ID: 905044465

View in Genome Browser
Species Human (GRCh38)
Location 1:34985098-34985120
Sequence GAAGCCCGAAGGCGGCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905044459_905044465 -2 Left 905044459 1:34985077-34985099 CCCAGCTCCAGCTGAGCCTCGGA 0: 1
1: 0
2: 0
3: 24
4: 189
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044457_905044465 -1 Left 905044457 1:34985076-34985098 CCCCAGCTCCAGCTGAGCCTCGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044455_905044465 11 Left 905044455 1:34985064-34985086 CCAGGCGCTTTCCCCCAGCTCCA 0: 1
1: 0
2: 2
3: 18
4: 271
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044461_905044465 -9 Left 905044461 1:34985084-34985106 CCAGCTGAGCCTCGGAAGCCCGA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044456_905044465 0 Left 905044456 1:34985075-34985097 CCCCCAGCTCCAGCTGAGCCTCG 0: 1
1: 0
2: 9
3: 49
4: 423
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044460_905044465 -3 Left 905044460 1:34985078-34985100 CCAGCTCCAGCTGAGCCTCGGAA 0: 1
1: 0
2: 0
3: 16
4: 202
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044454_905044465 24 Left 905044454 1:34985051-34985073 CCTCAGTCGAAAGCCAGGCGCTT 0: 1
1: 0
2: 0
3: 2
4: 57
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145
905044452_905044465 30 Left 905044452 1:34985045-34985067 CCTGCGCCTCAGTCGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG 0: 1
1: 0
2: 2
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905044465 Original CRISPR GAAGCCCGAAGGCGGCCTGC CGG Intronic
903652591 1:24930625-24930647 GAAGCCCGGCCGCGGCCAGCGGG - Intronic
903939815 1:26921905-26921927 GCAGCACGAGGGCGGCGTGCAGG + Exonic
905044465 1:34985098-34985120 GAAGCCCGAAGGCGGCCTGCCGG + Intronic
916629867 1:166600802-166600824 GAAGCCAGAATGGGGCCTGGGGG + Intergenic
916749926 1:167714468-167714490 TAAGCCGGAAGGCGGCTTCCGGG + Intergenic
916752463 1:167735670-167735692 CAAGTCCAAAGGCGGTCTGCTGG + Intronic
918282943 1:183023488-183023510 GAAGCGCGGAGGCGGCGCGCGGG + Exonic
920337005 1:205251555-205251577 GATGCCCAAAGGAGGCCTCCTGG - Intronic
921203127 1:212825656-212825678 AAAGCCCAAAGGCAGTCTGCTGG - Intergenic
922462559 1:225824553-225824575 GAGGCCTGATGGCAGCCTGCTGG - Intronic
923000844 1:230005203-230005225 GAGGGCAGAAGGAGGCCTGCAGG - Intergenic
924357848 1:243202305-243202327 GAAGCCGGAAGGCGGGGTGAGGG + Intronic
1063473377 10:6307108-6307130 GGAGCCTGGAGGCCGCCTGCTGG - Intergenic
1063586467 10:7357451-7357473 GAAGTCCGAAGGCTGCCTGCTGG - Intronic
1064446214 10:15396090-15396112 GAAGTCCAAAGGCTGTCTGCTGG + Intergenic
1072252947 10:93595974-93595996 GAAGCCACAGGGCTGCCTGCTGG + Intronic
1072825406 10:98601098-98601120 CAAGCCTGAAGGCAGTCTGCTGG + Intronic
1074422786 10:113324100-113324122 CAAGTCCAAAGGCAGCCTGCTGG + Intergenic
1074772602 10:116743123-116743145 GAGTCCCGCAGGCGGCCTGGAGG - Intergenic
1074815766 10:117139971-117139993 GAAGCCTGATGTCGGCCTGCAGG - Intergenic
1075729498 10:124627806-124627828 GAAGCCCTAGGGAGGCCGGCTGG - Intronic
1077337617 11:2012472-2012494 GAAGCCCGGAGCCGGCCGCCGGG + Intergenic
1077635506 11:3839210-3839232 GAAGCCGGAAGACAGCCTGAAGG - Intronic
1084572216 11:69966548-69966570 GAAGCCCGAGGCCGGCATGTGGG + Intergenic
1087989497 11:104730638-104730660 GAAGCACAAAGGAGGCCTGTGGG + Intergenic
1202820601 11_KI270721v1_random:67654-67676 GAAGCCCGGAGCCGGCCGCCGGG + Intergenic
1096234618 12:49917755-49917777 GGAGCTCCAAGGCTGCCTGCAGG - Intergenic
1104057623 12:125242700-125242722 GAAGGACAAAGGAGGCCTGCAGG - Intronic
1104180326 12:126373478-126373500 GAAGCCAGAAGGGGGCTTCCAGG + Intergenic
1105022969 12:132829249-132829271 GAAGCGCGAAGGGCGCCGGCCGG - Intronic
1106772678 13:32977122-32977144 AAAGTCCAAAGGCAGCCTGCTGG - Intergenic
1107707426 13:43121784-43121806 GAAGTCGGAAGGCTGTCTGCTGG - Intergenic
1107996478 13:45865826-45865848 CAAGTCCGAAGGCTGTCTGCAGG + Intergenic
1120435239 14:84473489-84473511 GAAGTCTGAAGGCAGTCTGCTGG + Intergenic
1121889420 14:97574932-97574954 GAAGCCAGAAGGCTGGCTGAGGG + Intergenic
1127259830 15:57319661-57319683 GAAGCCAGGAGGCGGCGGGCGGG + Intergenic
1128871845 15:71165112-71165134 GAAGGCCGAAGGAGGCCTCTTGG + Intronic
1129236041 15:74224274-74224296 GGAGCCAGCAGGCTGCCTGCAGG - Intergenic
1130070640 15:80644205-80644227 GGAACCCGGAGGCTGCCTGCCGG - Intergenic
1131025224 15:89135884-89135906 GAAGGCCGAAGGAGGCCTCTTGG + Intronic
1132116370 15:99138991-99139013 GAAGCCGGAAGCAGGGCTGCAGG + Intronic
1132656487 16:1043811-1043833 GTAGCCCGAAGCCGGCCGGCAGG + Intergenic
1132688332 16:1171468-1171490 GGAGCCCGGAGGAGGCCCGCGGG + Intronic
1132746622 16:1438892-1438914 GAAGCTGGAGGGCAGCCTGCGGG - Exonic
1137295659 16:47090649-47090671 AAAGCCTGCAGGGGGCCTGCAGG + Intronic
1137580415 16:49630473-49630495 GAAGCCCATGGGAGGCCTGCTGG + Intronic
1140210538 16:72966459-72966481 GAAGCCCGAAGTTGGCATGGTGG + Intronic
1142574113 17:894912-894934 GAATCATGAAGGCGGCCAGCGGG - Intronic
1142982427 17:3679875-3679897 GAAGCAGGGTGGCGGCCTGCAGG - Intronic
1144477743 17:15603266-15603288 GAAGCCCAAAGGCCATCTGCTGG - Intronic
1145059656 17:19724658-19724680 GAAGCCCGAGCCCGGGCTGCAGG + Intergenic
1148188966 17:45665646-45665668 GAAGCCCGGAGACAGCCAGCAGG + Intergenic
1152687360 17:81701162-81701184 GAAGCCTGAGGGTGCCCTGCGGG - Intronic
1152815306 17:82404322-82404344 GGAGGCAGAAGGGGGCCTGCAGG + Intronic
1153434294 18:5052509-5052531 GAAGCCTGAAGGCCGTGTGCAGG - Intergenic
1154218908 18:12434935-12434957 GCTGCCCGAAGGCGGCCCGAGGG + Intergenic
1157720675 18:49921609-49921631 GAAGCCCGAGGGCAGGCTGAGGG + Intronic
1158883450 18:61803513-61803535 TGAGCCCGAAGGCAGCCTGTTGG - Intergenic
1160594113 18:79962502-79962524 GAAGCCAGAAGCCGCCCGGCAGG + Intergenic
1161015339 19:1980314-1980336 GAAGCCAGAACGCAGACTGCAGG + Exonic
1161029416 19:2050900-2050922 GAGGCCCGAGGGCGGGCGGCCGG + Exonic
1161594603 19:5144657-5144679 GAAGCCCCAAAGCTGGCTGCGGG - Intronic
1161607582 19:5223244-5223266 GACCCCCGAGGGCAGCCTGCTGG - Exonic
1162786206 19:13036560-13036582 GATCCCCGGAGGCGACCTGCAGG + Intronic
1165743756 19:38218439-38218461 GAATCCCCAGAGCGGCCTGCAGG - Intronic
1167649995 19:50723914-50723936 GAAGCCCTAGGACTGCCTGCTGG + Exonic
926278702 2:11426350-11426372 GAAGCAGGAAGACAGCCTGCTGG + Intergenic
926751685 2:16203252-16203274 CAAGTCTGAAGGCTGCCTGCTGG - Intergenic
927516527 2:23674921-23674943 GAAGCCTGAAGGTGGGCTGGGGG - Intronic
927846393 2:26474518-26474540 GCAGCTCGAAGGCCGCCAGCAGG + Exonic
928404030 2:31000605-31000627 GAAGTCCTAAGGTGGTCTGCTGG + Intronic
929437744 2:41940995-41941017 GAGGCCGGAAGGAGGCCTCCGGG + Intronic
933666724 2:84970875-84970897 GGCGCCCGATCGCGGCCTGCTGG + Intergenic
937869410 2:126776829-126776851 TAAGCCCGAAGGTGCCCGGCTGG - Intergenic
939184123 2:138840629-138840651 GAAATCCAAAGGCAGCCTGCTGG + Intergenic
940322234 2:152389733-152389755 GCAGCACGAGGGCGGCGTGCAGG + Intronic
941808602 2:169734107-169734129 GCAGCCCGAGGCCGGCCTGCTGG + Intronic
946140835 2:217689309-217689331 GAAGTCTGAAGGCAGGCTGCTGG - Intronic
947446206 2:230164517-230164539 GGAGGCTGAAGGGGGCCTGCTGG + Intergenic
947454810 2:230244477-230244499 GGAGACCCAAGGAGGCCTGCAGG + Intronic
947800319 2:232925536-232925558 GAAGTCCGAAGCCGGCTGGCAGG - Intronic
948426035 2:237887051-237887073 GAGCCCCGAAGGCGGCCTCCTGG + Intronic
948619470 2:239225446-239225468 GAAGGCAGAAGTCGGTCTGCGGG + Intronic
1171393708 20:24817539-24817561 GAACCCCACAGGCGCCCTGCTGG + Intergenic
1171977909 20:31607018-31607040 GGAGCCCCAGGGCTGCCTGCTGG - Intergenic
1172879222 20:38187734-38187756 CAAGTCTGAAGGCCGCCTGCTGG - Intergenic
1175233156 20:57488722-57488744 GAAGGCCGAAGGAGGCCTCTTGG + Intergenic
1177120608 21:17132872-17132894 GAGGCCCCAAGGCCACCTGCTGG + Intergenic
1179149313 21:38796445-38796467 GAGGGCCAAAGGCAGCCTGCTGG + Intergenic
1179383720 21:40922677-40922699 GGAGCCCAAAGGCGGTCTGCAGG - Intergenic
1179882536 21:44299664-44299686 GAGGCCTGAAGGCGCCCTGAGGG + Intergenic
1179916057 21:44479007-44479029 CAAGCCCAAAGGCAGGCTGCAGG + Intergenic
1185119705 22:48958688-48958710 GAAGCCTGAAGAAAGCCTGCAGG - Intergenic
957469562 3:80640688-80640710 GAAGTCTGAAGGCAGTCTGCTGG + Intergenic
959165581 3:102773697-102773719 GAAGTCCAAAGGCAGTCTGCTGG - Intergenic
961551832 3:127673846-127673868 GCAGCCCAAAGGAGGCCTCCAGG - Intronic
961862093 3:129925353-129925375 GAAGTCTGAAGGCCACCTGCTGG - Intergenic
965367931 3:167821901-167821923 GCAACCCAAAGGCAGCCTGCTGG + Intronic
968645313 4:1737735-1737757 CAAGCCCCAGAGCGGCCTGCAGG - Intronic
968905760 4:3449866-3449888 GAAGACCAACGACGGCCTGCGGG - Intergenic
969533598 4:7742285-7742307 GACGCTTGCAGGCGGCCTGCTGG - Exonic
969637285 4:8376718-8376740 GAAGCCCCAAGGCCCCATGCTGG - Intronic
970244696 4:14048034-14048056 GAAGTCTGAAGGCTGTCTGCTGG - Intergenic
971870866 4:32236883-32236905 GAAGTCTGAAGGCAGCCTACTGG - Intergenic
973257231 4:48125841-48125863 TGAGCCCAAAGGCGGTCTGCTGG + Intronic
974022042 4:56700349-56700371 GAAGTCTGAAGGCAGGCTGCTGG - Intergenic
979681594 4:123466243-123466265 GAAGCCTGAGGACAGCCTGCTGG + Intergenic
981231956 4:142367071-142367093 GAAGCCAGAAGTAGGGCTGCAGG + Intronic
982214210 4:153066261-153066283 GGAGTCCAAAGGCAGCCTGCTGG - Intergenic
983453276 4:167932493-167932515 GAAGCCCGGAGGAGGCTTCCAGG - Intergenic
984811276 4:183798017-183798039 GAAGCCCGAGGGCGGCCGCAGGG - Intergenic
989205408 5:38804756-38804778 GAGGTCCAAAGGCGGTCTGCAGG + Intergenic
996048697 5:118907778-118907800 GAAGTCCAAAGGCAGTCTGCTGG + Intronic
998963207 5:147509863-147509885 CAAGCACGAAAGCGGCCCGCGGG + Exonic
1000887880 5:166768179-166768201 GAAGCCAGGAGGTGGACTGCTGG - Intergenic
1002000657 5:176194791-176194813 GAAGCACGCAGGCGGCATGTAGG + Intergenic
1002253682 5:177944190-177944212 GAAGCACGCAGGCGGCATGTAGG - Intergenic
1007609276 6:43138868-43138890 GAAGCCCCAAGACAGCCAGCTGG + Exonic
1008179323 6:48308718-48308740 GAAGCCCAAAGGTAGTCTGCTGG - Intergenic
1012562222 6:100597159-100597181 AGAGCCAGAAGGCGGCCTGGGGG - Intronic
1017002662 6:150006594-150006616 GAAGGCAGAAGGAGGCCAGCAGG + Intergenic
1018209913 6:161470776-161470798 TGAGCCCGAAGGCTGCCTGAAGG + Intronic
1020005648 7:4782662-4782684 GAGGCCTGGAGGTGGCCTGCAGG - Intronic
1024042176 7:45564284-45564306 GAACCCCAAAAGCGGCCAGCAGG + Intergenic
1025149900 7:56539803-56539825 TAAGCCCGAAGGGGGTCTGTGGG + Intergenic
1026421611 7:70242956-70242978 GAAGGCAGTAGGCGGCCTACGGG - Intronic
1026858429 7:73769767-73769789 GCAGCCCGAAGGCGGCCAGCAGG + Exonic
1029460419 7:100691126-100691148 GGAGCCCCATGGTGGCCTGCAGG - Intergenic
1032875981 7:136038659-136038681 TAAGCCTGAAGGCAGTCTGCTGG + Intergenic
1035283843 7:157794005-157794027 GAGGCCCGAAGGTGGCCTGGAGG - Intronic
1035288174 7:157819443-157819465 GAAGCGCGAGGGCGCCCTGCAGG + Intronic
1035398612 7:158550866-158550888 GAAGCGCGACGGCCGCCTGATGG - Intronic
1035412045 7:158652292-158652314 GCAGCCGGAAGAAGGCCTGCGGG - Exonic
1036153508 8:6320518-6320540 GAAGTCCGAAGGCAGACTGCTGG + Intergenic
1037708897 8:21339666-21339688 GAAGTCCGAAGGCAGCGTACTGG - Intergenic
1037832139 8:22196066-22196088 AAAGCCAGAATGCGGCCTACGGG - Intronic
1039557780 8:38489043-38489065 GAAGCCCAAGGGCGGCCATCTGG + Intergenic
1040285674 8:46099302-46099324 GAAGCCCCAAGGCACCCTCCGGG + Intergenic
1041107388 8:54456723-54456745 CAAGTCTGAAGGCGGACTGCTGG + Intergenic
1045189872 8:99871919-99871941 GAACCCAGCAGGCGGCCAGCAGG + Intronic
1045300771 8:100908316-100908338 GAAGGCTGAAAGGGGCCTGCAGG - Intergenic
1047219982 8:122911326-122911348 GAAGACAGGAGGCTGCCTGCTGG - Intronic
1047535754 8:125718346-125718368 GAAGTCTGAAGGCAGCCTGAAGG + Intergenic
1049504448 8:142988272-142988294 GAAGCAAGAATGCCGCCTGCTGG - Intergenic
1049937375 9:512369-512391 GAAGACTGAAGGAGGTCTGCTGG + Intronic
1060554236 9:124500167-124500189 GGAGGCCGAAGGCCGCCGGCTGG + Exonic
1062444536 9:136588099-136588121 GGACCCCCAAGGCTGCCTGCGGG + Intergenic
1187768090 X:22665229-22665251 CAAGCCAGAAGGCGGACAGCAGG - Intergenic
1188859547 X:35240937-35240959 GAAGTCTGAAGGCAGTCTGCTGG + Intergenic
1189877608 X:45453069-45453091 TAAGCCCAAAGGCAGCCTGTGGG + Intergenic
1190157134 X:48003530-48003552 GAAGCCGGAAAGAGGCCTTCGGG + Exonic
1192306289 X:69963488-69963510 GAATCCCCAAGGTTGCCTGCTGG + Intronic
1193085960 X:77448027-77448049 CAAGCCCGGGGGCGGTCTGCGGG - Intronic
1197357699 X:125456880-125456902 GAATTCTGAAGGCAGCCTGCTGG + Intergenic
1197709376 X:129654789-129654811 GAAGAGCGGAGGCGGCCAGCGGG - Exonic
1200083781 X:153592845-153592867 GAAGCCCCAAGGCCTTCTGCTGG + Intronic