ID: 905037409

View in Genome Browser
Species Human (GRCh38)
Location 1:34927158-34927180
Sequence TGGGACTCCTTGCCAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905037409_905037412 1 Left 905037409 1:34927158-34927180 CCTCTCTTTGGCAAGGAGTCCCA 0: 1
1: 0
2: 2
3: 15
4: 184
Right 905037412 1:34927182-34927204 GCTGAAAGATGTACAGCCTTAGG 0: 1
1: 0
2: 0
3: 20
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905037409 Original CRISPR TGGGACTCCTTGCCAAAGAG AGG (reversed) Intronic
902292218 1:15442758-15442780 TGGGAGTCTTGGCCAATGAGGGG - Intronic
905037409 1:34927158-34927180 TGGGACTCCTTGCCAAAGAGAGG - Intronic
906523592 1:46481143-46481165 TAAGTCTCCTTGCCAATGAGAGG - Intergenic
906590196 1:47017761-47017783 TGGGACAACTTGCCAGAGGGAGG - Intergenic
908353187 1:63306383-63306405 TGGGTGTCCTTCACAAAGAGGGG - Intergenic
909444121 1:75729472-75729494 TGTGACTTCTAGCCAAAGACTGG + Intronic
910515678 1:88057208-88057230 TGGAAATCCTTTTCAAAGAGAGG + Intergenic
911425142 1:97700177-97700199 TGCGACTTCTTACCAAAGGGAGG + Intronic
915903559 1:159862710-159862732 TGGGACTCCTCCCCAAGGCGGGG - Intronic
916869787 1:168901231-168901253 TGGGACACTTTGCTGAAGAGAGG - Intergenic
918086660 1:181251329-181251351 TTGGGCTCCTTGCAAAACAGGGG + Intergenic
918781404 1:188704394-188704416 GGGGACTCCCTCCAAAAGAGGGG - Intergenic
920045931 1:203132357-203132379 AGGGTCTCCTTCCCACAGAGAGG - Intronic
920089793 1:203444242-203444264 TGGGCCTCCTTGCAACATAGTGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922074835 1:222233418-222233440 TGGGTCCCCTTGGCCAAGAGGGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1062923868 10:1299785-1299807 TTGGGCTCCTGGGCAAAGAGAGG + Intronic
1063278883 10:4602611-4602633 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1063364929 10:5484940-5484962 TGGGAATCATTTCCAAAGATGGG - Intergenic
1064001693 10:11668847-11668869 TGGAACTTCTTCCCAAAGAATGG + Intergenic
1064694056 10:17948152-17948174 TGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1070415234 10:76183061-76183083 GGGGACTCCTTCCTAAAGATGGG - Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1076273986 10:129181234-129181256 TGGGAGTCCTTTCCAAAACGTGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081469201 11:43353921-43353943 TGTAACTCCTTGTCTAAGAGAGG + Intergenic
1081660085 11:44882739-44882761 TGGGACTCAAGGCCAGAGAGTGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083682652 11:64358604-64358626 TGGGACCCCATGGCAAGGAGAGG - Intergenic
1084365440 11:68694514-68694536 GGGGTCTCCTTGGCCAAGAGAGG - Intergenic
1084877813 11:72146522-72146544 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1085015348 11:73170161-73170183 TGGGAGTCCTGGGCAATGAGGGG + Intergenic
1087680635 11:101215189-101215211 TTGGGCTACTTGCCAAACAGGGG - Intergenic
1088749806 11:112834196-112834218 TGGGATTCACTGACAAAGAGTGG + Intergenic
1089358956 11:117873901-117873923 TGGGACGCCCTTCCAAAGTGAGG - Intronic
1091977159 12:4834740-4834762 TGGGACTACAGGCCAAAGTGGGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094836533 12:34324765-34324787 TGGGCATCCTTGCCACAGTGCGG + Intergenic
1094837654 12:34329678-34329700 TGGGCCTCCTTGCCACATTGAGG + Intergenic
1099555468 12:84103990-84104012 CTGGGCTACTTGCCAAAGAGGGG - Intergenic
1101511158 12:105393632-105393654 TTGGACTCCTTGCTACAGAAAGG - Intronic
1101648655 12:106654740-106654762 TGGGAGTCCTCTGCAAAGAGTGG + Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1106997195 13:35499396-35499418 ACGGACTCCAAGCCAAAGAGTGG - Intronic
1107407482 13:40128073-40128095 TGGGACTCCATGCCAACTAGAGG - Intergenic
1107798049 13:44075012-44075034 TGGGAGACCCTGCCAAAAAGAGG + Intergenic
1110843215 13:80166257-80166279 TGGGGCTTCCTGCCAAAAAGTGG - Intergenic
1111856798 13:93647994-93648016 AAGGACTCCTTTCCAAAGTGTGG + Intronic
1113024280 13:105923192-105923214 TGGGACTCCTTTCTAATTAGGGG + Intergenic
1113969458 13:114177351-114177373 TGGGACTCCTTCCCTGAGGGTGG + Intergenic
1114483731 14:23050765-23050787 TGGGAGACCTGGCCTAAGAGAGG - Intronic
1119752919 14:77093121-77093143 GGGGACTGCTTGGCCAAGAGGGG + Intergenic
1120210005 14:81624560-81624582 TGAGTCACCTTGCAAAAGAGAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121453474 14:94024070-94024092 TGGGGCTCCATTGCAAAGAGTGG + Intergenic
1122070719 14:99203918-99203940 TGGCACTCCTTGGCTCAGAGCGG - Intronic
1122155126 14:99746274-99746296 TGGCACTCTTTTCCAAAGAAGGG + Intronic
1122417324 14:101556685-101556707 TGGGGCTCCCGGCCAAGGAGAGG - Intergenic
1122643871 14:103178477-103178499 TGGAACCCCTGGCCAGAGAGAGG - Intergenic
1202923074 14_KI270724v1_random:2838-2860 TTGGACCCCTAGCCAAAGCGAGG - Intergenic
1124291400 15:28456284-28456306 TGGGATTCCAGGCCAAGGAGGGG - Intergenic
1124662022 15:31557666-31557688 AGGGACTGCTTTCCAAGGAGTGG - Intronic
1125414116 15:39434811-39434833 TGGGACTCAGAGCCACAGAGGGG + Intergenic
1125880541 15:43190184-43190206 TGGGGTTCCTTGCCTCAGAGGGG + Intronic
1127397665 15:58555673-58555695 TGGGACTCCTTACAACAGGGTGG + Intronic
1129893391 15:79086823-79086845 GGGGACTCCATGCCAAAGAAGGG + Intronic
1132180755 15:99751025-99751047 TGGCACTCCTAACAAAAGAGAGG - Intergenic
1138031475 16:53562713-53562735 TGGGCCTGCTTGACTAAGAGAGG + Intergenic
1138062001 16:53901568-53901590 TGGGACTGTTAGCCAAGGAGTGG - Intronic
1139661532 16:68424185-68424207 CAGTACTCCTGGCCAAAGAGAGG - Intronic
1141264748 16:82486912-82486934 TGGGTCACCTTGCCAAAGCTGGG - Intergenic
1142008615 16:87702274-87702296 CGGCCCTCCTTGCCAAACAGTGG - Intronic
1143995393 17:11002364-11002386 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1144367603 17:14559637-14559659 TGGGACACCTTTAGAAAGAGTGG + Intergenic
1147653112 17:42072997-42073019 TGAGTTTCCTTGCAAAAGAGGGG - Intergenic
1148053149 17:44779115-44779137 TGCGACCCCTTGCCCCAGAGCGG - Intronic
1148499541 17:48079118-48079140 TGAGACTCCATCTCAAAGAGGGG - Intronic
1150069774 17:62140574-62140596 CGGGACTCCCCGCCAAAGAAGGG - Intergenic
1152792756 17:82290976-82290998 TGGGACCCCTTGGCCAAGAGGGG + Intergenic
1152979601 18:263878-263900 TGGGACTTCTTGGCAAAGTTGGG + Intronic
1153769149 18:8401388-8401410 TTGGTCTCCTTGGCACAGAGTGG + Intronic
1155649423 18:28122533-28122555 TTGGACTCCATGGTAAAGAGTGG + Intronic
1158726792 18:59980880-59980902 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1160300316 18:77672278-77672300 TGGCACTCCGTGCCAATGAACGG + Intergenic
1162754106 19:12847118-12847140 TGGGACTCTTGGCCACAGACAGG - Intronic
1164981351 19:32616805-32616827 TGGGACTCCTGGGCCACGAGAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166913487 19:46177847-46177869 TGGGTCACCTTGGCCAAGAGAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168316337 19:55486347-55486369 AGGGCCTCCTGGACAAAGAGAGG - Intronic
925191189 2:1885114-1885136 AGGGACACTTTGCCAAAGATTGG - Intronic
926136874 2:10342726-10342748 CCGGACTCCTGGGCAAAGAGAGG + Intronic
926806552 2:16716838-16716860 TTGGACTCCTTGCCAGGGAGGGG + Intergenic
927088795 2:19694843-19694865 TGGGACCTCTTTCCACAGAGAGG + Intergenic
927889722 2:26740822-26740844 TGGGACTCCTCGAAAAAGATGGG - Intergenic
939653744 2:144796524-144796546 TGGGATTCCTGGCCCAAAAGGGG + Intergenic
940544271 2:155063124-155063146 TGTGAATGCTTACCAAAGAGTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941904931 2:170711563-170711585 TGAGTCTCCTTGGCAAGGAGTGG + Intergenic
942625347 2:177894489-177894511 TGGGTCCCCTTGGCCAAGAGGGG - Intronic
947368555 2:229422196-229422218 AGGCACTCCTTCCAAAAGAGAGG + Intronic
1169410413 20:5364500-5364522 TGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1169901133 20:10552563-10552585 GGGGACTGCCTGCCAAACAGTGG + Intronic
1170762217 20:19261122-19261144 GGGGATTCCTTGCCTCAGAGAGG - Intronic
1175297575 20:57919589-57919611 TGGGGCTCCTTGCCCAAGTGTGG + Intergenic
1175381765 20:58568648-58568670 TGGGAGTCATTGGCAAAGGGAGG - Intergenic
1176196386 20:63838095-63838117 AGGGACTCCTTTCCAAAGAGCGG + Intergenic
1179066555 21:38030054-38030076 TGTGAGTCCTTGCCAAGAAGTGG - Intronic
1179467922 21:41590087-41590109 TGGGACTCTCTGCAAAATAGAGG - Intergenic
1181672108 22:24430522-24430544 AGGGAAGCCTTGCCAAACAGAGG + Intronic
1181750863 22:24988369-24988391 TGGGAATCCTTCCCACTGAGCGG - Intronic
1182762242 22:32732147-32732169 TGGGAATACTTCCCAAACAGAGG - Intronic
1184918332 22:47588522-47588544 GGGGACTCCTTGGCCAAGAGGGG - Intergenic
949966532 3:9361557-9361579 AGGGTCTCCTTGGCCAAGAGAGG - Intronic
950206586 3:11085485-11085507 TGGGTCCCCTTGGCCAAGAGTGG - Intergenic
955405840 3:58625167-58625189 GGGGTCTCCTTGGCCAAGAGGGG - Intronic
957874224 3:86124562-86124584 TGGAACTCCTAGGCAAAGACTGG - Intergenic
957875959 3:86147052-86147074 TGCCAGTCCTGGCCAAAGAGGGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962431954 3:135328119-135328141 CAGGACTCCATGCCAAAGAGGGG + Intergenic
962599674 3:136982146-136982168 TCGTACTCCCTGTCAAAGAGAGG - Exonic
962704992 3:138034464-138034486 TGGGAAACCTAGCCAAAGGGAGG + Intergenic
963286649 3:143440178-143440200 TGGGTCTCCCTGCAGAAGAGAGG - Intronic
965792513 3:172404839-172404861 TCGGAGCCCTTGACAAAGAGTGG + Intergenic
966906140 3:184527128-184527150 TAGGACCCCATTCCAAAGAGGGG - Intronic
968967217 4:3775210-3775232 TGGGGCTCCCTGCCAAGGTGGGG + Intergenic
969636490 4:8372432-8372454 GGGGTCTCCTCGCCAGAGAGGGG - Intronic
970390084 4:15600370-15600392 TGGGAGGACTTGCAAAAGAGTGG - Intronic
971367787 4:25991468-25991490 TGGGAATCCTTGCCTAAAGGCGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972511217 4:39770355-39770377 TTGAACTCCTTGCCACAGCGAGG + Intronic
976339513 4:83931456-83931478 TGGAACTCCATGCCACACAGAGG - Intergenic
976885430 4:89978017-89978039 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
984240895 4:177218289-177218311 TGGGTCTCCTTGGCCAAGAGGGG - Intergenic
985659121 5:1147153-1147175 TGGGTCCCCTTGTCCAAGAGGGG - Intergenic
985912842 5:2896802-2896824 AGGGACTCCTTCCCACTGAGGGG + Intergenic
987144958 5:14982911-14982933 TGGGACCCCTTGGCCAAGAGAGG - Intergenic
987722380 5:21654695-21654717 GGTGACACCTTTCCAAAGAGAGG - Intergenic
990538859 5:56752143-56752165 TAGGACTCCCTGCCAAAGAGTGG + Intergenic
998401211 5:141850011-141850033 TCACACTCGTTGCCAAAGAGTGG + Intergenic
998571385 5:143261788-143261810 TTGGACTCTTTGCCACAAAGAGG + Intergenic
999749160 5:154613748-154613770 TGACATTCCTTGCCAAAGTGCGG + Intergenic
1002948245 6:1783139-1783161 AGTGAGACCTTGCCAAAGAGAGG + Intronic
1003153510 6:3572198-3572220 TTGCACTCATTGCCAAAGGGTGG - Intergenic
1003867386 6:10375775-10375797 TGGGACTCATTGCCAACAAAGGG - Intergenic
1005923290 6:30418849-30418871 TGGGAAACCTCCCCAAAGAGAGG - Intergenic
1007807848 6:44463917-44463939 TTGGATTCCTTTCCAAAGTGTGG - Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011253235 6:85394829-85394851 GGGGTCTCCTTGGCTAAGAGGGG + Intergenic
1012367835 6:98464053-98464075 TGGAACCCTTTGCCAAAGTGTGG + Intergenic
1013409857 6:109874340-109874362 TAGGAACCCTTGCCAGAGAGTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015739679 6:136440419-136440441 AGGCACTCCTTGCCAAGGAGAGG + Intronic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1017063648 6:150508774-150508796 GGGGTCCCCTTGGCAAAGAGGGG - Intergenic
1020459557 7:8413161-8413183 TGGGACTCCTTGTAAAGGATTGG + Intergenic
1021904258 7:25317565-25317587 AGGGTCTCTTTGCCAAGGAGTGG + Intergenic
1023019264 7:35995632-35995654 TGAGAGTCCTTGGCAAAGTGAGG - Intergenic
1023063757 7:36354287-36354309 TGGAACTCCTTGACAATGATGGG + Intronic
1024235245 7:47392753-47392775 CCGGCCTCCATGCCAAAGAGGGG + Intronic
1024302296 7:47896504-47896526 TGGGTCCCCTTGGCCAAGAGGGG + Intronic
1027993778 7:85397338-85397360 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029839330 7:103345516-103345538 TGGTGGTCCTTGCTAAAGAGTGG - Intronic
1030618303 7:111761629-111761651 AGGGACTCCAGGCCACAGAGAGG + Intronic
1032205812 7:129864230-129864252 TGGAACTCCTGGACAAGGAGGGG + Intronic
1033129695 7:138735256-138735278 TTGGAATCCTTTCCACAGAGTGG - Intronic
1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG + Intergenic
1035243491 7:157547430-157547452 TGGAACTCCTTGGTACAGAGAGG + Intronic
1037322662 8:17658637-17658659 TGTTATTCCTTTCCAAAGAGAGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1041317442 8:56579224-56579246 GGGGCCTCCTTGGCTAAGAGTGG + Intergenic
1041366977 8:57116835-57116857 TGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1047343214 8:124002480-124002502 TGGAGCTCCTTCCAAAAGAGAGG + Intronic
1048850907 8:138644489-138644511 TGGGTCTCCTTGGCCAAGAGGGG - Intronic
1048854147 8:138672498-138672520 TGGGCCTTCTAGCCTAAGAGAGG - Intronic
1049202939 8:141350699-141350721 TGGGAGTCCTGGACAGAGAGGGG - Intergenic
1049585142 8:143429486-143429508 TGGGGCGCCTGGCCAAAGAGCGG - Exonic
1051425174 9:16925026-16925048 TGGGGTTTTTTGCCAAAGAGGGG + Intergenic
1052649032 9:31275730-31275752 TGGGATTCCTTGGCCAAGAGGGG + Intergenic
1056802677 9:89703928-89703950 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1057022787 9:91713587-91713609 TGGGACCACTTGCCTTAGAGAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058776335 9:108287490-108287512 TGGGTCCCCTTGGCCAAGAGAGG + Intergenic
1060508998 9:124218672-124218694 TGGGCCTCCTTGCTAGAGACTGG - Intergenic
1062371764 9:136242929-136242951 GGGGTCTCCTTGGCCAAGAGGGG - Intronic
1186340783 X:8644256-8644278 TGGGACCCCTTGGCTAAGATGGG - Intronic
1186781376 X:12915634-12915656 TAGGACTGCTTGCCACAGTGGGG - Intronic
1187101550 X:16198043-16198065 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194088332 X:89556012-89556034 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG + Intergenic
1197479602 X:126966116-126966138 TGGGACTCCTTGACTTGGAGAGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198438361 X:136638571-136638593 TGGTACTCCTTGTCACAGGGTGG - Intergenic
1200441004 Y:3212054-3212076 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1200962987 Y:9011989-9012011 TCTGACTCCTTGCCCAAAAGAGG - Intergenic
1202150116 Y:21836793-21836815 TCTGACTCCTTGCCCAAAAGAGG + Intergenic