ID: 905044462

View in Genome Browser
Species Human (GRCh38)
Location 1:34985087-34985109
Sequence GCTGAGCCTCGGAAGCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905044450_905044462 30 Left 905044450 1:34985034-34985056 CCCAGGCAGGACCTGCGCCTCAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 905044462 1:34985087-34985109 GCTGAGCCTCGGAAGCCCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 95
905044452_905044462 19 Left 905044452 1:34985045-34985067 CCTGCGCCTCAGTCGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 905044462 1:34985087-34985109 GCTGAGCCTCGGAAGCCCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 95
905044455_905044462 0 Left 905044455 1:34985064-34985086 CCAGGCGCTTTCCCCCAGCTCCA 0: 1
1: 0
2: 2
3: 18
4: 271
Right 905044462 1:34985087-34985109 GCTGAGCCTCGGAAGCCCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 95
905044454_905044462 13 Left 905044454 1:34985051-34985073 CCTCAGTCGAAAGCCAGGCGCTT 0: 1
1: 0
2: 0
3: 2
4: 57
Right 905044462 1:34985087-34985109 GCTGAGCCTCGGAAGCCCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 95
905044451_905044462 29 Left 905044451 1:34985035-34985057 CCAGGCAGGACCTGCGCCTCAGT 0: 1
1: 0
2: 3
3: 17
4: 163
Right 905044462 1:34985087-34985109 GCTGAGCCTCGGAAGCCCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905044462 Original CRISPR GCTGAGCCTCGGAAGCCCGA AGG Intronic
900591212 1:3460841-3460863 GCTGAGCCTCCCAGGCCCCAGGG - Intronic
905044462 1:34985087-34985109 GCTGAGCCTCGGAAGCCCGAAGG + Intronic
905912078 1:41662133-41662155 GCGGAGCCTCGGCCGCCCGCAGG - Intronic
905915042 1:41678742-41678764 GCTGAGCCTTGGCAGCCCTGGGG - Intronic
906146711 1:43564901-43564923 GCTCAGCCTTGGACGCCTGAGGG - Intronic
913197121 1:116466356-116466378 GCTGAGACTCAGGAGCCTGATGG - Intergenic
916004448 1:160646669-160646691 GCTGAGTCTTGGAAACCCAAGGG + Intronic
920120128 1:203650255-203650277 GCTGAGCCACTGAAGCCACAGGG + Intronic
924707038 1:246509971-246509993 GCTTAGCCCCGGAAGCCCATGGG - Intergenic
1063022775 10:2146328-2146350 GCTGTGCCTTTGCAGCCCGAGGG - Intergenic
1067469909 10:46528577-46528599 TCTGAGCCTGGGCAGCCTGAGGG - Intergenic
1070256093 10:74814080-74814102 GCAGAGCATCGGAGGCCCGGTGG + Intergenic
1077185477 11:1233715-1233737 GCGGGGGCTCGGAAGCCCGGGGG + Intronic
1077390465 11:2298636-2298658 GCTGAGACTCGGCACCCCGTGGG - Intronic
1081782386 11:45722215-45722237 GATGAGCCTTGGAAGCGTGATGG - Intergenic
1081969278 11:47186689-47186711 GCAGAGCCTGGGAGACCCGAGGG + Intergenic
1083675075 11:64320688-64320710 GCTGAGGCTCTGAAGGCCAAGGG + Exonic
1087113119 11:94493506-94493528 GTTGAGGCTTGGAATCCCGACGG - Intronic
1092155368 12:6278718-6278740 GCAGAGCCTGGGATCCCCGAGGG + Intergenic
1092534979 12:9379070-9379092 GCTGAGTCTTGGAAGCCGGCAGG + Intergenic
1097124925 12:56766456-56766478 GCTGAGCCTTGGAGGACAGATGG - Intronic
1097885514 12:64724899-64724921 CCTGAGCCATGGAAGCCAGAAGG + Intronic
1098390017 12:69959782-69959804 GCTGAGATTCTGAAGCCAGATGG + Intergenic
1105730831 13:23213842-23213864 GCTGAGCCTCGGTAGCCTACAGG - Intronic
1110673503 13:78210183-78210205 GCTGTGCCTCGGAAGAAAGAGGG + Intergenic
1115754089 14:36516708-36516730 GCTGAGCCTAGGCGGCCAGAGGG + Exonic
1118975371 14:70671757-70671779 GCAGAGTCTCGGATCCCCGATGG - Exonic
1119783639 14:77296337-77296359 GAGGAGCCTCGGAAGCCACAGGG + Intronic
1121444976 14:93973018-93973040 GCCCAGCCTTGGAAGCCCCAAGG - Intronic
1123937633 15:25201735-25201757 GCTGACCCTCGGCAACCCTATGG - Intergenic
1125831664 15:42721263-42721285 GCTCTGCCTCAGAAGCCCCAGGG - Intergenic
1129265018 15:74388753-74388775 GGTGAGCCTTGGAAGCAGGAGGG - Intergenic
1131140366 15:89972242-89972264 GCTGAGCCTCAGAAGAAGGAAGG - Intergenic
1132012289 15:98286516-98286538 TCTGAGCCTCTGAATTCCGATGG - Intergenic
1133676195 16:8075292-8075314 ACTGAGCCTCAGAAACCTGAAGG + Intergenic
1142470514 17:160966-160988 CCTGAGCCACTGAAGCCTGAGGG - Intronic
1142740370 17:1928499-1928521 TCTGAGCCTCGGAGGCCCTGAGG - Intergenic
1143902156 17:10182539-10182561 GCTGAGCCTGGGAGGCCACATGG - Intronic
1146670918 17:34736873-34736895 GCTGGGGTTCAGAAGCCCGAGGG - Intergenic
1151222849 17:72626039-72626061 ACAGAGCCACGGAAGCCTGAGGG + Intergenic
1151372554 17:73657612-73657634 GTGGAGCCTCGGAAGCCAGGTGG - Intergenic
1152636705 17:81433142-81433164 GCTGAGCTTCTGAAGCCTCAGGG + Intronic
1160931937 19:1574967-1574989 GCTGAGACTCGGGAGCCCTGTGG + Intronic
1161103171 19:2431421-2431443 CCTGAGCCACGGCAGCCAGATGG + Intronic
1162514273 19:11138770-11138792 GCTGAGCCGCGGCTGCCAGAGGG + Intronic
1163023982 19:14498892-14498914 GCTGAGGCTGGGAAGTCCAATGG + Intergenic
1164530087 19:29041921-29041943 GCTGAGGAGCGGAAGCCAGAAGG - Intergenic
1164674452 19:30092149-30092171 GCTGAGCCTCAGAGGCCAGCAGG - Intergenic
1165837870 19:38770457-38770479 GGTGGGGCTGGGAAGCCCGACGG - Intergenic
1165841695 19:38792240-38792262 GGTGGGGCTGGGAAGCCCGACGG + Intergenic
1165858294 19:38893474-38893496 GCTCAGCCTGGGCAGCCAGAAGG - Exonic
1166108942 19:40611235-40611257 GCCGAGCCCCGGAAGCCAGCCGG - Exonic
1167142349 19:47660758-47660780 GCTGAGACTCCTAAGCCCGTGGG - Intronic
1172082206 20:32350935-32350957 GCTGGGCCTTGAAAGCCCAAAGG - Intergenic
1172811169 20:37649420-37649442 GCCGAGCCTCCGAAACCCCAGGG - Intergenic
1175036579 20:56005577-56005599 GATGAGCCTCAGAAGCCGCAGGG + Intergenic
1175100222 20:56574168-56574190 GCTGAGCCTCGGTAGGCCTGTGG + Intergenic
1175995479 20:62810383-62810405 GTTGAGCCTGGGAACCCAGAGGG + Intronic
1179411799 21:41168194-41168216 GCTGAGCCGCGGCTGCCGGACGG + Exonic
1180088935 21:45524071-45524093 GGTGAGCCTCCGAAGCCCAGGGG - Intronic
1180089015 21:45524374-45524396 GGTGAGCCTCCGAAGCCCAGGGG - Intronic
1180089095 21:45524677-45524699 GGTGAGCCTCCGAAGCCCAGGGG - Intronic
1184831524 22:46991869-46991891 GCAGAGCCCCGGCGGCCCGAGGG - Intronic
1185138559 22:49087827-49087849 TATGAGCCTGGGAAGCCTGAAGG + Intergenic
954422347 3:50425362-50425384 GCTGAGCCTTGGAAGGCAGGTGG - Intronic
968904215 4:3444166-3444188 GCTGGGCCTCGGAGGTCCGCAGG + Intronic
968908728 4:3466122-3466144 GCTGAAACTCAGAAACCCGAGGG + Intronic
981719549 4:147787661-147787683 GCTGAGCCAGGGAAGCACGAAGG - Intronic
986606726 5:9530048-9530070 GCAGAGGCTGGGAAGCCCCAGGG + Intronic
993047771 5:82887880-82887902 AATGAGCCTCAAAAGCCCGAGGG - Intergenic
994710368 5:103258642-103258664 GCTGCGCCTCTGCAGCCAGAGGG + Intergenic
1001746090 5:174093483-174093505 GCAGAGCCTTCGAAGCCAGAAGG - Intronic
1002081203 5:176738489-176738511 GCTGAGCCTGGGGAGCTCTAGGG - Intergenic
1007251819 6:40500357-40500379 TCTGAGGCTCTGAAGCCAGAGGG - Intronic
1011535549 6:88372235-88372257 CCTGAGCCTCTGAAGCCAAATGG + Intergenic
1015569328 6:134604951-134604973 GCTGAGCCTGGGAAGAACCAGGG - Intergenic
1018545141 6:164927703-164927725 GCAGAGCCTTGGAAGCCGGCGGG - Intergenic
1019065132 6:169290108-169290130 GCAGAGCCTGGGATGCCGGAGGG - Intergenic
1019297301 7:284966-284988 GCTGAGGCTCGGGAGCACGGTGG + Intergenic
1022097858 7:27152003-27152025 GCTGTGCCACGGAGGGCCGAAGG + Intronic
1023696864 7:42856727-42856749 GCTGAGCTAGGGAAGGCCGAGGG + Intergenic
1031986283 7:128166664-128166686 GCGGAGCCGCGGAACTCCGAGGG - Intergenic
1035528546 8:333653-333675 CATGAGCCTCGGAAGGCCCATGG - Intergenic
1040799414 8:51324585-51324607 GCAGAGCCTCAGAAGCCTGTGGG - Intronic
1049378137 8:142298742-142298764 GCTGAGCCTGAGCCGCCCGAGGG + Intronic
1049579649 8:143405513-143405535 GCTGGGCCTCGGAATCCCAAGGG + Intergenic
1049643873 8:143727560-143727582 GCTGGGACGCGGAAGGCCGAGGG + Exonic
1052048620 9:23822008-23822030 GGTGAGACTCGGAAGTCCGGAGG - Intronic
1058463902 9:105209235-105209257 TCTGAGCCTGGGAAGGTCGAGGG + Intergenic
1059332232 9:113542873-113542895 CCTGGCCCTCGGAAGCCCCATGG - Intronic
1060804067 9:126563947-126563969 GCGGACCCTGGGAAGCCTGAGGG + Intergenic
1061111744 9:128577217-128577239 GCTCTGCTTCGGAAGCACGAGGG + Exonic
1061632997 9:131885340-131885362 GCTGAGCATCAGAAGCCCCCGGG + Intronic
1061897715 9:133657097-133657119 GCTGAGACACGGACGCCTGAGGG - Exonic
1062236071 9:135508382-135508404 GCTGATCCCAGGAAGCCTGAGGG + Intergenic
1190927428 X:54922051-54922073 GCTGGGCCTTGGAAACCAGATGG + Intronic
1193974478 X:88100276-88100298 GCACAGCCTCGGAAGTCCTAAGG + Intergenic
1200215746 X:154367568-154367590 GGAGAGACTCGGAGGCCCGATGG - Intronic