ID: 905037687

View in Genome Browser
Species Human (GRCh38)
Location 1:34928710-34928732
Sequence GCGTGTGCGCGCGCGTGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 13, 3: 50, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905037687_905037689 5 Left 905037687 1:34928710-34928732 CCAACGCACGCGCGCGCACACGC 0: 1
1: 0
2: 13
3: 50
4: 311
Right 905037689 1:34928738-34928760 CACACACACACAGTCACACAGGG 0: 1
1: 26
2: 1992
3: 2575
4: 4405
905037687_905037690 15 Left 905037687 1:34928710-34928732 CCAACGCACGCGCGCGCACACGC 0: 1
1: 0
2: 13
3: 50
4: 311
Right 905037690 1:34928748-34928770 CAGTCACACAGGGCAGATACCGG 0: 1
1: 0
2: 0
3: 14
4: 180
905037687_905037691 16 Left 905037687 1:34928710-34928732 CCAACGCACGCGCGCGCACACGC 0: 1
1: 0
2: 13
3: 50
4: 311
Right 905037691 1:34928749-34928771 AGTCACACAGGGCAGATACCGGG 0: 1
1: 0
2: 0
3: 14
4: 202
905037687_905037688 4 Left 905037687 1:34928710-34928732 CCAACGCACGCGCGCGCACACGC 0: 1
1: 0
2: 13
3: 50
4: 311
Right 905037688 1:34928737-34928759 ACACACACACACAGTCACACAGG 0: 1
1: 31
2: 1720
3: 3306
4: 5790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905037687 Original CRISPR GCGTGTGCGCGCGCGTGCGT TGG (reversed) Intronic
900374801 1:2348638-2348660 GCGTGTGTGCGTGCCTGCGCAGG - Intronic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
902237343 1:15065846-15065868 GCGTGTGTGCAAGCGAGCGTGGG + Intronic
902501444 1:16914146-16914168 CCGGGGGCGCGCGCGTGCGCGGG + Intronic
902690318 1:18107012-18107034 GTGTGTGCTCGCGTGTGTGTTGG + Intergenic
903190117 1:21651719-21651741 GCGTGTGCGTGTGCACGCGTGGG - Intronic
903324747 1:22563477-22563499 GCGGGTGCCCGCGTGTGCGCTGG + Intergenic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905174382 1:36126714-36126736 GTGTGTGTGCGCGCATGGGTGGG + Intergenic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
907223873 1:52927257-52927279 GCGTGAGAGTGCGCGTGCGTAGG - Exonic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
907766974 1:57422501-57422523 GGGTGCGCGCCCGCGTGGGTCGG - Intronic
908131975 1:61082974-61082996 GCGTGTGCCCGCGGGTGGGGGGG + Intronic
908252903 1:62279183-62279205 GTGTGTGCGCGCGCTAGCTTAGG - Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
911102402 1:94104944-94104966 GCGTGTGTGTGTGCGTGTGTTGG - Intronic
912993506 1:114511202-114511224 GCGTGCGCGCGCGCTCTCGTTGG - Intergenic
916312044 1:163408565-163408587 GTGTGTGCGTGCGTGTGTGTGGG - Intergenic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
918995795 1:191757542-191757564 GTGTGTGTGTGCGCGCGCGTGGG - Intergenic
919464453 1:197912633-197912655 GCGTGTGTGTGCGCCTTCGTTGG + Intronic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
922739416 1:228006995-228007017 GCGGGTGCGCGGGTGTGCGCGGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
1062802846 10:392891-392913 GTGTGTGCGCGCCTGTGTGTGGG - Intronic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1063928891 10:11009355-11009377 GTGTGTGTGCGTGCGCGCGTCGG + Intronic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1066022875 10:31319936-31319958 GTTTGTGCGCGCGTGTGCGCGGG + Intronic
1066467846 10:35669178-35669200 GCGTGTGCGTGCGTGTGTGTAGG + Intergenic
1066528955 10:36315317-36315339 GCGTGTGCGTGTGTGTGTGTTGG + Intergenic
1067560212 10:47300156-47300178 GGGTGTGCGCCCGCGAGTGTGGG - Intergenic
1067650713 10:48152947-48152969 GTGTGTGTGCGCGCGCGTGTGGG - Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1068950132 10:62768489-62768511 GTGTGTGTGCGTGCGTGCGCTGG - Intergenic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1072542375 10:96407809-96407831 GTGTGTGTGCGCGCACGCGTGGG + Intronic
1072816167 10:98511606-98511628 GTGTGTGCGCACGTGTGTGTTGG + Intronic
1072881254 10:99232196-99232218 GTGTATGCGCGCGCGCGCGTTGG - Intronic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1073664422 10:105514166-105514188 GTGTGAGTGCGCGCGTGGGTTGG - Intergenic
1076364904 10:129915441-129915463 GCATGTGTGCGCGCATGCATGGG - Intronic
1078498571 11:11844797-11844819 GCATGTGTGCGTGCGTGTGTTGG + Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1080641446 11:34160771-34160793 GCGTGTGAGTGTGTGTGCGTTGG + Intronic
1081927890 11:46846008-46846030 GCGTGGGCGCTCGTGTGCGGCGG - Intronic
1082775670 11:57242597-57242619 GCGCGCACGCGCGCGTGCCTAGG - Intergenic
1083227515 11:61294425-61294447 GCGTGTGCGCGCGTGGGGGTGGG - Intronic
1084319191 11:68364029-68364051 GCGTGGGGGTGCGCGGGCGTGGG + Intronic
1084319193 11:68364033-68364055 GGGGGTGCGCGGGCGTGGGTGGG + Intronic
1085284716 11:75352108-75352130 GCGTGTGTGCGCACGGCCGTGGG + Intergenic
1086380500 11:86247248-86247270 GTGTGTGCGTGCGCATGCCTTGG + Intronic
1086980937 11:93197533-93197555 GTGTTTGCGCGCGCGCGTGTGGG - Intronic
1090285460 11:125495761-125495783 GCGTGTGTGCGCGCGTGTGAAGG - Intronic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1098219830 12:68257469-68257491 GTGTGTGTGCACACGTGCGTGGG + Intergenic
1102310575 12:111841937-111841959 TCGCGTGAGTGCGCGTGCGTTGG - Intergenic
1103527873 12:121579630-121579652 GAGTGTGCGCGCGCGCTTGTGGG - Intronic
1103800359 12:123533755-123533777 GGGAGGGCGCGCGCGTGCGCAGG + Intergenic
1103971734 12:124676888-124676910 GTGTGTGTGCGTGCGTGCGCGGG + Intergenic
1103980933 12:124736566-124736588 GGGTGGGTGCGCGGGTGCGTGGG - Intergenic
1104919687 12:132284140-132284162 GCGTGTGCGTGCATGTGCGTGGG - Intronic
1105601262 13:21889993-21890015 GTGTGTGTGTGCGCGTGTGTAGG + Intergenic
1106131612 13:26944361-26944383 GTGTGTGTGTGTGCGTGCGTAGG + Intergenic
1108530891 13:51326038-51326060 GTGTGTGCGCGCGCGCACGTGGG + Intergenic
1111548069 13:89770101-89770123 GCGTGTGTGCGAGTGTGAGTGGG - Intergenic
1112356173 13:98676335-98676357 GCGTGCGTGCGTGCGTGCGTGGG - Intergenic
1113737641 13:112689913-112689935 GCGGGTGCGAGCGCGGGTGTGGG + Intergenic
1113962063 13:114131817-114131839 GTGTGTGCGCGTGCGTTTGTGGG - Intronic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1118693682 14:68363745-68363767 GTGTGTGCACACGCGTGTGTGGG + Intronic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1121120884 14:91375267-91375289 GTGTGTGCGCGCGCGCATGTGGG + Intronic
1122183425 14:99971766-99971788 GTGTGCGCGGGCGCGTGCCTGGG - Intronic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122993336 14:105249107-105249129 GCGTGGGCGCGCGCGGGCGCGGG - Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123447175 15:20339738-20339760 GCCTGTGTGCGTGAGTGCGTGGG + Intergenic
1123653423 15:22494627-22494649 GCGGGAGCGCGTGCGTGCGGCGG + Intergenic
1124250810 15:28105524-28105546 GGGTGTGTGCGCGCATGTGTGGG + Intergenic
1124491674 15:30161731-30161753 GTGTGTGCGTGTGCGTGTGTTGG + Intergenic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1125333482 15:38604853-38604875 GTGTGTGCGTGCGTGTGTGTCGG + Intergenic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1125521960 15:40353147-40353169 GCGCGCGCGCGCGCATCCGTGGG + Intronic
1125917604 15:43503153-43503175 GTGTGTGTGCGCGCATGCGCGGG + Intronic
1126315759 15:47367659-47367681 GCGTGTGAGCGTGCGTGTTTAGG - Intronic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129460150 15:75696506-75696528 GTGTGTGTGTGCGCGTGTGTGGG + Intronic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1131713750 15:95085567-95085589 GTGTGTGTGTGCGCGTGCGCAGG + Intergenic
1132583017 16:694034-694056 CCGAGTGTGCGTGCGTGCGTGGG + Exonic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1135656687 16:24256284-24256306 GTGTGTGCGAGCGCGTGTGCTGG - Exonic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141983427 16:87563990-87564012 GCGTGTGTGTGCGCGTGTGTTGG + Intergenic
1142810220 17:2392683-2392705 GCGTGGGTGCGCGCGTGCTTCGG - Intronic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1146374275 17:32284059-32284081 GTTTGTGCGCGCGCATGAGTAGG - Intronic
1146958084 17:36948830-36948852 GCGTGCGCGTGCGAGTGCGCGGG - Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1148150690 17:45395154-45395176 GCGTGTGCGATAGCGTGTGTGGG - Exonic
1148437459 17:47694806-47694828 GAGTGTGTGCGCGCGTTTGTAGG - Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1150485128 17:65537915-65537937 GGGTGTGCGTGCTCCTGCGTAGG - Intronic
1152148683 17:78585156-78585178 GTGTGTGTGTGCGCGTGCATAGG - Intergenic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152356754 17:79811280-79811302 GCGTGCGCGTGCGCGCGCCTCGG - Intergenic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153596347 18:6729307-6729329 GTGCGTGCGCGCGCATGTGTCGG - Intergenic
1153923166 18:9809050-9809072 GTGTGTGCGCGCGCACGCGTGGG + Intronic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1156008384 18:32470234-32470256 GCGGGTGTGCGCGCGTGTGCTGG - Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157279280 18:46335090-46335112 GCGAGTGTGCGCGCGCGCCTCGG + Intronic
1157625378 18:49046288-49046310 GTGTGTGCGCGCGCATGTCTGGG - Intronic
1158030611 18:52960083-52960105 GCGTGTGTGCATGCATGCGTGGG - Intronic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1159963647 18:74575737-74575759 GCGTGTGTGCGCGTGTGTGAAGG + Intronic
1160452401 18:78974324-78974346 GCGTGCGCGTGCGCGTGCGAAGG - Intergenic
1160714976 19:572462-572484 GAGCGTGTGCGCGCGTGCGCAGG + Intronic
1160871765 19:1281000-1281022 GCGTGTGTGTGCGGGTGCCTGGG + Intergenic
1160902957 19:1438328-1438350 GCGTGTGCGCGCACGGCCGAGGG + Intergenic
1160962648 19:1730380-1730402 GTGTGTGTGCGTGCGCGCGTTGG - Intergenic
1161120727 19:2524770-2524792 GCGTGTGCGCACACGTGTGTGGG + Intronic
1161349879 19:3785721-3785743 GCTTGTGCGCGCGGATGCGCGGG - Intronic
1161978016 19:7616758-7616780 GCGTGTGGGCACGTGTGCATGGG + Intronic
1162314641 19:9930946-9930968 GCGTGGGCGCGTGCGTATGTGGG - Intronic
1162485960 19:10960842-10960864 GCGCGTGCGCGCCCGTCCCTGGG - Intergenic
1162742686 19:12782643-12782665 GGCTGCGTGCGCGCGTGCGTGGG + Intronic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1165531903 19:36409978-36410000 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
1165579701 19:36851322-36851344 GTGTGTGTGTGCGCGCGCGTTGG + Exonic
1165716190 19:38047223-38047245 GTGTGTGCGTGCGTGTGTGTCGG - Intronic
1166126019 19:40715863-40715885 GTGTGTGTGCGCGCGCGCGTTGG + Intronic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1166799989 19:45450899-45450921 GCGTCTGCGCGGGCGTGGGGGGG - Intronic
1168336527 19:55600362-55600384 GCGAGTGTGCGCGCGCGCGGGGG - Intronic
924991816 2:318996-319018 GTGTGTGCGGGCGTGTGTGTGGG + Intergenic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926017384 2:9466371-9466393 GCGCGTGTGTGCGAGTGCGTGGG - Intronic
926285374 2:11483201-11483223 GTGTGGGCGCGCGTGTGTGTGGG + Intergenic
927652439 2:24920453-24920475 GCGGGCGCGGGCGCGGGCGTGGG + Intergenic
927692223 2:25216198-25216220 GGCAGTGCGCGCGCATGCGTTGG + Intergenic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929783956 2:44975843-44975865 GTGTGTGCGTGTGTGTGCGTAGG - Intergenic
929937220 2:46302140-46302162 GTGTGTGTGTGCCCGTGCGTCGG + Intronic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932790194 2:74648313-74648335 GCGTGCGCCCGCGCGTTCGGAGG + Intronic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
934685940 2:96321796-96321818 GCCTGTGCACGCGCCTGCGGAGG - Intergenic
937950856 2:127387383-127387405 GTGTGTGCGCGCGTGTGTGTCGG - Intronic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
941020932 2:160407550-160407572 GCGGGTGCGGGCGCGGGCGCGGG + Intronic
941580808 2:167293576-167293598 GTGTGTGCGCGCGCGCGGCTTGG + Intergenic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
947958970 2:234218678-234218700 GCGCGTGTGCGCGCGTGTTTGGG + Intergenic
1168812017 20:710399-710421 GGGCGTGCGCGCGCGTGTCTGGG - Intergenic
1172840875 20:37902245-37902267 GTGTGCGCGCGCGTATGCGTGGG - Intergenic
1172841255 20:37903674-37903696 GCGTATCCGCGCGAGTGTGTGGG - Intronic
1175417890 20:58813449-58813471 GTGTGTGCGCGCGCGCATGTGGG - Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1176064024 20:63185005-63185027 GCGTGTGTGCGTGCATGCCTGGG + Intergenic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1180174216 21:46079808-46079830 GCGTGTGTGTGCACGTGTGTGGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182149508 22:28018291-28018313 GCGTGTGTGCGCGCGCGGGGGGG + Intronic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182885271 22:33768423-33768445 GTGTGTGTGAGCGCGCGCGTTGG - Intronic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1183369888 22:37426598-37426620 GTGTGTGTGCGTGCGTGTGTGGG - Intronic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1185093780 22:48794161-48794183 GTGTGCGTGTGCGCGTGCGTGGG + Intronic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
949184568 3:1174882-1174904 GTGTGTGCACACGCGTGTGTGGG - Intronic
950316144 3:12003974-12003996 GCGTGTGTGCGCGCGTGATTGGG + Intergenic
951729797 3:25797979-25798001 GTGTGTGTGCGCGTGTGTGTAGG - Intergenic
951996861 3:28740146-28740168 GTGTGTGTGCGTGCGTGTGTTGG - Intergenic
952971077 3:38650530-38650552 GTTTGCGCGCGCGCGTGTGTGGG - Intergenic
953355487 3:42252912-42252934 GAGTGTGCGCGCGTTTGGGTGGG + Intergenic
953881621 3:46693952-46693974 GAGTGTGCGCGTGGGTGCGTAGG - Intergenic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954505453 3:51067447-51067469 GTGTGTGTGTGCGCGCGCGTTGG + Intronic
954505455 3:51067451-51067473 GTGTGTGCGCGCGCGTTGGAGGG + Intronic
954663714 3:52239320-52239342 GCGTGTGACCGAGCGTGCGTGGG + Intergenic
956930787 3:74040495-74040517 GCGTGTGTGCGTGGGTGGGTGGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
962263113 3:133927527-133927549 GCGTGCGTGCGTGCGTGCGGTGG + Intergenic
962648711 3:137466482-137466504 GTGTGTGTGTGCGCGTGTGTTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
965361203 3:167740722-167740744 GCGTGTGTGTGTGCGTGCATGGG + Intronic
965892878 3:173536765-173536787 GCGTGTGTGTGTGTGTGCGTAGG + Intronic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967889070 3:194352069-194352091 GGGTGTGTGCGCGCGTGGGTAGG + Intergenic
967889076 3:194352109-194352131 GCGTGTGTGGGTGCGTGTGTGGG + Intergenic
968234803 3:197025186-197025208 GCGTGTGTGCGCCCGTGCGATGG - Intronic
968475538 4:805009-805031 GACGGTGCGCGAGCGTGCGTGGG - Intronic
968564768 4:1305719-1305741 GTGTGTGCGCACGCGTGTGTGGG + Intronic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
972091221 4:35287036-35287058 CCGTGTGTGCGTGGGTGCGTGGG - Intergenic
973754882 4:54064675-54064697 GGGCGGGCGGGCGCGTGCGTGGG + Exonic
974047125 4:56907830-56907852 TCGCGGGCGCGCGCGGGCGTCGG + Intergenic
975883639 4:78939509-78939531 GGGTGTGCTCGAGCGTGCGCTGG + Intergenic
976107256 4:81632380-81632402 GCGTGTTTGCGCACGTGTGTGGG + Intronic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
983577002 4:169270994-169271016 GTGTGTGTGCGCGCGTGAGGGGG - Exonic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
988853935 5:35208166-35208188 GTGTGTGTGTGCGCGCGCGTGGG - Intronic
989033993 5:37150509-37150531 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
993519454 5:88883219-88883241 GCGTGTGTGCGCGCGCGCGAGGG + Intronic
995106539 5:108382070-108382092 GCGGGTGCGCGCGCCGGCGGCGG - Exonic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
1000665419 5:163989211-163989233 GTGTGTGTGCGCGCGCGTGTGGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002852931 6:1012361-1012383 GTGTGTGTGTGCGCGCGCGTAGG + Intergenic
1003035487 6:2637533-2637555 GTGTGTGTGTGCGCGTGCGGGGG + Intergenic
1003035489 6:2637537-2637559 GTGTGTGCGCGTGCGGGGGTGGG + Intergenic
1004193626 6:13486208-13486230 GGTTGTGCGCGCGCGCGCCTGGG - Intronic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1006337526 6:33428192-33428214 GCGGGGGCGCGCGTGTGCGTGGG + Intronic
1007264663 6:40587446-40587468 GCGTATGCGCGCGCGCGTGGGGG - Exonic
1007264665 6:40587448-40587470 GCGCGTATGCGCGCGCGCGTGGG - Exonic
1007600574 6:43078255-43078277 GTGTGTGCGCGCGTGTGTGTGGG + Intronic
1007702067 6:43771374-43771396 GTGCGTGCGAGCGCGCGCGTGGG + Intronic
1007800451 6:44387916-44387938 GCTTGTGCGCACGCGCGCGGAGG + Intronic
1011127855 6:84026196-84026218 GTGTGTGTGCGTGCGTGTGTGGG - Intergenic
1013072601 6:106742513-106742535 GTGTGTGTGCGTGCGTGTGTGGG + Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1015149258 6:130019952-130019974 GCGCGGGCGCGGGCGTGTGTCGG + Intronic
1016823699 6:148368745-148368767 GCGCGTGCGCGCGCATGTGGGGG - Intronic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1017447391 6:154519261-154519283 ATGTGTGTGCGCGCGTGCGCAGG - Intergenic
1019206568 6:170366501-170366523 GCGTGTGAGCGCACCTGAGTGGG + Intronic
1019356644 7:583413-583435 GGGTGTGTGCGTGTGTGCGTGGG - Intronic
1019356654 7:583510-583532 GGGTGTGTGCACGCGTGTGTGGG - Intronic
1019619444 7:1983125-1983147 GCGCGCGCGCGCGCGTCTGTGGG - Intronic
1019703302 7:2485140-2485162 GCGCGCGCGCGCGCGTGTGAGGG - Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1022100513 7:27166481-27166503 GGCTGGGCGCGCGTGTGCGTGGG - Intronic
1022260536 7:28700213-28700235 GCTTGTGCGCGTGTGTGAGTTGG - Intronic
1022344381 7:29500150-29500172 GTGTGTGCGCACACATGCGTAGG - Intronic
1022729058 7:33005884-33005906 GCGTGTGCGTGTGCGGGGGTGGG - Exonic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1024468477 7:49740089-49740111 GTGTGTGCGCATGCGTGTGTAGG - Intergenic
1025044594 7:55682094-55682116 GCGTGTGCGTGTGCGGGGGTGGG + Intergenic
1026148964 7:67772007-67772029 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1030121288 7:106112594-106112616 GCGTGTACGCGTGCGCTCGTTGG + Intergenic
1030304054 7:108002217-108002239 GCGTGTGCGTGCACGCGCGAGGG + Intronic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1032496296 7:132365359-132365381 GTGCGTGCGCGCGCATGCATGGG + Intronic
1032651603 7:133884615-133884637 GTGTGTGCGCGCGTGTGTGATGG + Intronic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1035264982 7:157685435-157685457 GGCTGTGCGCGCGGGTGTGTGGG + Intronic
1035288312 7:157820535-157820557 GCGTGTGTGTGCACGTGTGTGGG - Intronic
1035368855 7:158365886-158365908 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035368874 7:158366058-158366080 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035458971 7:159027746-159027768 GCGTGTGTGGGTGTGTGCGTGGG - Intergenic
1035717232 8:1763748-1763770 GCGTGCGAACGCGCGTGCGCGGG + Exonic
1036762041 8:11515966-11515988 GGGTGTGCACTCGCGTGCCTGGG + Intronic
1037839069 8:22231448-22231470 GTGTGTGCGCGCTCGCGAGTTGG - Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1041355125 8:56992699-56992721 GTGTGTGCGCTCGCGGGAGTCGG - Intronic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1042540259 8:69901001-69901023 GCGTGTGTGTGAGCGTGTGTGGG - Intergenic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1047415408 8:124660932-124660954 GCGTGTGTGTACGTGTGCGTGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048484255 8:134832340-134832362 GTGTGTGTGCGCGCGCGCGTGGG + Intergenic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049016819 8:139925800-139925822 GCGTGTGCGTGTGCGTGTGCTGG - Intronic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050261479 9:3845730-3845752 GGGTGTGTGTGTGCGTGCGTGGG - Intronic
1051373173 9:16375913-16375935 GTGTGTGTGCGTGCGTGTGTGGG - Intergenic
1051964109 9:22804663-22804685 GTGTGTGTGTGCGTGTGCGTGGG - Intergenic
1052243658 9:26306712-26306734 GTGTGTGCGTGCGTGTGTGTTGG - Intergenic
1053411422 9:37918361-37918383 GCGTGTGCGTGTGCGTGTGTAGG + Intronic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1058058575 9:100473329-100473351 GCGGGTCCGGGCGCGTGCGAGGG - Exonic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059502638 9:114768091-114768113 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1059790038 9:117632135-117632157 GCGCGCGCGCGCGCGTGTATTGG - Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060713058 9:125889864-125889886 GCGCGAGCGCGGGCGGGCGTCGG - Intronic
1060798388 9:126527775-126527797 GCGTGTGTGCGCACGTGAGAGGG + Intergenic
1061423483 9:130484827-130484849 ACACGTGCGCGCGCGCGCGTCGG + Intronic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062267050 9:135691776-135691798 GTGTGTGCACACGCGTTCGTGGG - Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1186209982 X:7240450-7240472 GTGTGTGCGCGCGCGCTCCTTGG - Intronic
1186349899 X:8731008-8731030 GTGTGCGCGCGCGCTTGTGTGGG - Intronic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1192216740 X:69164628-69164650 GCGTGTGCCTGCGCATGCGCGGG + Intronic
1192425141 X:71068436-71068458 CGGCGTGCGCGTGCGTGCGTGGG - Intronic
1193208232 X:78774142-78774164 GTGTGTGTGTGCGCGTGTGTTGG - Intergenic
1195175334 X:102309877-102309899 GAGTGTGTGCGCACATGCGTGGG - Intronic
1195183531 X:102377216-102377238 GAGTGTGTGCGCACATGCGTGGG + Intronic
1195894693 X:109733411-109733433 GCGGGGGCGGGCGCGTGGGTGGG - Intergenic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1197559848 X:128006303-128006325 GTGTGTGCACGCGCACGCGTGGG - Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic