAGGATGG + Intergenic
1069845612 10:71368819-71368841 GAGAAAATGGAGGAGGGGATTGG - Intergenic
1069871722 10:71537084-71537106 GGGAAAATGGAGATGGAGCTGGG - Intronic
1071079896 10:81798482-81798504 GGGAAAGTGGGGAAGTAAGTAGG + Intergenic
1071796021 10:89007354-89007376 GAGAAAGGGGAGAGGTTGGTTGG - Intronic
1072238042 10:93469930-93469952 GAGAAAATAAAGGAGTAGGCCGG + Intronic
1073838736 10:107473913-107473935 CTGAAAATGTAGAAGTAGGTAGG + Intergenic
1074167344 10:110894946-110894968 GTGTAAATAGAGAAGTAGATGGG + Intronic
1074447773 10:113534397-113534419 GAGAGAAGGGAGAGGTAGGGAGG - Intergenic
1074618274 10:115092783-115092805 GAGAAAAAGAAGAAATAGGCAGG + Intergenic
1074919417 10:117992360-117992382 TGTAAAATGAAGAAGTAGGTTGG - Intergenic
1075900811 10:126041549-126041571 AACAAACTGGAGAAGAAGGTAGG - Intronic
1076251905 10:128991405-128991427 GAGAAAATGGAAGAGGAGATAGG - Intergenic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1079352302 11:19702029-19702051 GAGAAGATGGAGAGGAAAGTGGG - Intronic
1080163291 11:29205136-29205158 GAGATAATAGATAAATAGGTAGG - Intergenic
1080290616 11:30666976-30666998 GAGCAAATGGGGAAGTAGGAAGG + Intergenic
1080315452 11:30942652-30942674 GAGAAAATGTAGAAATAGCTAGG - Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1081483139 11:43507268-43507290 GAGATAAAGCACAAGTAGGTAGG + Intergenic
1082041506 11:47689287-47689309 AAAAAAATTGAGAAGTGGGTAGG - Intronic
1082696230 11:56368021-56368043 GATATAATAGTGAAGTAGGTAGG - Intergenic
1084181080 11:67446349-67446371 GAGAAAATGGGCATGAAGGTGGG - Intergenic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085867149 11:80307914-80307936 GAGAAAATGGAGTTGTTGGTGGG + Intergenic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086286713 11:85259955-85259977 GAGTAAATGAAGAAATATGTTGG + Intronic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087530490 11:99375004-99375026 AAGAAAATGGAGAGCTAGGCCGG + Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088354189 11:108924934-108924956 TAGAAAATGTAGAAAGAGGTTGG + Intronic
1088487216 11:110352399-110352421 GACATAATGGAGAATGAGGTAGG + Intergenic
1088861244 11:113801684-113801706 GATAAAAGGTAGAATTAGGTGGG + Intronic
1089627312 11:119759619-119759641 GAGAAAATGGAGCAGGAAGAAGG + Intergenic
1089834735 11:121360017-121360039 GAGAAAATGGAGAGAAAGCTAGG - Intergenic
1090853752 11:130593756-130593778 GAGAAAATGAGGAAGGAGGTAGG + Intergenic
1090921399 11:131209206-131209228 GAGAGAATAGAGAAGTAATTTGG + Intergenic
1091004333 11:131938898-131938920 GAGAGACTGGTGGAGTAGGTGGG + Intronic
1091096304 11:132825467-132825489 GAGAAAATGGAGGCATAGATGGG - Intronic
1091854095 12:3724950-3724972 GAGAGAATGGAGAAGAAGAATGG + Intronic
1092174066 12:6390946-6390968 GAGAAAAGGCAGAAGAAGGGGGG + Exonic
1092731926 12:11542861-11542883 AAAAAAATGGAGGAGAAGGTGGG + Intergenic
1093829770 12:23741163-23741185 GTGAAAATGTAAAAGAAGGTAGG - Intronic
1094742633 12:33307311-33307333 GGGCAAATGGTGAAGGAGGTAGG - Intergenic
1095065496 12:37766984-37767006 GAGGATGTGGAGAAATAGGTGGG + Intergenic
1095244832 12:39907804-39907826 GAGAAAGTGGAGAATCAGGCAGG - Intronic
1095413492 12:41949152-41949174 GAGAAAATGCATAATAAGGTTGG + Intergenic
1095727929 12:45472955-45472977 GAGAAAAAGAGAAAGTAGGTGGG - Intergenic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1096329513 12:50698212-50698234 GAGAAAATGGAGAATTTTTTTGG + Intronic
1096612008 12:52808289-52808311 GAGAACATCAAGAAGCAGGTGGG - Exonic
1097285203 12:57871934-57871956 GAGAATATGAAGGAGGAGGTAGG - Intergenic
1097904309 12:64904389-64904411 GAGGAGATGGAGAAGGATGTGGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098594522 12:72256250-72256272 GGAAAAAAGGAAAAGTAGGTGGG - Intronic
1098694476 12:73535556-73535578 GAGAAAATGGTGAATACGGTTGG - Intergenic
1099497463 12:83368306-83368328 GAGAAGATGCAGAAGTAAGCAGG - Intergenic
1099652619 12:85447761-85447783 GAGATGATGAAGATGTAGGTGGG + Intergenic
1100215222 12:92440942-92440964 GAGAAGATGAAGAGATAGGTTGG - Intergenic
1100795601 12:98178675-98178697 GAGGAAATGGAGATTTAGGCTGG - Intergenic
1100825695 12:98472349-98472371 CAGAGAATGGAGAGGTGGGTTGG - Intergenic
1101304183 12:103511094-103511116 GAAAAAATGGAGGAGAAGATGGG + Intergenic
1101485035 12:105148109-105148131 GAGAAAATGGAAAGTTAAGTTGG + Intronic
1101870356 12:108560838-108560860 GAGAGACTGGAGGAGCAGGTGGG - Exonic
1102752963 12:115311845-115311867 GAGAAAATTGGACAGTAGGTAGG + Intergenic
1102774290 12:115505300-115505322 GAGAAAATGGAGAGAGAGCTGGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1103131796 12:118475508-118475530 AGGAAAGTGGAGAACTAGGTAGG + Intergenic
1103767542 12:123291759-123291781 GGGAAAAGGGAGAAACAGGTGGG + Exonic
1104172332 12:126293897-126293919 GATGAAATGGGGAAGTAGTTAGG + Intergenic
1104948742 12:132429275-132429297 GTGAAAATGGGGAAGTGGGCGGG - Intergenic
1105225580 13:18428511-18428533 GAGAAAATGGAGATTATGGTAGG - Intergenic
1106177023 13:27340401-27340423 GAGAGAATGGAGAAGCGGGGAGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106652807 13:31710034-31710056 GAGAAAATGGCAAACTAGGGTGG - Intergenic
1106674178 13:31940173-31940195 GACACTATGGAGAAGTAGGGGGG + Intergenic
1106815372 13:33401669-33401691 GAGAAAATGGAGAGGGAGCTGGG - Intergenic
1107314310 13:39114626-39114648 GAGATCATGGAGAAATAGGAAGG - Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1107642649 13:42459748-42459770 GAGGAAGAGGAGAAGTAGATTGG + Intergenic
1108132602 13:47319019-47319041 AAGAAAATGAGGAAGTAGGAAGG - Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1108862130 13:54874027-54874049 GATAAAATGCAAAAGAAGGTTGG - Intergenic
1108910515 13:55545406-55545428 GAGAAAAAGGAGAAAATGGTAGG + Intergenic
1109811164 13:67514485-67514507 GAGAAAACTGTGAAGTAGATTGG - Intergenic
1109839190 13:67900952-67900974 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1110995235 13:82099559-82099581 AAGAAAAAGTAGCAGTAGGTGGG + Intergenic
1114050846 14:18919068-18919090 GAAAAAATGGAAAAATAGTTTGG - Intergenic
1114055136 14:18961815-18961837 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1114107406 14:19439963-19439985 TAGAAAATGCAGAAGTAGCCTGG + Intergenic
1114111713 14:19482854-19482876 GAAAAAATGGAAAAATAGTTTGG + Intergenic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1115978891 14:39027922-39027944 CAGAAAATGTAGAAAAAGGTAGG + Intergenic
1116161403 14:41270433-41270455 GAGAAAATGGATTATAAGGTAGG - Intergenic
1116603473 14:46958650-46958672 GAGGAAAAGGAGAGGTAGATTGG + Intronic
1116676113 14:47907846-47907868 GAGAAAATGGAACACTTGGTAGG + Intergenic
1117442203 14:55770707-55770729 CAGAAAATGGTCAAATAGGTTGG + Intergenic
1117756654 14:58981358-58981380 GAGGAAATGGAGCTGTAGGGAGG - Intergenic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118438314 14:65791012-65791034 GTGGAAATGGAAAAGAAGGTTGG + Intergenic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1119530098 14:75353973-75353995 GACAAAATTGGGAAGGAGGTGGG - Intergenic
1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG + Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121557361 14:94848539-94848561 GAGAAAATGGAGCAGGAGAGTGG + Intergenic
1122271746 14:100571364-100571386 AAGAAAAGGAAGTAGTAGGTGGG - Intronic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124044969 15:26140320-26140342 GAGGAAGTGGAGAAAAAGGTGGG + Intergenic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1126397820 15:48237867-48237889 GGGAAAATGGTGTAATAGGTAGG + Intronic
1126499832 15:49333442-49333464 GAGAATATGCAGAAGAATGTAGG - Intronic
1126682053 15:51211994-51212016 GTTTAAATGGAAAAGTAGGTTGG + Intronic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1127293160 15:57588197-57588219 GAGAAAATGGAGCGGCAGGGAGG - Intergenic
1127298390 15:57629897-57629919 GAGAAAAGGGAGAAGTAAAGAGG - Intronic
1128356970 15:66934981-66935003 GAGAAGATGGAGAAGCCTGTGGG - Intergenic
1129043833 15:72715049-72715071 GAGTAGAGAGAGAAGTAGGTAGG + Intronic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129376545 15:75137334-75137356 GAGAAAATGGAGATGGACGCAGG - Intergenic
1129589020 15:76898737-76898759 GATAAGATGGGGAAGTAGGGAGG + Intronic
1129743904 15:78004720-78004742 GAGAAATTGGTTTAGTAGGTTGG - Intronic
1130138049 15:81197972-81197994 GGGAAACTGGAGAAATAGGAAGG - Intronic
1130441384 15:83957495-83957517 GAGAGAATGAAGAAGCAGTTGGG + Intronic
1130686774 15:86044608-86044630 GAGAAAATGGAGAAACAGAGAGG + Intergenic
1130707242 15:86244838-86244860 AAGAAAATTGAGAATTAAGTGGG - Intronic
1131021727 15:89104743-89104765 GAGGAAATGGAGATGGGGGTGGG - Intronic
1134020812 16:10920184-10920206 GTGTGAATGGAAAAGTAGGTGGG + Intronic
1134753609 16:16647136-16647158 GAGCAATTGGAAAAGTGGGTGGG - Intergenic
1134905401 16:17975665-17975687 GAGAATATGGAGAAGATGCTTGG - Intergenic
1134992450 16:18711907-18711929 GAGCAATTGGAAAAGTGGGTGGG + Intergenic
1135217846 16:20588310-20588332 GAGTAATTTGAGAAATAGGTAGG - Intergenic
1136287721 16:29254122-29254144 GAGGAAATGGAGCTGGAGGTGGG - Intergenic
1136901797 16:34048104-34048126 GAAAAAATAGAGATGTAGATGGG - Intergenic
1137560672 16:49500194-49500216 GAGAAACAGCAGCAGTAGGTGGG - Intronic
1138052024 16:53788641-53788663 GAGATAATGGAGATAGAGGTTGG - Intronic
1138143630 16:54589157-54589179 GGCTAAAAGGAGAAGTAGGTTGG - Intergenic
1138813071 16:60173503-60173525 GAGAAAATGGAGCATGAAGTTGG - Intergenic
1139173658 16:64662298-64662320 GAGAAAAGGAAGAAGTAGGGAGG - Intergenic
1139494507 16:67306554-67306576 GAGAAAATGGAGAGGCAGGACGG - Intronic
1139854250 16:69968093-69968115 GGGAAACAGGAGATGTAGGTTGG + Intergenic
1139883230 16:70191007-70191029 GGGAAACAGGAGATGTAGGTTGG + Intergenic
1140095632 16:71873349-71873371 GGTAAAATGGGGAAGGAGGTAGG + Intronic
1140188077 16:72792149-72792171 GAGAAACAAGAGAAGTATGTAGG + Intronic
1140193400 16:72837168-72837190 GAGAAAATGGAAAAGGATGAAGG - Intronic
1140369277 16:74404514-74404536 GGGAAACAGGAGATGTAGGTTGG - Intergenic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1141150989 16:81564638-81564660 GAGACAATGGGGCAGTGGGTCGG + Intronic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1142093345 16:88226750-88226772 GAGGAAATGGAGCTGGAGGTGGG - Intergenic
1142154161 16:88525695-88525717 GAGAAAATGGTGACGGAGGAAGG - Intronic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1143614456 17:8041313-8041335 GAGAAAATGGTTAAGAATGTAGG + Intronic
1143623412 17:8094272-8094294 GAGCAAAGGGAGAAGTGGTTTGG + Intergenic
1144461610 17:15463188-15463210 GAAACAATGGGGAAGTGGGTAGG + Intronic
1144877849 17:18411656-18411678 AAGAAAATGGAGAAGAGGCTGGG - Intergenic
1145154380 17:20532766-20532788 AAGAAAATGGAGAAGAGGCTGGG + Intergenic
1146505375 17:33400128-33400150 GAGAAAAGAGAGAAATTGGTGGG - Intronic
1146945606 17:36871000-36871022 GAGCCTATGGAGAAGTGGGTGGG - Intergenic
1147712194 17:42476557-42476579 GAGGCAATGGAGAAGTTGATTGG + Intronic
1147736531 17:42642315-42642337 GAGAAAGTGGAGATGCAGGAAGG - Intergenic
1147813313 17:43189564-43189586 TAGAATATGGAGCAGAAGGTAGG - Intronic
1148764390 17:50028738-50028760 GAGAAAATGGAGAGGAAGGACGG - Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148989933 17:51657039-51657061 GAGAAAATAGAGGTGGAGGTTGG + Intronic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149959941 17:61097521-61097543 GAGAAATTGGAAAAGTAGCAGGG + Intronic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1152315267 17:79576804-79576826 GAGAAGATGGAGATGGAGATGGG + Intergenic
1152341419 17:79728006-79728028 GAGAAAATGGAAACATACGTGGG + Intergenic
1152837526 17:82543584-82543606 GAGAAACCGGAGCAGTAGGAAGG + Intronic
1153388739 18:4531192-4531214 GAGGAAGTGGAGAAATAGGTAGG - Intergenic
1153647075 18:7204975-7204997 GAGAAAAGGGAGAAGCGGGGTGG - Intergenic
1154078254 18:11226464-11226486 GAGCATATGGAAAAGTAGGGAGG + Intergenic
1154195703 18:12264847-12264869 TAGAAAGTGGAGAAGTTGGCCGG - Intronic
1154355964 18:13623450-13623472 GAAAAAAAGGAGAAATAGCTCGG - Intronic
1154527799 18:15311011-15311033 GAGAAAATGGAGATTATGGTAGG + Intergenic
1155456336 18:26018829-26018851 GTGAAAATGGAAAGGTATGTGGG + Intronic
1155563587 18:27107984-27108006 GAGAAACTGGACAAGTAGACTGG - Intronic
1155758661 18:29536145-29536167 GAGAAACTAGAGATGTAAGTCGG - Intergenic
1155807785 18:30193354-30193376 GAGACAATTTAGAAGTTGGTGGG - Intergenic
1156818350 18:41339963-41339985 GAGAATATTGAGTAATAGGTAGG + Intergenic
1157209067 18:45725834-45725856 GAGAAATTTGAGAGCTAGGTAGG - Intronic
1157357522 18:46949215-46949237 GAGAAGGAGGAGAAGTAGTTAGG - Intronic
1157551955 18:48588323-48588345 GAGCAAGTGGAGAAGTGGCTGGG - Intronic
1157683460 18:49624891-49624913 GAGAACATGGAAACGAAGGTTGG - Intergenic
1157726683 18:49969834-49969856 GAGAGAATGGGGTAGAAGGTGGG - Intronic
1158095115 18:53761711-53761733 AAGAAACTTTAGAAGTAGGTGGG - Intergenic
1158428726 18:57363828-57363850 GAGAAAATGGAGAAACAGGGAGG + Exonic
1159071820 18:63631999-63632021 GAAAAAATGAAAAAGTAGCTAGG - Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159306198 18:66646042-66646064 GAGAAAATGGAGAAATTGAGTGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1160331108 18:77992356-77992378 GAGAAAGTGGAGGTGTAGATGGG + Intergenic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161501480 19:4618428-4618450 GAGAAAGTGGAGAAGAGGGAGGG - Intergenic
1162126038 19:8499956-8499978 CACTAAATGGAGAAGTAGGGAGG - Intronic
1163210124 19:15834141-15834163 GAGAAACTGTGGAAGTAGGGAGG - Intergenic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1164142426 19:22484792-22484814 GAGACAAGGGAGAATTAGGCAGG + Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164790248 19:30971453-30971475 GAGAGTCTGGAGAAGGAGGTGGG - Intergenic
1164943423 19:32269355-32269377 GAGAAAAAGAAAAATTAGGTAGG - Intergenic
1165144524 19:33722780-33722802 GAGAAAAGAGAGATGTGGGTGGG - Intronic
1166379438 19:42348168-42348190 GGTAAAATGGGGAAGAAGGTTGG + Intronic
1166568252 19:43778101-43778123 GAGGAAATGGAAAAGTAGAGAGG - Intronic
1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG + Intronic
1168286110 19:55334623-55334645 GAAAAAACAGAAAAGTAGGTCGG - Intergenic
925476964 2:4227935-4227957 GAACAAATCCAGAAGTAGGTGGG + Intergenic
925592396 2:5523267-5523289 GAGAAAAGAGAGAAGTAGGAAGG + Intergenic
926928106 2:18008772-18008794 GAGAAACTGGAGTAGGAGGGAGG - Intronic
927775007 2:25895910-25895932 GAGGAAGTGGAGGAGGAGGTGGG + Intergenic
928926533 2:36585489-36585511 GAGAAGAGGGAGAGGTGGGTGGG + Intronic
929060799 2:37922942-37922964 GAAAAGCTGGAAAAGTAGGTTGG + Intergenic
930381957 2:50641370-50641392 GAGAAAATGGAAGAGTGGGCAGG + Intronic
931151184 2:59575167-59575189 GTGAAACTGGAGAGTTAGGTAGG + Intergenic
931690172 2:64829066-64829088 GGGAAAAGGGAGAAGGAAGTAGG - Intergenic
932050349 2:68392143-68392165 GAGAAAAGGGGGAGGAAGGTAGG - Intronic
933263005 2:80151030-80151052 GCAAAAATGAAGAAGTAGGCAGG + Intronic
933485335 2:82914910-82914932 GAAAAGGTGGAGAAGTTGGTAGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
934582246 2:95452459-95452481 GAGAATTTGGAGAATTAGTTGGG - Intergenic
934597204 2:95624255-95624277 GAGAATTTGGAGAATTAGTTGGG + Intergenic
934719543 2:96564077-96564099 GAGAACTTTGAGAAGTGGGTTGG + Intergenic
934842680 2:97638749-97638771 GAGAATTTGGAGAATTAGTTGGG - Intergenic
935081980 2:99807262-99807284 GAGAAAACGGAGTGGTGGGTGGG + Intronic
935902831 2:107810953-107810975 GAGAAATAGGAGAAGTGGGGAGG + Intergenic
936346778 2:111681530-111681552 GAGCAGATGGAGAAATAGGAAGG - Intergenic
936351533 2:111716436-111716458 GAGAAAATGGAGAAAGAGAGGGG + Intergenic
936446262 2:112597889-112597911 AAGAAAATGTAGAACTAGGCTGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937514881 2:122641998-122642020 AAGAAAATGGAAATTTAGGTAGG - Intergenic
938468890 2:131542508-131542530 GAAAAAATGGGAAAGTAGTTTGG - Intergenic
938473146 2:131584604-131584626 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
938526895 2:132142468-132142490 GAGAAAATGGAGATTATGGTAGG + Intergenic
939062022 2:137433648-137433670 GAGAAAGTAGAAAAATAGGTGGG - Intronic
939202674 2:139058199-139058221 GACATAATGAAGGAGTAGGTAGG + Intergenic
939556658 2:143682828-143682850 GCGAAAAAGGAGAAGTGGGTAGG - Intronic
940146245 2:150547430-150547452 GAGAAAATGTAAATGAAGGTTGG + Intergenic
942088972 2:172469944-172469966 GAGTAAATGGAGATGTAGAGAGG + Intronic
942622657 2:177864207-177864229 GAAAATAGGGAGATGTAGGTCGG + Intronic
942762200 2:179412327-179412349 GAGAAATTGGAGAAGGGGGAGGG - Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943181336 2:184546039-184546061 GTGACAATGGAGAATGAGGTTGG - Intergenic
943510210 2:188816131-188816153 GGTAAAATGGTGAAGTAGGTGGG + Intergenic
943564088 2:189496895-189496917 GAGAAACTGGAGAAGTGTATAGG - Intergenic
943622011 2:190159065-190159087 GAGAAAATGCAGAAGGGCGTAGG + Intronic
944057414 2:195537598-195537620 GAGAAAATGGAGAACAAGAGAGG + Intergenic
944241199 2:197486933-197486955 GAGAAAATGAAGAAAAAGGCTGG - Exonic
944428454 2:199608114-199608136 ATGAAACTGGAGAGGTAGGTGGG + Intergenic
944517671 2:200528518-200528540 GAGGACATGGTGGAGTAGGTTGG + Intronic
944615766 2:201458592-201458614 GAGAGAAGGGAGAAGTGGCTGGG - Intronic
945549781 2:211206619-211206641 TAGAAGATAGATAAGTAGGTAGG + Intergenic
946131576 2:217610842-217610864 GAGAAAACGGAAAAGTACGGTGG + Intronic
946442657 2:219710031-219710053 GAGAATATGGAGGGGAAGGTTGG - Intergenic
946523066 2:220487530-220487552 AAGAAAAAAGAGAAGTAGTTAGG - Intergenic
946867077 2:224051371-224051393 GAGAAAAAGGAAAAAAAGGTAGG - Intergenic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
947687796 2:232105538-232105560 GAGAAACTAGGCAAGTAGGTAGG - Intronic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
947805633 2:232966146-232966168 GAGAATATGGAGCAAGAGGTAGG - Intronic
948553101 2:238788061-238788083 GAGAAAAAGTAGAAGTTTGTTGG - Intergenic
949005303 2:241643177-241643199 AACAAGATGAAGAAGTAGGTTGG - Intronic
1170661296 20:18343176-18343198 TAGACAATGGAGACTTAGGTTGG - Intergenic
1170949420 20:20923083-20923105 GAAACAATGGAGAAGTATATTGG - Intergenic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171161081 20:22924413-22924435 GATAAAAGGGAGCAGGAGGTAGG + Intergenic
1171993585 20:31715355-31715377 AGGAGGATGGAGAAGTAGGTGGG - Intronic
1172113935 20:32562921-32562943 GAGAGAGTGGAGAAGGAGGGTGG + Intronic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172234265 20:33359338-33359360 GAGAAAAGGGAGAAGTGGCTGGG - Intronic
1172280099 20:33701891-33701913 GAGAAGATTGAGAAGTCGGATGG + Intergenic
1173163916 20:40672617-40672639 AAGAAAAAGAAGAAGAAGGTGGG + Intergenic
1173184128 20:40827365-40827387 GAGAAAATGAAGAAGTATTGAGG - Intergenic
1173673988 20:44817896-44817918 AAGAAAAAAGAGAACTAGGTAGG + Intergenic
1175168061 20:57060276-57060298 GAGGCAATGGGGAAGTGGGTGGG + Intergenic
1175618311 20:60422315-60422337 GAGACAAAGGAGATGTAAGTAGG - Intergenic
1176769634 21:13057534-13057556 GAGAAAATGGAGATTATGGTAGG - Intergenic
1176984587 21:15421280-15421302 GAGAAAACAGAGAAGCAAGTAGG - Intergenic
1177066084 21:16438238-16438260 GAGAAAATTGAAAATTAGTTAGG + Intergenic
1177144433 21:17392246-17392268 GAGAAATGGGAGGAGTATGTTGG + Intergenic
1177316962 21:19474914-19474936 GATAAAATAGATAATTAGGTTGG - Intergenic
1177659335 21:24062619-24062641 TAGAAAATGGAGATGGTGGTCGG - Intergenic
1178063537 21:28877616-28877638 GAGAAAAGAGAGAAATAGGAAGG + Intronic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178989820 21:37343466-37343488 GAGAAAATGGAGACCTAGATGGG + Intergenic
1179116691 21:38499778-38499800 GAAAAAATGGAGAAGGAGAAAGG + Intronic
1180469323 22:15641443-15641465 GAAAAAATGGAAAAATAGTTTGG - Intergenic
1180473618 22:15684365-15684387 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1181325275 22:22040119-22040141 GACAAGATGGACAAGGAGGTGGG + Intergenic
1181359621 22:22324366-22324388 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181369693 22:22406104-22406126 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181761188 22:25059853-25059875 GGGAAAATGGAGAATTTAGTTGG + Intronic
1182817543 22:33179121-33179143 GGGATAATGGAGAAGTAATTAGG - Intronic
1183045890 22:35219758-35219780 GAGAAAATGCAAAAGCATGTGGG - Intergenic
1183102692 22:35593593-35593615 GAGAAAAGGGAGAGAGAGGTGGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183429710 22:37758121-37758143 GAGGCACTGGAGAAGGAGGTAGG + Exonic
1183591070 22:38779570-38779592 GAGACAATGGACAAGAAGTTCGG - Exonic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949252474 3:2003462-2003484 CAGAAAATGCATAATTAGGTAGG + Intergenic
949614303 3:5737053-5737075 GAGCAAATGGAGAAGGATGCAGG + Intergenic
951204597 3:19911999-19912021 GAGAAAATAGAGAAAGAGATAGG + Intronic
951265037 3:20554923-20554945 TAGGAAATGTAGAAGAAGGTAGG + Intergenic
952198133 3:31097461-31097483 GGGAAAAAGGAAAAGTAGGAAGG + Intergenic
952308240 3:32164168-32164190 GGGGAAAGGGAGAAGCAGGTTGG + Intronic
952676025 3:36031017-36031039 GAGAAAATGGTAGAGGAGGTTGG + Intergenic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
955109222 3:55931114-55931136 GAGGACATGGAGAAATAGGGAGG + Intronic
955129542 3:56151430-56151452 GAGCACAGGGAAAAGTAGGTAGG + Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955599960 3:60634699-60634721 GAGAAAGAGGAGAAGAAGTTTGG + Intronic
955948757 3:64221157-64221179 GACAGAATGGAGAAGCAGCTGGG - Intronic
955952180 3:64253419-64253441 GAGTAACTGGGGAAGTGGGTAGG - Intronic
956050336 3:65241168-65241190 GGAAAAATGGATGAGTAGGTAGG + Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956176429 3:66477513-66477535 GGCACAATGGAGCAGTAGGTAGG + Intronic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
957703494 3:83749292-83749314 GAGTTAATGAAGAAATAGGTAGG + Intergenic
957813333 3:85257072-85257094 AAGAAAATTGAGAAATAGGGAGG + Intronic
957941127 3:87005351-87005373 GATATAATGGAGAAAAAGGTGGG + Intergenic
959034905 3:101349831-101349853 GAAGAAATGGATAAGTGGGTAGG - Intronic
960183620 3:114612074-114612096 GGGAAAACAGAGAAGTAGGGAGG - Intronic
960272455 3:115689771-115689793 TAGAAAATGGAGAAAAAAGTGGG + Intronic
960409536 3:117305884-117305906 GAGGAAAAGGAGGAGAAGGTGGG - Intergenic
960474409 3:118106816-118106838 AAGAAAATGGTGAAGCAGGGAGG - Intergenic
960729847 3:120714879-120714901 GAGAAAATTTAGAAAAAGGTTGG - Intronic
961339276 3:126206316-126206338 GATAAAATGGCAAAGTAGGATGG - Intergenic
962316397 3:134362199-134362221 GAGAAAATAGAGACTCAGGTAGG + Intronic
962364921 3:134772510-134772532 GAGAAAATGGAGGAGAAGAGGGG - Intronic
962464273 3:135642196-135642218 GAGAAAATGGAGGAGGGGGAGGG - Intergenic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963388755 3:144631115-144631137 GATAATATTGAGAAGAAGGTAGG - Intergenic
963534213 3:146507803-146507825 TACAAAATGGAGAAGTTGGGAGG - Intergenic
964367812 3:155968439-155968461 GAACAAAAGGAGAAGGAGGTTGG + Intergenic
965424620 3:168506592-168506614 GAGAAAATGGTTAAGGAGGAAGG - Intergenic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965922301 3:173931830-173931852 GAGAAAATGGTGAATTGGGAAGG + Intronic
966028509 3:175316317-175316339 GAGAAAATGTAGATGAGGGTGGG - Intronic
966979464 3:185117752-185117774 GACAAGCTGGAGAAGTAGGCAGG - Intronic
967458852 3:189721998-189722020 AAGAAAGTAGAGAAGTAGGAAGG + Intronic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
969895052 4:10295859-10295881 GAGGAAATGGTGATGGAGGTAGG + Intergenic
970168366 4:13263565-13263587 GAGATAAGGGAAAAGAAGGTAGG + Intergenic
970548558 4:17155527-17155549 GAGAAAATGGAGATGTGGCAGGG - Intergenic
970855251 4:20643933-20643955 GAGAGAATGGAGAAGTGAGAGGG + Intergenic
971223463 4:24730442-24730464 GACAAAGTGGAGATGTGGGTAGG + Intergenic
972411629 4:38801187-38801209 GAGAAAATTGTGAAGTAATTAGG + Intronic
972496579 4:39639826-39639848 GAGATAATGGGGAAGTAGGAGGG + Intergenic
972685441 4:41348261-41348283 AAAAAAATGGAGAATTAGGTAGG - Intergenic
972818225 4:42668478-42668500 GAGAGAATGGATTAGCAGGTAGG + Intergenic
973001213 4:44953444-44953466 CAGAAACTGGATAAGTGGGTGGG - Intergenic
973075485 4:45919824-45919846 GAGAAAATTGAGAATCAGGAAGG + Intergenic
973845186 4:54904422-54904444 GAGAAAATTCTGAAGTAGCTTGG + Intergenic
974388687 4:61235818-61235840 AAGAGAATGGACTAGTAGGTGGG + Intronic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
977009468 4:91618551-91618573 GAGAAAAGGGAGAAGAAGAGTGG + Intergenic
977242565 4:94590879-94590901 TAGAAAATGAAGAAGCAGGGAGG + Intronic
978340513 4:107717738-107717760 GTGGAAATTGGGAAGTAGGTTGG - Intronic
978356334 4:107878581-107878603 GAGAGAATAGATAAATAGGTAGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979286329 4:118929115-118929137 GAGATAAAGGAAAAGTAGGAAGG + Intronic
979418475 4:120474037-120474059 GAGAAACTGTAGATTTAGGTAGG - Intergenic
979565534 4:122150754-122150776 GAGAAAAATGAAAAATAGGTGGG + Intergenic
979702701 4:123686344-123686366 ATGAAGATGGAGAGGTAGGTAGG + Intergenic
979712972 4:123802653-123802675 GAGAGCAAGGAGAAGTATGTAGG - Intergenic
979748420 4:124245432-124245454 GTGAAACTGGACAACTAGGTAGG + Intergenic
981141619 4:141276094-141276116 ATGAGAATGGAGAAGTATGTAGG - Intergenic
981511432 4:145562815-145562837 AAGAGAATGGAGAGGTAGGAAGG + Intergenic
981788094 4:148503341-148503363 AAGAAAATTAAGAATTAGGTGGG - Intergenic
981821831 4:148896225-148896247 GAGATAATGGCCAAGTAAGTTGG - Intergenic
982817068 4:159899232-159899254 GAGAAAATGCAGAATTCAGTAGG + Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983304607 4:165970494-165970516 GTGAAAGTGGAGGAGGAGGTTGG + Intronic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
983826419 4:172267711-172267733 GAGAAATAGGAGAGCTAGGTTGG - Intronic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984290658 4:177789747-177789769 GAGAAAAGGGAGAATAAGGAGGG + Intronic
984339052 4:178430187-178430209 GAGAAAACGCAGATGTAGGAAGG - Intergenic
985348726 4:189035326-189035348 GAGTAACTGGAGAATGAGGTGGG - Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986111961 5:4728225-4728247 GGGAAGATGGAGAAATAGGCTGG + Intergenic
986947360 5:13039283-13039305 GAGAGAAAAAAGAAGTAGGTAGG + Intergenic
986970363 5:13328125-13328147 GTGAAAATGGAAGAGTGGGTGGG - Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987229489 5:15878720-15878742 GAGAAAATGGAGACGCAGCCAGG + Intronic
988014885 5:25542674-25542696 GTGAAAATAGTGAAGTAGGAAGG - Intergenic
988415248 5:30938918-30938940 GAGAACATGGAGAATTAACTAGG - Intergenic
988868068 5:35357145-35357167 GACAAAATGGAGAAGAAGGAGGG - Intergenic
989527577 5:42470868-42470890 GGAAAAATGGAAAAGCAGGTTGG - Intronic
989697836 5:44224645-44224667 GAGAAGTTAGAGAAGAAGGTGGG + Intergenic
990256401 5:53975212-53975234 GAGAAAAACAAGAAATAGGTGGG + Intronic
990959841 5:61382858-61382880 GAGTGCATGGGGAAGTAGGTAGG + Intronic
991050588 5:62268638-62268660 GAGAAGAATTAGAAGTAGGTAGG + Intergenic
991169420 5:63603920-63603942 GAGGAAATGGAGAAAGAGATAGG - Intergenic
991195756 5:63930236-63930258 GAGAAAAAGGAAAAGTTGGGGGG + Intergenic
993040972 5:82814379-82814401 GAGAAAATGGAGCTGGAGCTTGG - Intergenic
994264580 5:97699927-97699949 GAGAAAATGTACAAGTGGGGAGG + Intergenic
994901115 5:105770688-105770710 AAGAAAATTCAAAAGTAGGTTGG + Intergenic
995072469 5:107940601-107940623 GAGAAAATGAAGTAGTTGGAGGG + Intronic
995634507 5:114170891-114170913 GAGATAATGGAGAAATGTGTTGG - Intergenic
995781340 5:115779053-115779075 AAAAAAATGCAGAAGTAGATAGG - Intergenic
995915998 5:117245624-117245646 GAGAGAATGAAGAAGGAGATGGG + Intergenic
996363828 5:122678847-122678869 CAGAAAATGGAAAATTAGCTGGG + Intergenic
996834041 5:127771556-127771578 TAGAAAATGCAGAAGTGGATTGG + Intergenic
996991086 5:129632977-129632999 GAGAGGATGGAGAGGTAGGAAGG - Intronic
998337995 5:141390317-141390339 GTGAATATGGAGAAATGGGTAGG - Intronic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
999465334 5:151798366-151798388 AAGCAAGTGGAAAAGTAGGTTGG + Intronic
1000329857 5:160197990-160198012 GAGAAAGAGGAGCAGGAGGTGGG + Intronic
1000743430 5:164998792-164998814 GAGATAAAGGAGAAGCAGGTGGG - Intergenic
1001421436 5:171590201-171590223 GAGAAAAAAGGGAAGTAGGAAGG - Intergenic
1001498121 5:172204685-172204707 GAGAAAATTGAGACCTAGGAAGG + Intergenic
1003237206 6:4306131-4306153 AATAAACTGGAGGAGTAGGTGGG - Intergenic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1003804651 6:9713614-9713636 GTGAAGCTGGAGAGGTAGGTGGG + Intronic
1004728836 6:18337914-18337936 TAGGAAATGGAGATGTAGGAAGG + Intergenic
1004989361 6:21119691-21119713 GGGGAAATGCAAAAGTAGGTGGG - Intronic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1006092262 6:31635030-31635052 GAGAAAAAGCAGAAAAAGGTAGG - Intronic
1006094680 6:31648623-31648645 GAGAAAAGGGAGAGGGAGGGTGG + Intronic
1006287516 6:33107930-33107952 AAGAAAATGGAGAAGCAGAGAGG - Intergenic
1007136413 6:39525915-39525937 GGGAAAATGGAAATGTTGGTCGG + Intronic
1007304086 6:40890955-40890977 GACATCATGGAGAAGAAGGTGGG - Intergenic
1007993868 6:46285637-46285659 GAAATAAAGGAAAAGTAGGTAGG - Intronic
1008071705 6:47104999-47105021 GTGAAAATGGAGGAGTGAGTTGG - Intergenic
1008221808 6:48863405-48863427 GGGGAAATGGTGAAGGAGGTTGG - Intergenic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1009667132 6:66697470-66697492 GAGAAAGAGGAGAAGAAAGTTGG + Intergenic
1010355681 6:74930024-74930046 GAGGAAGAGGAGAAGTAGGAAGG + Intergenic
1010741174 6:79507066-79507088 TAGAAAATGGAGGAGTATTTTGG - Intronic
1010952213 6:82050155-82050177 GAGAAAGAGCAGAAGTAGGAAGG - Intergenic
1011959111 6:93064945-93064967 GAGAATATGGAGAAGAATGTGGG - Intergenic
1012057796 6:94436996-94437018 GAGAAAATGATGAAGTAAATAGG - Intergenic
1012255301 6:97024366-97024388 GTGAACATGAAGAAGTATGTGGG + Intronic
1012398494 6:98825553-98825575 GGGAAAAGGGAGGAGTAGGGGGG - Intergenic
1013235195 6:108192289-108192311 GTGAAAATGTAGAACCAGGTTGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013805145 6:113988495-113988517 GAGAAAATTGAGAAATAGAGAGG + Intronic
1014214281 6:118737661-118737683 GAGAAAGAGGAGAACTAGGAGGG + Intergenic
1014266121 6:119279710-119279732 GAGAAAGCGGAGGAGAAGGTAGG - Intronic
1014451632 6:121588244-121588266 GTGAGAATGTAGAAGTAGTTTGG + Intergenic
1016239289 6:141909672-141909694 GAGCAAATCCAGAGGTAGGTCGG + Intergenic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1016895326 6:149045758-149045780 AAGAAAATGGAGAACTAGAAGGG - Intronic
1018316518 6:162562054-162562076 GAGGAGATGGAGGAGTAGGGAGG + Intronic
1018330261 6:162719959-162719981 AATAAAATGGAGAAATAGGAAGG - Intronic
1020527713 7:9284172-9284194 GAGAAAATGCTGCAGTAGGAGGG - Intergenic
1020632523 7:10656670-10656692 GGGAGACTGGAGAAGGAGGTGGG + Intergenic
1020695859 7:11413537-11413559 GAGAAAAGCGAGATGAAGGTGGG - Intronic
1021255518 7:18387555-18387577 TAGAAAATGAGGAAGGAGGTAGG + Intronic
1021781918 7:24114600-24114622 GAGAGAATGGATTTGTAGGTAGG + Intergenic
1021871382 7:25009807-25009829 AAGAAAATGAAGATGTAGGTGGG - Intergenic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1022840177 7:34156978-34157000 GAGAAACTTGAAAAGTAGGAAGG + Intergenic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1023028313 7:36071916-36071938 TAGATAATGGAGAAATAGCTGGG - Intergenic
1023082316 7:36537072-36537094 GAAAGGCTGGAGAAGTAGGTGGG - Intronic
1023552184 7:41382271-41382293 GAGAAAATGGAAAAGGAAGGAGG - Intergenic
1024214917 7:47240515-47240537 GTGAAAATGGAGAATTGGGAGGG - Intergenic
1024710408 7:52009115-52009137 GAGAAAATGAGGAAGAAGGTGGG - Intergenic
1024957723 7:54942144-54942166 GAGCATATGGAAAAGTAGGGAGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026336551 7:69398748-69398770 GAGAAAAGGGAGAATAAGGAAGG + Intergenic
1028191776 7:87862148-87862170 CAGAAAAAAGATAAGTAGGTTGG - Intronic
1028378217 7:90170089-90170111 GAGAGAATTAAGAAATAGGTAGG - Intronic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1029197957 7:98819629-98819651 GAAAAAAAGGAGAAAAAGGTGGG + Intergenic
1029322512 7:99777070-99777092 GAGATAATAGAGAAATAGATTGG - Intronic
1029549617 7:101230737-101230759 GAGAAGAGAGAGAAGTAGATGGG + Intergenic
1030122171 7:106120534-106120556 GAGAAAATGGAAACTTAGGAAGG - Intergenic
1030345337 7:108427005-108427027 TGGAATATGGAGAAGTAGATTGG - Intronic
1030395444 7:108980822-108980844 GAGAGAATGGTGAAGGTGGTGGG - Intergenic
1030740890 7:113108583-113108605 TTGAAAATGAAGAAGTAGTTTGG + Intergenic
1030835942 7:114285426-114285448 AAGAAAATGGAGAAGTTTGTGGG + Intronic
1030921717 7:115397696-115397718 GAGAAAAAGGAGATTGAGGTTGG - Intergenic
1030999638 7:116399786-116399808 GAGAAATTTGAAAAGTTGGTGGG - Intronic
1031723409 7:125206365-125206387 TACAAAATAGAGAAATAGGTTGG + Intergenic
1031747958 7:125528715-125528737 GAGAAAATTGGTGAGTAGGTAGG - Intergenic
1031789265 7:126079621-126079643 GAGAAGATAGAAAAATAGGTGGG - Intergenic
1031942346 7:127802244-127802266 GAGAAAATCCAGATGTAAGTGGG + Intronic
1032783253 7:135181264-135181286 GAGACAAGGGAGAATTAGGCAGG - Intergenic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033168457 7:139062475-139062497 CAGAAAATGGAGGAGTCAGTGGG - Intronic
1033254954 7:139792429-139792451 GAGAATAAAGACAAGTAGGTAGG - Intronic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1034561815 7:151885208-151885230 GAGAGAATGGAAGAGTAGGAGGG + Intergenic
1035076005 7:156177994-156178016 GGGAAGAGGGAGAAGTGGGTAGG + Intergenic
1036791530 8:11724475-11724497 CAGAAAATGAAGAATTACGTTGG - Intronic
1036916644 8:12810722-12810744 GAGCAAAGGGAGAAGAAGGAAGG - Intergenic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037512777 8:19600374-19600396 TACAAAATAGAGAAGTAGGCTGG - Intronic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1038093108 8:24276569-24276591 GTGAATATGGAGAAGTAGCTTGG - Intergenic
1038548539 8:28444925-28444947 GTGAAAATGAAGAAATAGGCCGG - Intronic
1038559540 8:28560009-28560031 AAGGAAGTGGATAAGTAGGTAGG + Intronic
1038584564 8:28777360-28777382 GAGAAAGGGAAGAAGTAGCTGGG - Intronic
1039172950 8:34769429-34769451 TAGAAAATGGGGAAGTAAGTGGG - Intergenic
1040287402 8:46107499-46107521 GAGAAAATGAAGCAGCAGGGTGG - Intergenic
1040287491 8:46107929-46107951 GAGAAAATGGAGCAGCAGTGTGG - Intergenic
1040308105 8:46222736-46222758 GAGAAAATGGAGCCATAGGGTGG + Intergenic
1040316420 8:46263289-46263311 GAGAAAATGGGGCTGCAGGTTGG + Intergenic
1040330698 8:46384321-46384343 AAGAAAACGGAGAAGCAGGGTGG + Intergenic
1040336801 8:46420218-46420240 GCGAAAACGGAGCAGTAGGGTGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041285427 8:56256298-56256320 GAGTAAATGGAGAAATTGATAGG - Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041482666 8:58340656-58340678 GAGAAAATTGATAAGTTGATCGG - Intergenic
1041847378 8:62346070-62346092 GAGAGAGTGGAGAGGAAGGTGGG + Intronic
1042552200 8:70004092-70004114 GAGAAAAGGGAGAAAGTGGTAGG + Intergenic
1042813957 8:72857483-72857505 GTGAGGCTGGAGAAGTAGGTTGG + Intronic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044278295 8:90327541-90327563 GAGTAGATGGAGGAGTAGGTTGG - Intergenic
1045514733 8:102848615-102848637 CTGAAAAGGGACAAGTAGGTGGG + Intronic
1045584919 8:103523495-103523517 TTGAAAATGGACCAGTAGGTTGG + Intronic
1045680427 8:104653747-104653769 GAGAAAACGGGGCAGGAGGTGGG + Intronic
1045743448 8:105388317-105388339 GAGAAAAGGGAAAAGGAGATGGG + Intronic
1046302955 8:112321995-112322017 GAGAAAATGGAGAAGATAGGGGG + Intronic
1047106658 8:121738847-121738869 GGGAAAACGGAGAAGAAAGTAGG + Intergenic
1047427876 8:124763236-124763258 GAGAAAAAGGAAAAAAAGGTGGG - Intergenic
1047554690 8:125916396-125916418 GAGAAAATGGATAAGAAGAAAGG - Intergenic
1047868824 8:129059856-129059878 GAGGAAATTGAGGAGTAGATAGG - Intergenic
1048007582 8:130431856-130431878 GAGGAAAGGGAGGAGTAGGAGGG + Intronic
1048383119 8:133885850-133885872 GAGAGACTGGAGAAGGAGGGAGG + Intergenic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048987583 8:139743045-139743067 GAGAAAATGTGGAAGGTGGTGGG + Intronic
1049024335 8:139978534-139978556 GAGGAAATGGGGAAATAGGTAGG + Intronic
1050256999 9:3804416-3804438 GAGAGAAAGGAGAAGTTGTTTGG - Intergenic
1050395999 9:5196513-5196535 GAGGAGGTGGAGAAGTAGGGAGG - Intergenic
1050475910 9:6040922-6040944 GAGAAGATGAAGAAGTAAGGAGG - Intergenic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1051050313 9:12924682-12924704 GAGCAAATGGAGGAGTGGGGTGG - Intergenic
1051765244 9:20515499-20515521 GAGAAAATGGGGGAGGAGGAAGG + Intronic
1052473811 9:28932769-28932791 AAGAAATTTGAGAAGTAGCTGGG - Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053420008 9:37971386-37971408 GGGAAAGTGGAGAGGTGGGTGGG - Intronic
1053421466 9:37982494-37982516 AAAAAAATGGATAAGTAGGCCGG + Intronic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055810610 9:80143678-80143700 TAGAAAAAAGAGAAGTTGGTCGG + Intergenic
1055933366 9:81582125-81582147 GAGAAAATAGGGAAGTAAGGCGG + Intergenic
1056242626 9:84663670-84663692 GAGGAAAGAGAGAAGTAGGCAGG - Intergenic
1056550149 9:87646088-87646110 GGGAGAATGGAGAAGCAGATGGG - Intronic
1056896074 9:90551777-90551799 TAGATAATGGATAGGTAGGTAGG + Intergenic
1058213803 9:102206302-102206324 GAGAAAAGGGAGTTATAGGTAGG + Intergenic
1058363309 9:104176477-104176499 GGGAAAAGGGAGAAGTAGAGAGG + Intergenic
1058378286 9:104350287-104350309 AAGAAAATGGAGAAAGAGTTGGG + Intergenic
1058478498 9:105366206-105366228 GAGAAAGTGGACAAGTATGGAGG + Intronic
1058809313 9:108624357-108624379 GAGAAAATAGAAAACTTGGTTGG - Intergenic
1058815923 9:108682820-108682842 GAGATCATGGAGAGGGAGGTGGG - Intergenic
1058928464 9:109692906-109692928 GAGAAAAGAGAGATGGAGGTGGG - Intronic
1059055645 9:110976566-110976588 AAGGAAATGGAGAGTTAGGTTGG - Intronic
1060071515 9:120553418-120553440 GAGAAACTGGGGATGTTGGTAGG - Intronic
1060495061 9:124112407-124112429 GAGTAACTGGAAAAGTAGCTTGG - Intergenic
1060611875 9:124973939-124973961 AAGAACATGGAGAACTAGATGGG - Intronic
1061025925 9:128049461-128049483 AAGAAAGTGGAGAAGTTGGCCGG + Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185666482 X:1769237-1769259 GAGAAGATGGAGACAGAGGTTGG + Intergenic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186458770 X:9731698-9731720 GAGAAAATGGAATTGTAGGAGGG + Intronic
1186720797 X:12301373-12301395 GAGAAGCTGCAGAAGTAGGTTGG - Intronic
1186904165 X:14093500-14093522 GATAAAATAGAGCAGTAGGTTGG + Intergenic
1186965173 X:14779185-14779207 GAGAAAATGGTGAAGGAGTTAGG - Intergenic
1187087117 X:16052085-16052107 GTAAAAATGGACAAGTAAGTGGG + Intergenic
1187487281 X:19716537-19716559 GAGAAAATGTAGAACTAGTAGGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187928175 X:24269521-24269543 GAGAGAATGGAGAGGTATGGGGG + Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188249164 X:27870877-27870899 GAGAATGGGGAGATGTAGGTTGG - Intergenic
1188919440 X:35954311-35954333 GAGAAAATAGAGAATTAGGAAGG + Intronic
1189055399 X:37694386-37694408 GAGGAGATTGAGAAGGAGGTGGG + Exonic
1189091015 X:38082895-38082917 GAGGAGATGGAGAGGTAAGTTGG + Intronic
1189686711 X:43572247-43572269 GAGGAAATGTAGAAGAAGGTAGG - Intergenic
1189705769 X:43757163-43757185 GAGAATGTGGACAAGCAGGTGGG - Intergenic
1189798481 X:44669987-44670009 GAGAAAATGGAGAACTATTTAGG - Intergenic
1191590097 X:62873049-62873071 GAGCAAATGGTGAAGGAGCTGGG - Intergenic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1191757789 X:64613043-64613065 GAGAAAATTGAGATGAAGCTAGG - Intergenic
1192003283 X:67180521-67180543 GAGGTAATGCATAAGTAGGTTGG - Intergenic
1192567335 X:72176147-72176169 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1193377145 X:80774874-80774896 GAGAAACTGGAGAGGCAGGTAGG - Intronic
1193476646 X:81974284-81974306 GAGGACATGGAGAAATAGGAAGG + Intergenic
1195031616 X:100932104-100932126 CTGAAAATAGAGAAGTTGGTGGG - Intergenic
1195065668 X:101236128-101236150 TAGGAAAGGGAGAAGTGGGTGGG - Intronic
1195198357 X:102520893-102520915 GAGAAAATGGAGGATAAGGAAGG - Intergenic
1195370201 X:104166252-104166274 GAGAAAGCGGAGGAGGAGGTTGG + Intergenic
1196008419 X:110859971-110859993 GAGAGAATGGGCAACTAGGTGGG + Intergenic
1196316969 X:114238306-114238328 GAGAATGTGGAGAAATAGGAAGG - Intergenic
1196500116 X:116371162-116371184 GAGATAAGTGAGGAGTAGGTGGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197144211 X:123153679-123153701 GAAAAAATGGAGGAATAGGGAGG - Intergenic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1198025448 X:132701598-132701620 GAGAAGATGGGGAAGCAGGTGGG - Intronic
1198320691 X:135516358-135516380 GAGAAAATTGAAAAGAAGATAGG + Intergenic
1198701730 X:139404230-139404252 GAAAATATGGAAAAGTGGGTTGG + Intergenic
1198841190 X:140859971-140859993 GAGAAAGTAGAGAAGGAGATGGG + Intergenic
1201431624 Y:13908546-13908568 GAGAAAATGGGGAAAGAGGAAGG - Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic