ID: 905044458

View in Genome Browser
Species Human (GRCh38)
Location 1:34985076-34985098
Sequence CCCCAGCTCCAGCTGAGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 545}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905044454_905044458 2 Left 905044454 1:34985051-34985073 CCTCAGTCGAAAGCCAGGCGCTT 0: 1
1: 0
2: 0
3: 2
4: 57
Right 905044458 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG 0: 1
1: 0
2: 6
3: 66
4: 545
905044452_905044458 8 Left 905044452 1:34985045-34985067 CCTGCGCCTCAGTCGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 905044458 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG 0: 1
1: 0
2: 6
3: 66
4: 545
905044451_905044458 18 Left 905044451 1:34985035-34985057 CCAGGCAGGACCTGCGCCTCAGT 0: 1
1: 0
2: 3
3: 17
4: 163
Right 905044458 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG 0: 1
1: 0
2: 6
3: 66
4: 545
905044450_905044458 19 Left 905044450 1:34985034-34985056 CCCAGGCAGGACCTGCGCCTCAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 905044458 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG 0: 1
1: 0
2: 6
3: 66
4: 545
905044449_905044458 20 Left 905044449 1:34985033-34985055 CCCCAGGCAGGACCTGCGCCTCA 0: 1
1: 0
2: 4
3: 23
4: 211
Right 905044458 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG 0: 1
1: 0
2: 6
3: 66
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905044458 Original CRISPR CCCCAGCTCCAGCTGAGCCT CGG Intronic
900092968 1:928534-928556 CCCGAGCTCCAGCTGACACGCGG + Intronic
900236978 1:1597629-1597651 CCCCAGCTCTAGCTCTGCCAGGG + Intergenic
900440898 1:2654687-2654709 CCTCACCTCCAGGTGAGCATCGG + Intronic
900447656 1:2689450-2689472 CCTCACCTCCAGGTGAGCATCGG + Intronic
900450105 1:2701694-2701716 CCTCACCTCCAGGTGAGCATCGG + Intronic
900450508 1:2747230-2747252 CCTCACCTCCAGGTGAGCATCGG + Intronic
900453593 1:2762805-2762827 CCTCACCTCCAGGTGAGCATCGG + Intronic
900454306 1:2766390-2766412 CCTCACCTCCAGGTGAGCATCGG + Intronic
900455035 1:2770066-2770088 CCTCACCTCCAGGTGAGCATCGG + Intronic
900455784 1:2773812-2773834 CCTCACCTCCAGGTGAGCATCGG + Intronic
900520236 1:3101875-3101897 CACTAGCTCCAGCTGGGACTGGG - Intronic
900659642 1:3776186-3776208 CTGCAGCTCCTGCTGAGGCTGGG - Intergenic
901401689 1:9019176-9019198 CCCAGGCTCCGGCTCAGCCTTGG - Intronic
901604623 1:10449454-10449476 CCCCAGGGCCAGCAGTGCCTGGG + Intronic
901876326 1:12168803-12168825 CCCCCTCTCCCGCTGATCCTTGG + Intronic
901947998 1:12719130-12719152 GCCCTGCTCCACCTCAGCCTGGG - Intronic
903213576 1:21831429-21831451 CCCCACCTCCAGCTGAGGCTGGG - Intronic
903215864 1:21842997-21843019 GACCAGCTCCAGTTGATCCTGGG + Intronic
903475006 1:23613451-23613473 CCCCATGTCCAGCTGGGCCCAGG - Intronic
904207153 1:28862770-28862792 CCCCAGCCCCAGCTGGTACTGGG + Exonic
904370113 1:30042875-30042897 GCTCAGCTCTGGCTGAGCCTGGG - Intergenic
904403945 1:30274320-30274342 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
904613123 1:31736029-31736051 CACTGGCTCCTGCTGAGCCTCGG + Intronic
905001307 1:34671842-34671864 ACCCTGCTTTAGCTGAGCCTGGG - Intergenic
905044458 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG + Intronic
905546091 1:38801561-38801583 GCTCAGCTCTGGCTGAGCCTAGG - Intergenic
905922992 1:41731411-41731433 CCCCAGCACCTGCTGTGCATGGG - Intronic
906101692 1:43267942-43267964 CCCCTGCTGCAGCTCTGCCTGGG + Intronic
906132411 1:43468608-43468630 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
906279638 1:44544235-44544257 CCCCAGAACCATCTGAGCCAAGG + Intronic
907240698 1:53079397-53079419 CCCCCGGTCCTCCTGAGCCTAGG - Intronic
907369617 1:53992511-53992533 GCCCAGCTCTGGCAGAGCCTGGG + Intergenic
907453094 1:54559839-54559861 CCCAAGCTCCAGCTGGGCAGGGG + Intronic
907676108 1:56519301-56519323 TCTCTGCTCCAGGTGAGCCTAGG + Intronic
908837528 1:68242963-68242985 CTCCAGCTCCAGAAGAGCCTGGG + Intergenic
910101608 1:83583555-83583577 CCACAGCTGCAGCTGCACCTGGG + Intergenic
912458852 1:109818077-109818099 CCCCAGCCCCATCTGAGTCCAGG - Intergenic
913194684 1:116445737-116445759 CCCTAGCTGCACCTGACCCTGGG + Intergenic
913975394 1:143451113-143451135 CTCCAGCCCCACCTGTGCCTTGG + Intergenic
914069786 1:144276729-144276751 CTCCAGCCCCACCTGTGCCTTGG + Intergenic
914109369 1:144689625-144689647 CTCCAGCCCCACCTGTGCCTTGG - Intergenic
915345012 1:155192968-155192990 CACCTGCTCCGGCTGTGCCTAGG - Intergenic
915587332 1:156851401-156851423 CCACAGCTGCAGCACAGCCTGGG - Exonic
917491259 1:175500521-175500543 ACCCAGCACCAGCCCAGCCTTGG - Intronic
920339989 1:205269645-205269667 CGCCAGCGCCAGCTCAGCCGGGG + Exonic
921810454 1:219506521-219506543 CCCCAGGTCTAGCTGTCCCTGGG + Intergenic
922516056 1:226209213-226209235 CTCCATCTCCAGCGGAGCCGGGG + Intergenic
922574809 1:226654618-226654640 CCCCACCTCCAGCCCATCCTTGG + Intronic
923008738 1:230071993-230072015 CCCAAGGTCCAACAGAGCCTGGG - Intronic
923191895 1:231627378-231627400 CCCGAGATCCAGCTGGGTCTTGG - Intronic
923327898 1:232897074-232897096 CCCCAGTCCCAGCTAGGCCTAGG - Intergenic
923368753 1:233289355-233289377 CTCCAGCTCCAGAAGAGCCTGGG + Intronic
924044451 1:240012715-240012737 CTCCAGCTCCAGAAGAGCCTGGG - Intergenic
924602920 1:245507266-245507288 GCCCAGCTCCACCTGAGTGTTGG - Intronic
924710683 1:246527870-246527892 CCCCTACCCCAGCTGGGCCTGGG + Intergenic
924862447 1:247937692-247937714 TCCCAGCGGCAGCTGAGCCTGGG - Intronic
1063364020 10:5478939-5478961 GCCCAGCTCCAGGGGAGCCGAGG - Intergenic
1063753219 10:8975987-8976009 CCCTAGCTCCAGCTTCCCCTGGG + Intergenic
1064563253 10:16613476-16613498 TCCCATCCCCATCTGAGCCTGGG + Intronic
1065094394 10:22266269-22266291 CCCTAGCTGCAGGGGAGCCTGGG - Intergenic
1065813675 10:29465054-29465076 CCCCAGCTGCAAGGGAGCCTGGG - Intronic
1065957977 10:30709922-30709944 CCCCAGCTGCAAGGGAGCCTGGG + Intergenic
1067018065 10:42772223-42772245 ACTCAGCTCTGGCTGAGCCTGGG - Intergenic
1067078062 10:43199229-43199251 CCCCAGCTCCTGCTGTCCCCCGG - Intronic
1067657505 10:48207551-48207573 CCCCAGCTCCAACTGACCCATGG - Intronic
1067834994 10:49632897-49632919 CCTCAGCTCCAGCTCAGACATGG + Intronic
1067848955 10:49743132-49743154 CCCCTCCTCCAGCTGAGACAAGG + Intronic
1068083607 10:52347817-52347839 CCTCTGCTCTGGCTGAGCCTGGG - Intergenic
1069698433 10:70404638-70404660 CCCCAGCTCCACCGAAGCCCCGG + Intronic
1070567476 10:77614792-77614814 ACCCAGCCCCAGCTCAGCTTGGG + Intronic
1070610238 10:77927245-77927267 CCCCACCCCCGGCTGCGCCTGGG - Intergenic
1070777855 10:79120488-79120510 ACAGAGCTCCAGCTCAGCCTCGG - Intronic
1070788697 10:79177055-79177077 TCCCAGCTGCAGCAGGGCCTGGG + Intronic
1070792126 10:79195737-79195759 CCCCACCTCCGGCTGTGACTGGG - Intronic
1071509461 10:86252110-86252132 GCCCAGGTCCAGCTGACCCACGG + Intronic
1071567707 10:86680287-86680309 CCCCTGCTGCAGCTGACCCTGGG + Intronic
1072223779 10:93349323-93349345 CCCCACCTCCAGGTGCCCCTGGG - Intronic
1072268611 10:93754072-93754094 CACCAGCAGCAGCTCAGCCTTGG - Intergenic
1072336496 10:94402843-94402865 CCCCGGCTCCAGCTGCTCCCCGG - Exonic
1072825196 10:98599092-98599114 CCCAAGCTCCAGCAGACCCAAGG - Intronic
1073098947 10:100997214-100997236 ACCCAGCGCCACCTGCGCCTCGG - Intronic
1073188178 10:101629981-101630003 CCCCAGCAGCCTCTGAGCCTGGG + Intronic
1073218363 10:101849535-101849557 GCACAGCTCCAGCTGGGCCTGGG - Intronic
1073612103 10:104954650-104954672 GCCCAGTTCCAGCTCAGGCTGGG - Intronic
1074683395 10:115933960-115933982 CCCCAGCCCCAGCTGAGTAGTGG + Intronic
1076178261 10:128385388-128385410 CCCCCTCTCCAGCAGCGCCTTGG - Intergenic
1076249965 10:128977848-128977870 CTCCTGCTCCAGCGGGGCCTGGG - Intergenic
1076362010 10:129896309-129896331 TCCCAGCACCAGCTGAGCTCGGG - Intronic
1076543265 10:131227640-131227662 CCTCACCTCCAGGTGAGCCGAGG + Intronic
1076691609 10:132226556-132226578 CAGCAGCCCCAGCTGAGACTGGG - Intronic
1076759330 10:132593162-132593184 CTCCATCTCCAGCTGATCTTAGG - Intronic
1076828976 10:132984924-132984946 TCCCAGCTGCAGCCGAGCCAAGG - Intergenic
1077118931 11:897944-897966 CCCCGGCTCCAGAAGAGCCCTGG - Intronic
1077160614 11:1110836-1110858 CCCCAGGGCCACCTGACCCTCGG - Intergenic
1077160628 11:1110906-1110928 CCCCAGTACCACCTGACCCTCGG - Intergenic
1077160650 11:1111016-1111038 CCCCAGGGCCACCTGACCCTTGG - Intergenic
1077183683 11:1227297-1227319 ATCCAGCTCCAGCTGAGAGTGGG - Exonic
1077352278 11:2098555-2098577 CCCCGGCTCCAGCAGGGCCCTGG + Intergenic
1077382568 11:2251118-2251140 CCAGAGCTACAGCTGAGCGTAGG + Intergenic
1077457284 11:2688688-2688710 TGCCAGCCCCAGCTGGGCCTAGG - Intronic
1077467514 11:2740554-2740576 CCCTGGCTCCAGCTGAGCTGAGG - Intronic
1077590744 11:3489099-3489121 CCCCAGCTCCAGATCAGGATGGG - Intergenic
1078760219 11:14245613-14245635 CCTCAGCTCCACCCAAGCCTGGG - Intronic
1079465287 11:20723957-20723979 CCACAGCTCAAGCTGTACCTTGG + Intronic
1079472292 11:20789985-20790007 GCTCAGCTCTGGCTGAGCCTGGG + Intronic
1080189268 11:29525218-29525240 CTCCAGCTTCAGCTGTGCATAGG - Intergenic
1080450458 11:32374814-32374836 TCCCAGGTCCAGGTGAGCCAAGG - Intergenic
1080908181 11:36567878-36567900 CCCCAGCTCCAGCTGCCACCTGG - Intronic
1081611403 11:44565452-44565474 CCTCAGCTCCAGCTGGGCCCGGG + Intronic
1081651550 11:44827360-44827382 CCTCAGCCCCTGCTGAGTCTTGG + Intronic
1081815381 11:45936790-45936812 TCCCAGCTCCTTCTAAGCCTGGG - Intronic
1081866180 11:46361867-46361889 CCCGAGCTCCTGCTGAGCCAGGG + Intronic
1082889060 11:58119011-58119033 ACCAGGCTCCAGCAGAGCCTGGG + Exonic
1083211995 11:61193944-61193966 CCCCAGCTCGAGCTGGGTCCTGG + Intergenic
1083213902 11:61206662-61206684 CCCCAGCACCAGCCGACCCTGGG + Intronic
1083216786 11:61225491-61225513 CCCCAGCACCAGCCGACCCTGGG + Intronic
1083219668 11:61244317-61244339 CCCCAGCACCAGCCGACCCTGGG + Intronic
1083623165 11:64058898-64058920 CCCCACCTCCAGCTGTGCCTGGG - Intronic
1083644980 11:64166646-64166668 ATTCTGCTCCAGCTGAGCCTTGG - Intergenic
1084086565 11:66857693-66857715 CGCCAGCCCCACCTGTGCCTGGG + Exonic
1084166410 11:67376690-67376712 CCCCAGCTCCAGACAAGCATGGG + Intronic
1084517980 11:69646674-69646696 CCCCCACCCCAGCGGAGCCTGGG - Intronic
1084538682 11:69773931-69773953 CTCCAGCCCCACCTGTGCCTGGG - Intronic
1084575667 11:69986417-69986439 CCCCAGCCCCAGCCCAGCCCCGG - Intergenic
1084826217 11:71733617-71733639 CCCCAGCTCCAGATCAGGGTGGG + Intergenic
1084887918 11:72223066-72223088 ACCCAGCTGGAGCAGAGCCTGGG - Intergenic
1084913701 11:72411823-72411845 CCCCAGCTGCAGCTGAGGGCTGG - Intronic
1084941142 11:72614021-72614043 AGCCCGCTTCAGCTGAGCCTCGG + Intronic
1084953510 11:72679411-72679433 GCCCAGCCCCAGCTGAGTCCAGG + Intergenic
1084961351 11:72718365-72718387 CCCGAGGTCCAGCTGAGGCCCGG + Intronic
1085530931 11:77191625-77191647 CCCCAGGTCCCGCTCAGCCGAGG - Intronic
1088038794 11:105351079-105351101 CCACAGCTCAAGCTGCACCTTGG + Intergenic
1088288098 11:108207760-108207782 CCACAGCTGCAGCTGCACCTGGG + Intronic
1088513301 11:110599715-110599737 GCTCAGCTCTGGCTGAGCCTAGG - Intronic
1088795042 11:113260610-113260632 CCCCAGCTCCAGCCTAGCCTTGG + Intronic
1089059165 11:115612188-115612210 CCCCAGCTCCAGCAGGTCTTGGG + Intergenic
1089191424 11:116656257-116656279 CCAGCCCTCCAGCTGAGCCTGGG + Intergenic
1089227362 11:116936913-116936935 CCCCATCCCCAGCTGAACTTTGG + Intronic
1089591912 11:119547042-119547064 TCTCAGCTCTGGCTGAGCCTGGG - Intergenic
1090333453 11:125948049-125948071 CCCCAGCTGCAGCTGGTCCGCGG + Intergenic
1090405049 11:126471471-126471493 CCCCAGCCCCAACTGACCCTGGG - Intronic
1091222446 11:133937272-133937294 CACTAGCCCCAGCTGAGCCCTGG + Intronic
1092417026 12:8298006-8298028 CCCCAGCTCCAGATCAGGGTGGG - Intergenic
1093637817 12:21492753-21492775 CCCCAGCTCCTGCTAAATCTTGG + Intronic
1094486604 12:30930381-30930403 TCGCAGCTCCAGCTGGGGCTTGG - Intronic
1094703872 12:32896609-32896631 CGCCAGCTTCAGCTTGGCCTCGG + Exonic
1095045471 12:37499349-37499371 CCACAGCACCAGCTCATCCTAGG + Intergenic
1096171982 12:49479113-49479135 GCCCAGCTCTGGCTGAGCCTGGG + Intronic
1096214468 12:49791802-49791824 CCCCAGCTCCAGCGGGGCCGTGG + Exonic
1096245063 12:49980101-49980123 CCTCAGCTCAAGCTAAGCCTGGG - Intronic
1096572245 12:52530291-52530313 GCACAGCTCCTGCTAAGCCTTGG - Intergenic
1096649773 12:53056454-53056476 CCCTTGCTCCATCTGAGACTCGG + Intronic
1096684623 12:53279825-53279847 ACCCAGCTCCTCCTGACCCTCGG + Exonic
1101086272 12:101239538-101239560 GCCCTGCTCTGGCTGAGCCTGGG - Intergenic
1101504241 12:105331201-105331223 CGCCAGCTGCAGGTGAGCCCCGG - Intronic
1101823128 12:108199356-108199378 GCCCAGCCTCAGCTCAGCCTGGG - Intronic
1101862904 12:108497597-108497619 CCAGAGTTCCAGCTGAACCTGGG - Intergenic
1102429895 12:112875141-112875163 GCCCAGCGCCACCTCAGCCTGGG + Exonic
1102507849 12:113395112-113395134 CCCCAGCTCCAGCACTCCCTAGG - Intronic
1103921686 12:124402632-124402654 CCCCAGCTCAGGCTGAGCCCAGG - Intronic
1103972242 12:124679492-124679514 ACCCAGATCCGGCTGAGGCTGGG - Intergenic
1103984779 12:124760018-124760040 CCCCAGCGCCAGCAGAGCAGAGG + Intergenic
1104672388 12:130689627-130689649 CCCCCTCCCCAGCTAAGCCTTGG - Intronic
1105041894 12:132967251-132967273 GCTCAGCTCTGGCTGAGCCTGGG - Intergenic
1105573729 13:21628923-21628945 CTCCAGCTCCAGAAGAGCCTGGG + Intergenic
1105784917 13:23738952-23738974 CCGCAGGTCCATCTGAGCCATGG - Intronic
1107272672 13:38638542-38638564 CTCCACTGCCAGCTGAGCCTGGG - Intergenic
1108730924 13:53234804-53234826 TCCCAGCTGCAAGTGAGCCTAGG - Intergenic
1109030002 13:57179406-57179428 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
1109870204 13:68323239-68323261 CCACAGCTCCAGCTGTACCTTGG + Intergenic
1109883015 13:68506809-68506831 CCCCTGTACCAGCTGAGTCTGGG - Intergenic
1111709782 13:91796392-91796414 TTCCAGCTCAAGCTGAGCTTTGG - Intronic
1112433871 13:99376505-99376527 CCACAGCACCAGCTGCACCTTGG + Intronic
1113302368 13:109036125-109036147 CCCCAGCTCCAGCCAACCCCTGG + Intronic
1113617987 13:111694577-111694599 GAGCAGTTCCAGCTGAGCCTTGG - Intergenic
1113623520 13:111779838-111779860 GAGCAGTTCCAGCTGAGCCTTGG - Intergenic
1114086183 14:19238199-19238221 CCCAATGTCCACCTGAGCCTGGG - Intergenic
1114349562 14:21835545-21835567 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
1114992240 14:28301061-28301083 CCCCAAGTGTAGCTGAGCCTGGG - Intergenic
1115636261 14:35292646-35292668 TCCCAGCTCCAGCCCAGCTTCGG - Intronic
1116257241 14:42571455-42571477 GCCCTGCTCTAGCTGAGCCCAGG - Intergenic
1116326842 14:43540943-43540965 CACCAGCTCCACCAGGGCCTTGG - Intergenic
1117495019 14:56294261-56294283 ACCCTGCTCCAGCTGAGCCCTGG - Intronic
1118783208 14:69024183-69024205 CCCCAGCTCCTTTTCAGCCTGGG + Intergenic
1119003970 14:70907780-70907802 CCCCGGCCCCAGCTCGGCCTCGG - Exonic
1119642673 14:76326935-76326957 GCCCAGCACCAGCACAGCCTCGG + Intronic
1120673299 14:87389098-87389120 CCCCAACCCCTGCAGAGCCTTGG + Intergenic
1121320399 14:92988535-92988557 CACCAGCACCAGGTGAGCCTAGG + Intronic
1121451126 14:94008939-94008961 CCCCAACCCTAGCTGAGCCCAGG - Intergenic
1121824646 14:97000571-97000593 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
1122353835 14:101112044-101112066 CCCCAGCCCCAGCTCAGCCTGGG - Intergenic
1122802516 14:104238782-104238804 CCCCAACTCCAGCTCAGGATTGG - Intergenic
1122885899 14:104710156-104710178 AGCCAGCACCAGCTGGGCCTTGG - Exonic
1123113942 14:105885462-105885484 TCCCAGCTCCGGCTGTCCCTGGG + Intergenic
1202897720 14_GL000194v1_random:19818-19840 CCCAATGTCCACCTGAGCCTGGG - Intergenic
1202853776 14_GL000225v1_random:37420-37442 CCCCAGCTCCTGGAGCGCCTGGG - Intergenic
1202859379 14_GL000225v1_random:72147-72169 CCCCAGCTCCTGTAGCGCCTGGG + Intergenic
1124436307 15:29652084-29652106 CTCCTGCTCTGGCTGAGCCTGGG - Intergenic
1125760929 15:42094852-42094874 CCCCAGCTCCACTGGAGCCAGGG + Intergenic
1126167073 15:45662787-45662809 CCCCACCTGCTGCTGAGCCCAGG + Intronic
1126796757 15:52265903-52265925 CTCCAGCTCCAGCTGAGTCCAGG + Intronic
1128375342 15:67070340-67070362 ACTCAGCTGCAGCTGAACCTAGG + Intronic
1128609339 15:69061434-69061456 GCCCAGCACCAGCCCAGCCTGGG + Intronic
1128916469 15:71567257-71567279 CCCCAGACACAGCTGAGCCAAGG + Intronic
1129227730 15:74179706-74179728 GCCCAGCTCCACCTCAGCCTTGG - Intronic
1129658657 15:77541142-77541164 ACCCAGCTCTCTCTGAGCCTTGG + Intergenic
1129713852 15:77835722-77835744 CCCCAGCTCTCTGTGAGCCTAGG - Intergenic
1129739899 15:77985129-77985151 CTCCAGCTCCTGCGGGGCCTGGG + Intronic
1130183189 15:81651878-81651900 GCCCAGCTCTGGCTGAGCCTGGG - Intergenic
1130324144 15:82865709-82865731 CAGCAGCTCCAGCTGTGACTAGG + Intronic
1131222535 15:90597085-90597107 GCCCAGCTGCAGCTGTGCCTTGG - Intronic
1131252176 15:90838065-90838087 CCCCTGCCCCTGCAGAGCCTTGG + Intergenic
1131623183 15:94089224-94089246 ACACAGCCTCAGCTGAGCCTTGG + Intergenic
1132554421 16:566295-566317 CCCCAGCTCTAGCTGCCCCGAGG - Intergenic
1132568209 16:632779-632801 GCCCAGCTTCACCTGCGCCTCGG + Exonic
1132597872 16:761504-761526 CCCCAGCTCCATGTGACCCAAGG - Intronic
1132981973 16:2742863-2742885 GCACTGCTCCTGCTGAGCCTGGG + Intergenic
1133270963 16:4610619-4610641 CCCCAGCCTCAGAGGAGCCTGGG - Intronic
1133924240 16:10181097-10181119 CCCCAGGCACAGCGGAGCCTGGG - Intronic
1134773421 16:16830810-16830832 CCCCACCTACAGCTGGCCCTGGG + Intergenic
1135183197 16:20292488-20292510 CCCCAGGTCCATCTGACCTTAGG - Intergenic
1135255867 16:20941229-20941251 CCCCAGCACATGCTGACCCTGGG - Intronic
1135484476 16:22852016-22852038 GCCCAGCTGAAGCTCAGCCTAGG + Intronic
1136113127 16:28077542-28077564 CCACAGCCCCAGCCGAGCATGGG - Intergenic
1136318295 16:29466640-29466662 TCCCAGCTTCAGCCGAGCCCTGG - Exonic
1136365282 16:29806657-29806679 CCCCGGCCCCCGCTGAGCCCCGG + Exonic
1136372884 16:29847249-29847271 CTCCAGCTCCAGCTGGGCCCGGG - Exonic
1136432870 16:30205989-30206011 TCCCAGCTTCAGCCGAGCCCTGG - Exonic
1137003691 16:35252998-35253020 CCACAGCTCCAGGTGAGCTGTGG - Intergenic
1137043976 16:35639369-35639391 TCTCAGCCCCAGCTGGGCCTTGG + Intergenic
1137334303 16:47533217-47533239 GCTCAGCTCTGGCTGAGCCTGGG + Intronic
1138393025 16:56683756-56683778 GCCCAGCCCCACCTGAGTCTGGG - Intronic
1138577319 16:57916290-57916312 CCCAAGGACCATCTGAGCCTTGG + Intronic
1139046132 16:63061994-63062016 CCCCTGTGCCAGCTGAGTCTGGG + Intergenic
1139478479 16:67215269-67215291 CACCAGCTCTAGCTGGGCCTCGG + Intronic
1139489853 16:67280262-67280284 CCCCAGCTGCAGATGAGTCGGGG + Exonic
1141524901 16:84604797-84604819 CCCCAGCTCCAGCTGACCCCTGG + Intronic
1141830661 16:86508516-86508538 CCCCAGCTCGCGCTGGGGCTTGG + Intergenic
1141847376 16:86619962-86619984 ACACAGCTCCAGCTGCCCCTTGG - Intergenic
1141992806 16:87620181-87620203 TCCCAGCGCAGGCTGAGCCTGGG + Intronic
1142210722 16:88807184-88807206 CACCCGCTCCAGCAGATCCTGGG - Exonic
1142706691 17:1699709-1699731 TCCCAGCTGCAGCTGAGGCAGGG - Intergenic
1142780557 17:2178197-2178219 CCCCATCTCCAGCCCAGCCCAGG - Intronic
1143114402 17:4574374-4574396 ACCAAGGTCCAGCTCAGCCTGGG + Intergenic
1143175553 17:4952971-4952993 CCCCAGCTCCTCAAGAGCCTTGG - Intronic
1143400124 17:6638187-6638209 CCACAGCTCCTCCTGAGCCACGG + Intronic
1143457785 17:7078869-7078891 CCCCAGCTCCACCCCAGACTGGG - Exonic
1143687229 17:8527485-8527507 CCCCAACTCATGCTGAGACTGGG + Intronic
1145897435 17:28467892-28467914 CTCCAGCTCCAGAAGAGCCTGGG - Intronic
1145962135 17:28892995-28893017 CCACAGCTCAAGCTGGGCCTTGG + Intronic
1145977589 17:28993209-28993231 CCCCAGCTCCAGCCCTACCTAGG - Intronic
1146567956 17:33929366-33929388 CCTTAGCTCCTGCGGAGCCTGGG + Intronic
1146761527 17:35482933-35482955 CCCCTGCTCTGGCTGAGCCCAGG - Intronic
1147266580 17:39238009-39238031 CCCCATCTCCAGAGGAGCCCGGG - Intergenic
1147310607 17:39593923-39593945 CACCATACCCAGCTGAGCCTAGG - Intergenic
1147659720 17:42111089-42111111 TCCCTTCCCCAGCTGAGCCTCGG - Intronic
1147849850 17:43433557-43433579 ATCCATCTGCAGCTGAGCCTGGG + Intergenic
1147993586 17:44349741-44349763 CCCCAGCTGCACCTGATCTTTGG - Exonic
1148143264 17:45343077-45343099 CCCCAGCTGCAGCTGGGAATCGG + Intergenic
1148318089 17:46722074-46722096 CTCCAGCTCCAGAAGAGCCTGGG + Intronic
1148434742 17:47674715-47674737 CCCCAGACCCAGCTGTGCTTTGG - Exonic
1148496108 17:48054451-48054473 CCGCATCTCCAGCGGAGACTTGG + Intronic
1148539279 17:48466950-48466972 CCCCATTTCCAGCTTGGCCTTGG + Intergenic
1148579893 17:48736268-48736290 CCCCAGCTTGAGATGAGCATTGG + Intergenic
1148641307 17:49189770-49189792 CCCCACCTCTAGCAGAACCTAGG + Intergenic
1149085482 17:52710374-52710396 GCCCTGCTCTGGCTGAGCCTGGG - Intergenic
1150613649 17:66752688-66752710 CTCCAGCCCCAGCAGAGCCATGG - Intronic
1150644199 17:66968089-66968111 CCCCATCTGCAGATGAGCCAGGG + Intronic
1150739190 17:67765874-67765896 CCCCAGCTGCAAGGGAGCCTGGG + Intergenic
1151475670 17:74343174-74343196 GGCCAGCCCCATCTGAGCCTAGG - Intronic
1151482779 17:74380075-74380097 CCCATCCCCCAGCTGAGCCTGGG + Intergenic
1151495089 17:74454099-74454121 CCCCAGCTCCAGCCAACCCGAGG + Intergenic
1151552416 17:74829793-74829815 CCCCAACTCCAGTGGTGCCTGGG + Intronic
1151562472 17:74878020-74878042 CCCCTGCTCCATCTGAGCCTTGG - Exonic
1151615692 17:75209277-75209299 CTCCAGCTCCATCTGTGCCTTGG - Intronic
1151675429 17:75595039-75595061 CCACAGCTCCAGCTCTCCCTGGG + Intergenic
1151746746 17:76015600-76015622 GCCCAGCGCCTGCAGAGCCTGGG - Exonic
1151842914 17:76630384-76630406 CCTGAGCTGCAGCTGACCCTGGG + Intronic
1152019048 17:77770961-77770983 CATCACCTCCAGCTGGGCCTTGG - Intergenic
1152401622 17:80070040-80070062 CACCAGACCGAGCTGAGCCTGGG - Intronic
1152855751 17:82663935-82663957 CCCCAGCCCCAGCTGCACCAGGG - Intronic
1153243206 18:3049777-3049799 CCCCACCTCCAGGAGAGCCCCGG - Intergenic
1153270843 18:3319595-3319617 CCCCAGCTCCAGGCCAGCCACGG + Intergenic
1153650120 18:7231968-7231990 CACCAGCTCCGGCAGAGGCTTGG - Exonic
1153655506 18:7278425-7278447 CCCCAGCTCCTGTTGATTCTGGG - Intergenic
1153987858 18:10368941-10368963 CCCCTCCTCCAGCTGTGTCTAGG + Intergenic
1154335306 18:13460399-13460421 CCGGAGTTCCAGCTCAGCCTGGG - Intronic
1156242464 18:35267351-35267373 CCCCAGATACAGCCGAGCCCCGG + Intronic
1156570169 18:38243770-38243792 CCCCAGCTCCAAAAGAGACTGGG - Intergenic
1157161482 18:45318025-45318047 TCCTAGCTCCCGCTGAGGCTGGG - Intronic
1158198059 18:54910400-54910422 GCCCAGCTCTGGCTAAGCCTGGG + Intronic
1158553386 18:58456195-58456217 CCCCAGCTGCAGGTCAGCATTGG - Intergenic
1159519061 18:69495505-69495527 GCTCAGCTCTGGCTGAGCCTGGG + Intronic
1159826104 18:73212790-73212812 CCCATTCTCTAGCTGAGCCTCGG - Intronic
1160455641 18:78997134-78997156 CCCCAGCTCCCCGTGAGTCTTGG + Exonic
1160811325 19:1014159-1014181 CCTCTGCTGCAGCTGAGCCCAGG + Intronic
1161208894 19:3056238-3056260 CCCCACCTCCAGCCCCGCCTTGG - Intronic
1161238004 19:3207480-3207502 CCCCTGCCCCACCTGAGCCTGGG - Intronic
1161479947 19:4505441-4505463 CCTCAGCTCCAGGTGACCCTTGG + Intronic
1161796472 19:6389620-6389642 GTCCCGCTCCAGCCGAGCCTAGG + Exonic
1161824137 19:6551329-6551351 GCCCTGCTCTGGCTGAGCCTGGG + Intergenic
1162193662 19:8966891-8966913 CCCCATCCCCACCTGAGGCTTGG - Exonic
1162297577 19:9823954-9823976 CCCTAGCTGCAGCTGTGCCTCGG - Intronic
1162369837 19:10271877-10271899 CCCCAGCTCCAGCCCAGCTAGGG + Intronic
1162460437 19:10811241-10811263 CCACAGCTCCAGCGGCTCCTTGG - Intronic
1162558419 19:11401964-11401986 GCCCCACCCCAGCTGAGCCTGGG - Intronic
1163129430 19:15263409-15263431 CGCAAGCTCCAGGTGAGGCTTGG - Exonic
1163154459 19:15432462-15432484 CCCCGGCTCCGGCTCGGCCTTGG + Intronic
1163417097 19:17193380-17193402 CCCCAGCTCCATGTGAGTGTTGG - Intronic
1163601258 19:18250456-18250478 CCCCAGCTCCAGGTGACACTGGG - Exonic
1163675930 19:18655290-18655312 TCCCAGCTCAGGCAGAGCCTTGG + Intronic
1163702597 19:18793671-18793693 CCACAGCTCCAGTGGGGCCTGGG + Intergenic
1163943473 19:20515565-20515587 AACCAGCTCTAGCTGAGCGTTGG - Intergenic
1164574069 19:29395323-29395345 CCCCAGCTGCAGGTGAGACATGG - Intergenic
1164648447 19:29875337-29875359 AGACAGCTGCAGCTGAGCCTGGG + Intergenic
1165019422 19:32911442-32911464 GCCCAGCTCAAGATCAGCCTGGG + Intronic
1165064824 19:33222890-33222912 CCTCTGCTCCAGCTCAGACTGGG - Intronic
1165092796 19:33395604-33395626 CACCCGCTCCTGCTGGGCCTAGG + Intronic
1165150621 19:33758160-33758182 CCTCAGCTGCAGCTGCCCCTCGG + Intronic
1165941347 19:39416248-39416270 CCCCAGCCCCAGCAGACCATTGG + Intronic
1166294515 19:41882609-41882631 CCCCAGCTGTTGCTGTGCCTGGG - Intergenic
1166298812 19:41902865-41902887 CCCCTGCTCCTGCAGAGCATCGG + Exonic
1166517461 19:43458058-43458080 CCCCAGTTCAAGATCAGCCTGGG + Intergenic
1166846855 19:45733714-45733736 CCCCAGCACTAGCTGGGCTTAGG + Intronic
1167070925 19:47221628-47221650 CTCCAGCCCCAGCCCAGCCTGGG - Exonic
1167145556 19:47679529-47679551 ACCCAGGTCCAGCTCAGCCTCGG - Exonic
1167254650 19:48419827-48419849 CCCCAGCTCCAGCCCAGCCCTGG - Intronic
1167667958 19:50833609-50833631 CCCCAGACCCAGCTGGGACTGGG - Intronic
1167840234 19:52110848-52110870 CTCCAGCTCCACCTCAGCCTTGG + Intergenic
1168004225 19:53473300-53473322 CTCCAGCTTCAGCTGTGCATAGG + Intronic
1168030538 19:53676168-53676190 CCCCAGCTACTGCAGAGGCTGGG + Intergenic
1168233776 19:55049230-55049252 CCGCACCTCCATCTAAGCCTTGG + Intronic
1168240428 19:55086429-55086451 CCCCACCTCCAGCTCTGGCTCGG + Exonic
1168270282 19:55246012-55246034 CCCCAGCTCCGGCTGACTCCTGG + Intronic
925407035 2:3612743-3612765 CTCCTGCACCTGCTGAGCCTTGG + Intronic
925922675 2:8647705-8647727 ACCCTGCTCTGGCTGAGCCTGGG - Intergenic
926434238 2:12822315-12822337 ACCCAGTTCCACCTGAGTCTGGG + Intergenic
926625466 2:15086178-15086200 GCCCTGCTCTAGCTCAGCCTGGG - Intergenic
926953646 2:18271438-18271460 ACCCTGCTCCCGCTGAGCCCAGG + Intronic
927510740 2:23642493-23642515 CCCCAGCTCCCGCTGATGCCAGG + Exonic
927661988 2:25001091-25001113 CCCCACCTGCAGCTGCACCTGGG + Intergenic
927810924 2:26179833-26179855 CCCCAGCTCCAGCCCTGACTTGG + Intronic
929049116 2:37819643-37819665 CCACATGTCCAGCTTAGCCTTGG - Intergenic
929492478 2:42408416-42408438 GCCCAGCTCTAGCTGAACCTGGG - Intronic
931069331 2:58626759-58626781 CTCAGGCTCCAGATGAGCCTAGG - Intergenic
931786320 2:65622357-65622379 CCCGAGCTCCTGCTCAACCTGGG - Intergenic
932092194 2:68816284-68816306 CATCAACTCCTGCTGAGCCTGGG - Exonic
932933157 2:76066792-76066814 CCCCAGATACAGTTGTGCCTGGG + Intergenic
933979866 2:87540691-87540713 TCCGAGGTCCAGCAGAGCCTTGG - Intergenic
934180096 2:89612086-89612108 CTCCAGCCCCACCTGTGCCTTGG + Intergenic
934290387 2:91686346-91686368 CTCCAGCCCCACCTGTGCCTTGG + Intergenic
934853873 2:97717293-97717315 GCCCTGCTCCTGCAGAGCCTTGG + Intronic
936289966 2:111215911-111215933 GCCCTGCTCTGGCTGAGCCTGGG + Intergenic
936290068 2:111216594-111216616 GCCCTGCTCTGGCTGAGCCTGGG + Intergenic
936313954 2:111410100-111410122 TCCAAGGTCCAGCAGAGCCTTGG + Intergenic
936439060 2:112534419-112534441 CCCCAGCTCCACAACAGCCTCGG + Exonic
937543517 2:122988555-122988577 CCCCGGGCCCAGCTGTGCCTTGG - Intergenic
938096393 2:128466995-128467017 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
938580433 2:132641075-132641097 CCCCACCTCCAGTTGAGGCAGGG + Intronic
940337609 2:152545642-152545664 CCCCAGAGGCAGCTGAGCCCAGG - Intronic
941641709 2:167995931-167995953 GCCCAGCACCCTCTGAGCCTGGG - Intronic
942151036 2:173076088-173076110 CCCGGGCTCCGGCGGAGCCTCGG - Intronic
942646040 2:178112299-178112321 CCTCAAATCCAGCTGAGCCTAGG - Intergenic
944516140 2:200513594-200513616 TCCCAACTCCGGCTGAGCCCAGG - Intronic
946142113 2:217700284-217700306 CCCCAGCTCCAGCAGTGGCTTGG + Intronic
946381942 2:219354829-219354851 CCCCATCTCTAGCAGAGACTGGG + Intergenic
946451975 2:219787907-219787929 ACTCAGCTCCATTTGAGCCTAGG + Intergenic
948697172 2:239737938-239737960 CCCCAGCCCCAGCCCAGCCCCGG + Intergenic
948769853 2:240246056-240246078 CTGCAGCTTCAGCCGAGCCTCGG - Intergenic
948770351 2:240248534-240248556 CCCCATGTCCAGATGAGCCCAGG - Intergenic
948893138 2:240916563-240916585 CTCCGGCTCCAGCTGGGCCGCGG + Intergenic
1168795126 20:606178-606200 CCACAGTCCCAGCAGAGCCTGGG + Intronic
1170539158 20:17370867-17370889 CCCCAGATACATCAGAGCCTTGG - Intronic
1171034604 20:21705419-21705441 TCCCAACCCCAGCTGGGCCTGGG - Intergenic
1171111645 20:22489703-22489725 CCCCAGCTGCAGGGGAGACTTGG - Intergenic
1171978223 20:31608716-31608738 CCCCAGCTGCAGCCGGGCCTGGG + Intergenic
1172115850 20:32573129-32573151 TCCCAGCTACACTTGAGCCTGGG - Intronic
1172790509 20:37502104-37502126 CTCCAGCTCCACCTGGTCCTGGG + Intronic
1173828000 20:46059283-46059305 CGCCAGCTCCAGCTCTGCCTTGG - Intronic
1174035878 20:47667976-47667998 TCCCCTCTCCAGCAGAGCCTTGG + Intronic
1174063723 20:47849959-47849981 CCCCACCTTCAGCTGGGCCCAGG + Intergenic
1174136987 20:48386542-48386564 CCCCCTCTCCAGCTGTGCCCTGG + Intergenic
1174476505 20:50799683-50799705 CCCCAGCTCCAGGAAAGACTTGG - Intronic
1174487267 20:50869338-50869360 CCACAGCCCCACCAGAGCCTGGG - Intronic
1175131899 20:56795608-56795630 CCCCAGCTGCAGTGGAGGCTGGG + Intergenic
1175268097 20:57714710-57714732 TCCCAGCTCCACCTCATCCTTGG - Intergenic
1175312968 20:58024569-58024591 CCACAGCTGCAGCTGCGCCCAGG + Intergenic
1175900961 20:62359765-62359787 ACCCAGAAGCAGCTGAGCCTGGG - Intronic
1175909874 20:62400131-62400153 CCCCACCTCCAGCTGGGACTGGG - Intronic
1175965106 20:62656493-62656515 CCCCAGCCCCAACTCAGCCATGG + Exonic
1176199533 20:63854223-63854245 CCCCAGCCCCAGTTTAGCCCAGG - Intergenic
1176408431 21:6434414-6434436 GCCCAGCTCTGGCTGAGCCTGGG - Intergenic
1176515579 21:7780999-7781021 CCCCAGCCCTGGCTGAGTCTTGG + Intergenic
1176617404 21:9035807-9035829 CCCAATGTCCACCTGAGCCTGGG - Intergenic
1176707736 21:10127862-10127884 CCCAATGTCCACCTGAGCCTGGG + Intergenic
1176976519 21:15327269-15327291 ACTCAGCTCTGGCTGAGCCTGGG - Intergenic
1178611469 21:34085716-34085738 CCTCAGCCCCAGCTGGGACTGGG + Intronic
1178649607 21:34411011-34411033 CCCCAGCCCTGGCTGAGTCTTGG + Intergenic
1178981439 21:37268008-37268030 TCCCAGCGCCAGCTGGGCCTAGG + Intergenic
1179599174 21:42464529-42464551 GACCAGCTCCAGCAGGGCCTGGG + Intergenic
1179683924 21:43042740-43042762 GCCCAGCTCTGGCTGAGCCTGGG - Intergenic
1179875804 21:44266808-44266830 CCCCGGGTCCAGCTGGGCCCAGG - Intergenic
1180050172 21:45327474-45327496 CCGCAACTCCACCTCAGCCTCGG - Intergenic
1180291680 22:10854537-10854559 CCCAATGTCCACCTGAGCCTGGG + Intergenic
1180291784 22:10854994-10855016 CCCAATGTCCACCTGAGCCTGGG + Intergenic
1180494485 22:15883959-15883981 CCCAATGTCCACCTGAGCCTGGG + Intergenic
1180494588 22:15884416-15884438 CCCAATGTCCACCTGAGCCTGGG + Intergenic
1183188141 22:36304219-36304241 GCACACCTCCAGCTGTGCCTGGG - Intronic
1183639873 22:39086401-39086423 CCCCTGCTTCAGCTGTGCCCAGG + Exonic
1183642559 22:39101335-39101357 CCCCTGCTCCTCCTGTGCCTGGG + Exonic
1183712153 22:39511368-39511390 CCCCAGCACCAGCCGGGCATTGG - Exonic
1183736086 22:39645730-39645752 CCCCAGCATTTGCTGAGCCTGGG - Intronic
1183745028 22:39687169-39687191 CCAGAGCCCCAGCTCAGCCTTGG - Exonic
1183826473 22:40391878-40391900 ACCCAGCTCTGGCTGGGCCTGGG + Intronic
1184352169 22:43951699-43951721 CAGCAGCTGCAGCTGGGCCTTGG - Intronic
1184560876 22:45262366-45262388 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
950123662 3:10498412-10498434 CCTCTGCTCCGGATGAGCCTGGG + Intronic
950253016 3:11482537-11482559 CCCCTGCTCCACCTGGGTCTAGG + Intronic
951562436 3:23982093-23982115 CCCCAGCTCTGACTCAGCCTAGG + Intergenic
952844063 3:37672095-37672117 GCCCAGCTCCAGCTGAACCCTGG - Intronic
952965912 3:38621104-38621126 CCCCAACTCCAGCTCTGCCATGG - Intronic
954099357 3:48357680-48357702 CCTCAGCTCTGGCTGAGCCCAGG + Intergenic
954192089 3:48970601-48970623 TACCAGCTCCAGCTGTGCCCTGG + Exonic
954412591 3:50377525-50377547 TCCCAGAACCAGCTGATCCTGGG - Exonic
954498060 3:50983455-50983477 GTCCAGCTCTGGCTGAGCCTGGG - Intronic
954678914 3:52330993-52331015 CCTCTGCTCCAGCAGAGCCAGGG - Intronic
954701083 3:52451217-52451239 CTCCAACTCCAGCTGAGTCCTGG - Exonic
955858844 3:63305217-63305239 CTCCAGCTTCATCTGAGCCTGGG + Intronic
961650294 3:128413712-128413734 CCCCAGGGCCAGGTCAGCCTGGG - Intergenic
961663902 3:128484764-128484786 CCCCAGCACCCGCTGAGCCCCGG - Intronic
961894575 3:130156608-130156630 CCCCAGCTCCAGATCAGGGTGGG - Intergenic
962199236 3:133388119-133388141 CCTCAGCTCCAGCTCAGTTTTGG - Intronic
962312933 3:134338655-134338677 CCCCAGCTCCAGCCTAGGCCTGG - Intergenic
962785922 3:138768399-138768421 GCTCAGCTCAGGCTGAGCCTGGG + Intronic
963804988 3:149714117-149714139 CCCCAGGCCCAGCTCCGCCTTGG - Intronic
963934902 3:151042470-151042492 CCCAAGCCCCAGCGGACCCTCGG - Intergenic
964255028 3:154766417-154766439 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
964503781 3:157376392-157376414 CCCCAGCTTCAACTGGGCCCTGG + Intronic
965929319 3:174023322-174023344 CCCCAGCTCCTGCAGATCCTAGG - Intronic
966840175 3:184081684-184081706 GCTCAGCTCTGGCTGAGCCTGGG - Intergenic
966863585 3:184243985-184244007 CCCCAGCACCACCTGAGGATTGG + Exonic
966883197 3:184361353-184361375 CCCCTGCTCCAGGTTACCCTGGG - Intronic
967151408 3:186654047-186654069 CTCCTGCTCCTGCTCAGCCTCGG - Intergenic
967822944 3:193855116-193855138 CCTCAGCTCCTGCTGAGTTTTGG + Intergenic
968016377 3:195337945-195337967 TCCCACCTCAACCTGAGCCTGGG + Intronic
968426524 4:527128-527150 CCCCAGCGCCAGGGCAGCCTTGG - Exonic
968486456 4:865352-865374 GCCCAGCCTCAGCTCAGCCTGGG - Intronic
968488541 4:877027-877049 CCCCAGCCCCCCATGAGCCTAGG + Intronic
968523403 4:1044644-1044666 CTCCAGCTCCAGCAGAGCAGAGG - Intergenic
968730805 4:2268422-2268444 CCCCAGCCCCAGCTGTGGGTGGG + Intergenic
969068178 4:4507272-4507294 TTCCAGCTCCAGAAGAGCCTGGG - Intronic
969526670 4:7707382-7707404 CATCAGTTCCAGCTGAGCCAGGG + Intronic
969656632 4:8502538-8502560 AGCCTGCCCCAGCTGAGCCTCGG - Intergenic
969748200 4:9090462-9090484 CCCCAGCTCCAGATCAGGGTGGG + Intergenic
971092327 4:23360446-23360468 CCCCATCTGCAGCTGTGGCTGGG - Intergenic
971298810 4:25425024-25425046 TCCCAGGTCCAGCTGGGTCTAGG - Intergenic
972072583 4:35039085-35039107 GCCCTGCTCTGGCTGAGCCTGGG - Intergenic
972279807 4:37590883-37590905 CCCCATCTCCATCGGAGCCATGG - Exonic
972358267 4:38303193-38303215 GCTCAGCTCTGGCTGAGCCTGGG + Intergenic
974619865 4:64340883-64340905 CCTCAGCTCTGCCTGAGCCTGGG - Intronic
975044432 4:69783816-69783838 CCTCTGCTCTGGCTGAGCCTGGG - Intronic
977311378 4:95391902-95391924 CCCCAGCTCTAGCTGACCCCTGG + Intronic
977471873 4:97452543-97452565 GCTCAGCTCTGGCTGAGCCTGGG - Intronic
978392210 4:108238921-108238943 CCCCATCTCTAGCTGGGCATGGG + Intergenic
979108689 4:116721314-116721336 CCACAGTCCTAGCTGAGCCTAGG + Intergenic
979311866 4:119212709-119212731 CTCCAGTTCCCGGTGAGCCTCGG + Intronic
979362744 4:119783766-119783788 CTCCAGCTCCAGCTTAGCAGGGG - Intergenic
979805730 4:124968568-124968590 CCAGAGCTCCAGCTCAGCTTTGG + Intergenic
979984392 4:127296022-127296044 CCACAGCCCAAGCTGAACCTTGG + Intergenic
981337184 4:143581043-143581065 CCCCAGCTCCTGCTGCGCTCAGG + Intronic
981872902 4:149507979-149508001 CAGCAGCTCAAGCTGTGCCTTGG - Intergenic
982141051 4:152318384-152318406 CCCCAGACCCAGCTGAGCCCTGG - Intergenic
983322424 4:166211787-166211809 TCACAGCTCAAGCTGTGCCTTGG + Intergenic
984752838 4:183295520-183295542 CCCTTGGTCCAGCTGTGCCTTGG + Intronic
985538841 5:478580-478602 CCCCACATGCAGCTGAGCCCAGG + Intronic
985631701 5:1017400-1017422 CCCCTGCTCCAGCTCTGTCTGGG - Intronic
986078929 5:4368893-4368915 CAGCAGCTTCACCTGAGCCTGGG - Intergenic
986205838 5:5624151-5624173 ACTCAGCTCCAGATGAGACTTGG + Intergenic
986553454 5:8984328-8984350 CCCCAGCTCCACTTTACCCTAGG + Intergenic
987195707 5:15523827-15523849 ACCCAGCTGCAGTTGAGTCTGGG + Intronic
991711939 5:69416520-69416542 CCACCCCTCCAGCTTAGCCTTGG - Intronic
992557533 5:77917722-77917744 TGCCAGCTCCAGTTCAGCCTAGG + Intergenic
995849377 5:116529016-116529038 ACCCAGTACCAGCAGAGCCTTGG - Intronic
996923835 5:128799988-128800010 GCTCAGCTCTGGCTGAGCCTGGG + Intronic
997508436 5:134436697-134436719 CGCCAGCTCCATGTGAGTCTGGG + Intergenic
997960463 5:138316652-138316674 ACCCTGCTCTGGCTGAGCCTGGG - Intronic
998528671 5:142865159-142865181 GCCCAGCCCCAGCTCAGCCCTGG - Intronic
999276194 5:150331635-150331657 TCCCAGCTCCAGCAGAGGCCAGG + Intronic
999384171 5:151142646-151142668 CCCCAGCTCTAGCACAGGCTTGG + Intronic
999551274 5:152689694-152689716 CCGCACATCTAGCTGAGCCTGGG - Intergenic
999868637 5:155728310-155728332 CTCCGGCTCCAGCTGGGGCTTGG - Intergenic
1000305581 5:159991655-159991677 CCCCACCTCCAACTAGGCCTGGG - Intergenic
1000426223 5:161093868-161093890 CCTCAGCTCTGGCTGAGCCCAGG - Intergenic
1001406763 5:171482212-171482234 CCCTATCCCCAGCTCAGCCTGGG + Intergenic
1002098700 5:176846809-176846831 CCCCAGCTCCCTCCGGGCCTCGG - Intronic
1002518258 5:179774996-179775018 CCCAAGCTCCAGGTGAGGCCTGG + Exonic
1002986239 6:2192003-2192025 GCCCTGCTCTAGCTGAGCCCGGG - Intronic
1004072686 6:12315329-12315351 CCCCAGCCCCACTAGAGCCTAGG + Intergenic
1004304511 6:14487774-14487796 GCTCAGCTCCGGCTGAGCCCAGG - Intergenic
1004879745 6:19995951-19995973 CTCCTCCTCCTGCTGAGCCTGGG + Intergenic
1006276257 6:33007546-33007568 GCCCAGCTCCACCCGAGACTTGG + Exonic
1006416541 6:33907536-33907558 CTCCCTCTCCAGCTGGGCCTCGG - Intergenic
1006502998 6:34469839-34469861 CCCCAGAGCCAGCTGAGGCCAGG - Intronic
1007286914 6:40754583-40754605 CCGCCGCTGCCGCTGAGCCTTGG - Intergenic
1008929590 6:56924380-56924402 CCCCAGCTCCAGCTCACCAATGG + Intronic
1009380545 6:63023465-63023487 TCCCAGCTCCAGCTGAGAGTGGG + Intergenic
1009610143 6:65930932-65930954 ACCCAGCTCTGGCTGAGCGTGGG + Intergenic
1009656848 6:66558483-66558505 TCCCAGCTCCAGCTGGGGGTTGG + Intergenic
1010810428 6:80293396-80293418 CCACAGCCCAAGCTGTGCCTTGG + Intronic
1011471070 6:87708359-87708381 CCTCAGCTGCAGTTGAGCCGCGG - Intergenic
1012220973 6:96648980-96649002 CTCCAGCTGCAGAAGAGCCTGGG + Intergenic
1012718102 6:102702109-102702131 GCACAGCTGCAGCTGTGCCTAGG + Intergenic
1014714550 6:124849055-124849077 CCACAGCTCAAGCTGTACCTCGG - Intergenic
1016621026 6:146109346-146109368 CCACAGCCCAAGCTGTGCCTTGG - Intronic
1016709814 6:147156715-147156737 CCTCAGCTGCAGCTCAGCCCAGG + Intergenic
1018172886 6:161155464-161155486 CCGCAGCTCCAGCTCAGCACAGG + Intronic
1018812618 6:167308601-167308623 CCCCAGCCCCAGCAAGGCCTTGG - Intronic
1019701621 7:2477095-2477117 CCCCACCTCAGGCTGAGCATGGG + Intergenic
1020210602 7:6155184-6155206 CCGCGACTCCAGGTGAGCCTGGG + Exonic
1020270737 7:6593857-6593879 CAGCAGTTCCAGATGAGCCTGGG - Intronic
1020324805 7:6966185-6966207 CCCCAGCTCCAGATCAGGGTGGG - Intergenic
1020790967 7:12627792-12627814 CCCCAGCACCAGCTGTGTCCTGG + Intronic
1021561382 7:21972019-21972041 GCCCTGCTCTAGCTGAGCCCAGG + Intergenic
1022275069 7:28847193-28847215 TCCCAGCCCCAGCTGAGTCCGGG + Intergenic
1024622585 7:51174998-51175020 CCCCAGCTCCAGAGGATCCCGGG + Intronic
1025095400 7:56092163-56092185 CCCCAGCCCCAGCTCTGACTGGG + Intronic
1025150292 7:56541954-56541976 CCCAAGCACCACCTGAGGCTGGG - Intergenic
1026095575 7:67343774-67343796 CACCTGCTCCAGCTGGGCTTTGG + Intergenic
1026972767 7:74478100-74478122 CCCCAGTTCTGGCTGAGCCCCGG - Intronic
1027385837 7:77659087-77659109 CAGCAGCGCCAGCTGAGCCCCGG - Intergenic
1028481806 7:91314344-91314366 CCCCAGATCCAGCTGCCCCTAGG + Intergenic
1029327637 7:99823502-99823524 GCTCAGCTCTAGCAGAGCCTGGG - Intergenic
1031002050 7:116426999-116427021 CAACAGGTCCAGCTGACCCTAGG - Intronic
1031393428 7:121244306-121244328 CCTCAACTCCAGCAGTGCCTGGG + Exonic
1031743705 7:125468065-125468087 GCCCTGCTCTGGCTGAGCCTGGG + Intergenic
1032240511 7:130155276-130155298 CCCCAGCACCAGCAGGGCCTGGG + Intergenic
1032483181 7:132262913-132262935 CCCCAGCTCCATCCAAACCTTGG - Intronic
1032919360 7:136527930-136527952 CCACAGCTGCAGCTGTGCCCAGG + Intergenic
1034055987 7:148035484-148035506 CACCAGCACCAGCTGCACCTGGG - Intronic
1034959793 7:155358140-155358162 CCCTGCCTCCAGCTGGGCCTCGG - Exonic
1035314571 7:157990135-157990157 CCCCAGCTGCAGCTTCACCTGGG - Intronic
1036661966 8:10714695-10714717 CCCCATCAGCAGCTAAGCCTGGG - Intergenic
1036679062 8:10857374-10857396 CCTCTTCTCCAGCTGAGCATAGG - Intergenic
1036879643 8:12500889-12500911 CCCCAGCTCCAGATCAGGGTGGG - Intergenic
1037823375 8:22146675-22146697 CCCCAGCCCCAGCTGACCTTGGG + Intergenic
1038160339 8:25031221-25031243 CTCCAGCTCCAGCTGGCTCTAGG - Intergenic
1039870418 8:41540779-41540801 CCCCAGCCCCAGCACAGGCTGGG - Intronic
1039893506 8:41700070-41700092 CTCCAGCTCCAGTTGAAGCTAGG - Intronic
1042687839 8:71461953-71461975 GTCCAGCTCTGGCTGAGCCTGGG + Intronic
1042846697 8:73175863-73175885 ACACAGGTCCTGCTGAGCCTGGG + Intergenic
1044233938 8:89808992-89809014 CCACAGCTTGAGCTGTGCCTTGG - Intergenic
1044962371 8:97543104-97543126 GCCCTGCTCTGGCTGAGCCTGGG - Intergenic
1047626115 8:126657805-126657827 CCCCAGCACCAACTCAGCCAGGG - Intergenic
1047746931 8:127852073-127852095 CCCCAACTGCTGCTGAGCCTGGG - Intergenic
1047918141 8:129604470-129604492 TCTCATCTCCATCTGAGCCTGGG + Intergenic
1048251902 8:132873270-132873292 CCCCAGCTCAAGGTGAGTGTGGG - Intronic
1048588445 8:135798064-135798086 CCCCAGCTCCAGCAGGACCCTGG - Intergenic
1049016326 8:139922666-139922688 CCCCAGTTCCAGGTGAGACGCGG + Intronic
1049037277 8:140086477-140086499 CCACAGCTCCACCTGTGCCCTGG + Intronic
1049194473 8:141307989-141308011 CCCCACCTCCCGCACAGCCTCGG - Intronic
1049203149 8:141351537-141351559 CCTCAGCTCCAGCTGAGTTCTGG + Intergenic
1049425238 8:142535255-142535277 CCTCTGCTCCAGCTGGCCCTGGG - Intronic
1049443969 8:142621680-142621702 CCCCAGCTCCCCCTCAGCCCTGG - Intergenic
1049529278 8:143146378-143146400 CTCCAGCTGCAGCTCAGCCCTGG - Intergenic
1049570402 8:143367711-143367733 CCACAGGCCCAGCGGAGCCTTGG - Intergenic
1049773842 8:144395744-144395766 CCCTAGCCCCAGCTGAGCGTGGG - Intronic
1050090660 9:2014958-2014980 GCCCAGCTCCAGCAGGGCTTGGG + Intergenic
1051001772 9:12290806-12290828 CCTCTGCTCTGGCTGAGCCTGGG - Intergenic
1056098315 9:83276499-83276521 CCACAGTTCCAGAAGAGCCTGGG - Intronic
1057468570 9:95337795-95337817 GCTCAGCTCTGGCTGAGCCTGGG - Intergenic
1058312045 9:103515524-103515546 CCCCAGCTCAAGCAGACCCCAGG - Intergenic
1058600863 9:106668683-106668705 CCACTGCTCCTGCTGGGCCTAGG - Intergenic
1058810004 9:108630333-108630355 CCACAGCCCAAGCTGTGCCTTGG - Intergenic
1059323038 9:113483880-113483902 CCCCAGCTCTGGCTGGGCCGTGG + Intronic
1059495165 9:114703194-114703216 CCCCACCCCCATCTGAGCCAGGG - Intergenic
1059581750 9:115556525-115556547 CCACAGCTCAAGCTGCACCTTGG + Intergenic
1060186922 9:121569079-121569101 ACCCCTCTCCAGCTGGGCCTGGG - Intronic
1060342513 9:122789727-122789749 CCCCAGCTCCAGCTATGCCCTGG + Exonic
1060526827 9:124325591-124325613 CCCCGTCTCTAGCTGAGCCGTGG + Intronic
1060793706 9:126501503-126501525 CCTCAGCCCCAGCTGAGACTCGG + Intronic
1060862033 9:126962401-126962423 CCCAGGCCCCAGCTGAGCCTTGG + Intronic
1061225886 9:129280826-129280848 CACCAGGTCCAGCTGGGCCAGGG - Intergenic
1061267381 9:129514615-129514637 GCTCAGCTCTGGCTGAGCCTGGG - Intergenic
1061626909 9:131845961-131845983 CCCCAGCCCCGGCTGGGCCTTGG + Intergenic
1061727212 9:132588526-132588548 CCTCACCTGCAGGTGAGCCTAGG + Intronic
1061913628 9:133737991-133738013 CCCCACCACCCCCTGAGCCTGGG - Intronic
1062013907 9:134281803-134281825 CACCAGGTCCGGCAGAGCCTGGG + Intergenic
1062042526 9:134410688-134410710 CCCCAGCTCCAGCCACGCCTCGG - Intronic
1062056172 9:134470697-134470719 GCCCAGGTCCTCCTGAGCCTGGG + Intergenic
1062070596 9:134553199-134553221 CCGGGGCTCCAGCTCAGCCTGGG + Intergenic
1062206759 9:135341812-135341834 CCCCAGAGCCCTCTGAGCCTTGG - Intergenic
1062395333 9:136350476-136350498 CTGCAGCTCCAGCTGGGCCAAGG + Intronic
1062442401 9:136576627-136576649 CCCCACTTCCAGCGGAGGCTGGG + Intergenic
1062501662 9:136854458-136854480 CCCCAGCTCCAGGGGGGCCCTGG - Intronic
1062533039 9:137010086-137010108 CTCCAGGTGCAGCAGAGCCTCGG - Exonic
1062614614 9:137390776-137390798 CCCCACTGCCAGCTGGGCCTGGG + Intronic
1062619012 9:137411250-137411272 CCCCAAACCCAGCTGAGCCCAGG + Intronic
1062635404 9:137487912-137487934 CCCTCACTGCAGCTGAGCCTTGG + Intronic
1202792481 9_KI270719v1_random:96742-96764 CCCAATGTCCACCTGAGCCTGGG + Intergenic
1203377248 Un_KI270442v1:385561-385583 CCCCAGTTCCAGAGGAGCCAGGG + Intergenic
1187201197 X:17135111-17135133 CCCCAGTTCTTGCTGAGCCATGG + Intronic
1187447150 X:19370034-19370056 CCTCTCCTGCAGCTGAGCCTGGG + Intronic
1188844847 X:35059892-35059914 CCCTAGCTGCAGCTGTGGCTTGG - Intergenic
1189155134 X:38749372-38749394 CCCCAGCTCTAGCTGAGGCCTGG + Intergenic
1189220848 X:39370432-39370454 CTCCAGCTGCAGCTCTGCCTGGG + Intergenic
1192737616 X:73863846-73863868 CCCTAGCACCAGGTTAGCCTAGG + Intergenic
1192793730 X:74409588-74409610 CTCCAGCTCCAGAAGAGCCTGGG - Intergenic
1192803786 X:74492744-74492766 CCCAACGTCCAGCTAAGCCTGGG + Intronic
1193211551 X:78811691-78811713 CTGCAGCTGCAGCTGTGCCTAGG + Intergenic
1193278908 X:79625068-79625090 TCCCACCTCCAGCTCATCCTGGG - Intergenic
1194380309 X:93181943-93181965 GCCCTGCTCTAGCTGAGCCCAGG - Intergenic
1194981695 X:100447956-100447978 CCCTTGCCCCAGCTGAGCCCAGG + Intergenic
1195902729 X:109815623-109815645 CCAGAGCTGCAGCTGAGCATGGG - Intergenic
1197542922 X:127788943-127788965 CCCCTGCTTCAGCTCAGGCTTGG - Intergenic
1197795965 X:130299268-130299290 GCCCTGCTCTGGCTGAGCCTGGG + Intergenic
1199844420 X:151680463-151680485 GCCCAGCCCATGCTGAGCCTGGG - Intergenic
1200151150 X:153952097-153952119 CCCCAGCTCCGCCTGAGTCACGG + Exonic
1201150800 Y:11094644-11094666 CCCAATGTCCACCTGAGCCTGGG - Intergenic