ID: 905044452

View in Genome Browser
Species Human (GRCh38)
Location 1:34985045-34985067
Sequence CTGGCTTTCGACTGAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905044452_905044463 22 Left 905044452 1:34985045-34985067 CCTGCGCCTCAGTCGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 905044463 1:34985090-34985112 GAGCCTCGGAAGCCCGAAGGCGG 0: 1
1: 0
2: 0
3: 10
4: 89
905044452_905044458 8 Left 905044452 1:34985045-34985067 CCTGCGCCTCAGTCGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 905044458 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG 0: 1
1: 0
2: 6
3: 66
4: 545
905044452_905044465 30 Left 905044452 1:34985045-34985067 CCTGCGCCTCAGTCGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044452_905044462 19 Left 905044452 1:34985045-34985067 CCTGCGCCTCAGTCGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 905044462 1:34985087-34985109 GCTGAGCCTCGGAAGCCCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905044452 Original CRISPR CTGGCTTTCGACTGAGGCGC AGG (reversed) Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG + Intergenic
1067208372 10:44238708-44238730 CTGGCTTATGCCTGAGGCCCTGG - Intergenic
1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG + Intronic
1072924848 10:99608191-99608213 CTGGCTCTCCACAGAGGCTCTGG + Intergenic
1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG + Intronic
1083424316 11:62575291-62575313 GTGGCTGGCGACTGAGGCTCAGG - Exonic
1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG + Intergenic
1115215461 14:31009484-31009506 GTGGTTTTCAACTGGGGCGCGGG - Intronic
1115909671 14:38241530-38241552 CTGCCTTTTGAATGAGGTGCCGG - Intergenic
1119020566 14:71108658-71108680 CTGGCTGGCTACTGAGGCCCGGG - Exonic
1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG + Intergenic
1123019958 14:105393028-105393050 CTGGCCTCCGCCTGAGGCTCTGG - Intronic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG + Intergenic
1132212721 15:100036287-100036309 CTGTCTTAGGACAGAGGCGCTGG + Intronic
1133610729 16:7431047-7431069 CTGGCTTTCTACTAAGGCACAGG + Intronic
1141424691 16:83937140-83937162 CTGTCTTCCCACTGAGGAGCAGG - Intronic
1146685701 17:34840248-34840270 CTGGCTTTAGAGTGAGACTCAGG - Intergenic
1149095733 17:52838260-52838282 CTGTCTGTCAACTGAGGAGCAGG + Intergenic
1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG + Intronic
1151795957 17:76345931-76345953 CTGGCTTTGGAGGGAGGAGCAGG - Intronic
1157790650 18:50528218-50528240 CTGGCTTTTGAAGGAGGAGCAGG + Intergenic
1159909073 18:74126719-74126741 CTGGCTTGTGCCTGAGGTGCTGG - Intronic
1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG + Intronic
1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG + Intergenic
925943699 2:8841848-8841870 CTGGCTTTCACCTGAGTTGCCGG + Intergenic
937343019 2:121104019-121104041 CTGTCTTTCGCCTCAGGCTCTGG - Intergenic
946500179 2:220238788-220238810 CTGGCTTTGGACTCAGGTGCTGG + Intergenic
1168993700 20:2116457-2116479 CTGGGTTTGGAATGAGGCCCAGG - Intronic
1171823211 20:29874263-29874285 CTGGGCTTCGGCTGGGGCGCGGG - Intergenic
1171896884 20:30816049-30816071 CTGGGCTTCGGCTGGGGCGCGGG + Intergenic
1174733096 20:52937522-52937544 TTGGCTTAACACTGAGGCGCTGG - Intergenic
1179223664 21:39432670-39432692 CTGGGTTGGGAGTGAGGCGCAGG - Intronic
1184159296 22:42688428-42688450 CCGGCTGTCGCCTGAGGCCCTGG + Intergenic
950297717 3:11846539-11846561 CTGGCTTTCGTCTACGGCTCCGG - Exonic
950443228 3:13021981-13022003 CTGGCTGTCGACTGTTGGGCCGG - Intronic
950450075 3:13060499-13060521 CTGGCTTTCCACCGATGGGCGGG + Intronic
951078450 3:18424831-18424853 CTGGCTTTCGGCTGGGCCCCCGG + Intronic
952036549 3:29209321-29209343 CTGGCTTTCTTCTGAGGCTTTGG - Intergenic
952525005 3:34200713-34200735 CTGGCTTTCCACTGAGATGCAGG - Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
985444653 4:190015335-190015357 CTGGGCTTCGGCTGGGGCGCAGG - Intergenic
985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG + Intergenic
985797527 5:1974049-1974071 CTGGCTTTCAGCTGAGGGGAGGG + Intergenic
987128720 5:14840746-14840768 CTGGCTTTCTAATGATGCCCAGG + Intronic
994003031 5:94803974-94803996 CTGGCTTTCAACTGGGGTGATGG - Intronic
1002671681 5:180872683-180872705 GAGGCTTTCGACTGTGGCGGGGG + Intergenic
1007748653 6:44058622-44058644 CTGGCTGTCGACAGTGGGGCAGG - Intergenic
1010540748 6:77089133-77089155 CTGGCTTTGGAATGAGGCCCAGG - Intergenic
1018982219 6:168610254-168610276 CTGGTTTTCGTCTGAGGTGTGGG - Intronic
1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG + Intronic
1037412795 8:18616123-18616145 CTGGCTTACCACTCACGCGCAGG + Intronic
1038530653 8:28315957-28315979 CTGGATTTAGACTGAGGTGATGG - Intergenic
1039379434 8:37071216-37071238 CTTTCTTTTGACTGAGGCCCTGG + Intergenic
1062328601 9:136025134-136025156 CAGGCTTTCAGCTGAGGCCCTGG + Intronic
1062439525 9:136563491-136563513 CTGGCTCTGGACTGAGGAGGTGG - Intergenic
1196194375 X:112824588-112824610 CTGGCTTCCAACTGTTGCGCTGG + Intronic
1200122636 X:153798346-153798368 CTGGGTGTCCACTGAGGTGCTGG + Exonic