ID: 905044648

View in Genome Browser
Species Human (GRCh38)
Location 1:34986027-34986049
Sequence ATCAGACATCTGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905044648 Original CRISPR ATCAGACATCTGGCCAAATT TGG (reversed) Intronic
900739841 1:4324058-4324080 ATTTGAAATCAGGCCAAATTAGG - Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905652160 1:39663735-39663757 AGCAGACATCTGGCCCAAGCTGG + Intronic
906572922 1:46860050-46860072 ATCACACATCTGTGAAAATTTGG + Intergenic
906598842 1:47105840-47105862 ATCACACATCTGTGAAAATTTGG - Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
912572705 1:110636174-110636196 ATCAGTCATCAGCACAAATTGGG + Intergenic
914674194 1:149895797-149895819 CTCAGATATTTGGCCAAATATGG - Intronic
915011300 1:152688610-152688632 ATCACACATCGGGGCATATTGGG - Intergenic
915969513 1:160343735-160343757 ACGAGACATCTGGACAAAGTGGG - Intronic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
918798812 1:188943741-188943763 ACCAGTCATCTGGTTAAATTAGG + Intergenic
921224747 1:213007138-213007160 AGCAGAGATCAGGCCAAGTTTGG - Exonic
921485198 1:215707081-215707103 ATTAGACATTTGGACAAAATGGG + Intronic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
921991124 1:221369023-221369045 ATCTGAAAACTTGCCAAATTTGG - Intergenic
924024512 1:239818326-239818348 ATCCCTCATGTGGCCAAATTTGG - Intronic
924363048 1:243261092-243261114 ATGAGGCTTATGGCCAAATTGGG + Intronic
1067698413 10:48551866-48551888 CACAGACATCTGGCCATATGGGG - Intronic
1068053920 10:51986478-51986500 CTCAGAGATCTGGGCAAAGTAGG + Intronic
1070078595 10:73163174-73163196 ATCTGACCTCTGGCAAAATATGG - Intronic
1071067607 10:81655271-81655293 ATCAGAAAAGTTGCCAAATTTGG - Intergenic
1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG + Intergenic
1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG + Intergenic
1074538456 10:114345607-114345629 ATCAGGGATGTGGCCAAATTGGG - Intronic
1078672732 11:13379239-13379261 ATCATAAGTCTGTCCAAATTTGG + Intronic
1079449660 11:20588956-20588978 GGCAGACATGTGGCCAACTTTGG + Intergenic
1080653076 11:34237971-34237993 ATCACACATCAGGGCAAATGGGG - Intronic
1086384302 11:86291340-86291362 AACAGACAGCTGGCCAGGTTCGG - Intergenic
1087973716 11:104517752-104517774 ATCCAACATCTGGCCATAGTCGG + Intergenic
1089169836 11:116504338-116504360 ACCTGACATCTGGCCACTTTGGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1095454543 12:42369010-42369032 AACAGACAGCTGACCAGATTTGG - Intronic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1096938104 12:55306640-55306662 TTCATACCTCTGGCAAAATTCGG - Intergenic
1097309479 12:58102649-58102671 ATTGGACTTCTGGCCAAACTTGG + Intergenic
1097539286 12:60916601-60916623 AACAAAAATCTGGACAAATTAGG - Intergenic
1098177681 12:67809892-67809914 AACAGACAACTGACCAAAATGGG - Intergenic
1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG + Intronic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1105678396 13:22700864-22700886 AACACACATCTGGCTTAATTAGG + Intergenic
1109089034 13:58015759-58015781 TTCAGAAGTCTGGCTAAATTTGG - Intergenic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1113041717 13:106110498-106110520 GTCCGACATCTGGCCACACTAGG + Intergenic
1113417587 13:110140477-110140499 CTCAGAGATCTGCACAAATTAGG - Intergenic
1114827060 14:26093875-26093897 ATCACACATGTGGCCATATGAGG + Intergenic
1116391553 14:44397302-44397324 ATCAGACATTTGGCCAGGTGTGG - Intergenic
1117997802 14:61494275-61494297 ATTAGAAATCTGCCTAAATTTGG + Intronic
1119574543 14:75707111-75707133 AGCAAAAATCTGGCCCAATTTGG - Intronic
1120363592 14:83537813-83537835 TTAAGACATATGGCCAAATTGGG + Intergenic
1121745375 14:96285793-96285815 GCCGGACATCTGGCCTAATTTGG + Exonic
1122063155 14:99150441-99150463 CTGACACATCTGGACAAATTGGG - Intergenic
1122065088 14:99167433-99167455 TTCATACTTCTGGCCAAACTTGG - Intergenic
1124922660 15:34041388-34041410 ACCAGACATTTGCCCAAATCAGG - Intronic
1126651926 15:50931807-50931829 ACCAGGCATTTGGCCAGATTAGG + Intronic
1130094276 15:80844440-80844462 AGCAGTCACCTGGCTAAATTTGG - Intronic
1130850046 15:87783993-87784015 ATTTGACATGTGTCCAAATTTGG + Intergenic
1131334309 15:91532930-91532952 ATCAGACATCAGGCAGAATAGGG - Intergenic
1132422126 15:101679177-101679199 AGCTGACAACTTGCCAAATTTGG - Intronic
1134518524 16:14906340-14906362 AACAGACAGCTGGCCAGAGTTGG - Intronic
1134706195 16:16304993-16305015 AACAGACAGCTGGCCAGAGTTGG - Intergenic
1134961345 16:18407117-18407139 AACAGACAGCTGGCCAGAGTTGG + Intergenic
1134965645 16:18489720-18489742 AACAGACAGCTGGCCAGAGTTGG + Intronic
1135845544 16:25915105-25915127 AGCAGACATGTGGCCACATCTGG - Intronic
1136076564 16:27821227-27821249 AGCAGAGATCTGGCCACACTGGG - Intronic
1137873480 16:51972816-51972838 ATCAGACCTCTGGCCACTTGAGG - Intergenic
1138024206 16:53510189-53510211 ATCCGACCTCTGGCCAAGTCAGG + Intergenic
1138162344 16:54766071-54766093 TTCAGACATCTGTCCATATGTGG - Intergenic
1139147530 16:64342000-64342022 ATGAGAAATCTGGCCAAGTAGGG - Intergenic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1143203704 17:5129266-5129288 ATCGGAAATCTGGGCAGATTTGG - Intronic
1144874885 17:18392377-18392399 ATCGGAAATCTGGGCAGATTTGG - Intergenic
1145157340 17:20552044-20552066 ATCGGAAATCTGGGCAGATTTGG + Intergenic
1146113531 17:30113389-30113411 ACCAGGCAGCTGGCCAGATTTGG - Intergenic
1146631160 17:34470435-34470457 AGCAGGCATCTGGTCAGATTTGG + Intergenic
1149988762 17:61368506-61368528 ATCAGACTTCTAGCCTGATTTGG + Intronic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1156725541 18:40121865-40121887 ATCTGTCATCAGGGCAAATTGGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1164304403 19:23991861-23991883 ATCAGACAACTAGTTAAATTAGG - Intergenic
1164562999 19:29307028-29307050 ATCAGATATCAAGCCATATTAGG - Intergenic
1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG + Intergenic
1165659754 19:37566935-37566957 ATCAGAAAAGTGGCCAAAGTGGG - Intronic
925404771 2:3598901-3598923 ATCAGATATGTGTCCACATTTGG + Intronic
927997484 2:27496107-27496129 ATCACACAGCTGGACAAATTGGG - Intergenic
928849300 2:35723856-35723878 ATAAGAAATCTGGCCAGATGAGG - Intergenic
929821640 2:45278759-45278781 ATCAGAGATCTCCCCAGATTAGG + Intergenic
932924714 2:75959642-75959664 ATCCCACAGCTGGCCAGATTTGG + Intergenic
933400181 2:81786276-81786298 CTCAGAAAGTTGGCCAAATTAGG + Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
940635310 2:156292201-156292223 CTCAGACATGTGGCAAAGTTTGG + Intergenic
944390915 2:199218553-199218575 TTAAGACATCAGGCCAAATCTGG + Intergenic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170454467 20:16519414-16519436 ATCAAACATCTGGGAAAAATAGG - Intronic
1170922879 20:20695834-20695856 ATCAGATATCCACCCAAATTAGG - Intronic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175451002 20:59068019-59068041 AACAGAGAGCTGGCCAGATTTGG - Intergenic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1182652020 22:31859728-31859750 ATCAGAGGGCTGGCCAGATTTGG + Intronic
1184988192 22:48150098-48150120 ATCAGACATCATTCCAAAGTGGG - Intergenic
1185417261 22:50717051-50717073 ATCACACAGCTGCCCAAACTCGG + Intergenic
951824172 3:26848760-26848782 TTCTGACATCTGGCCAATTACGG - Intergenic
955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG + Intergenic
955776285 3:62437261-62437283 ATGAAATATCTGGCTAAATTAGG + Intronic
956696612 3:71923963-71923985 ATCAGACATCTGGATCAATTAGG - Intergenic
957023472 3:75151596-75151618 CTCAGGCATCTAGCCAAATTTGG + Intergenic
959587346 3:108037267-108037289 ACCACACCTCTGGCCAAGTTGGG + Intergenic
960029612 3:113044168-113044190 CTCAGTCATTTGGCCAAATGTGG - Intergenic
961958991 3:130834236-130834258 AACAGACATTTGAACAAATTTGG - Intergenic
964517562 3:157529315-157529337 ATCAGGCAACTGGCTGAATTTGG + Intronic
964587486 3:158322975-158322997 AACAGACATCTGGGTTAATTTGG + Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966954234 3:184857261-184857283 AACAGACGGCTGGCCAGATTTGG - Intronic
970074072 4:12197352-12197374 AGCAAACCTCTGGCCAAATTAGG + Intergenic
970291849 4:14581647-14581669 AACAGCCATTTGGACAAATTTGG - Intergenic
973208558 4:47588406-47588428 ATCAGACAGTAGGCCAAATTTGG - Intronic
973751828 4:54028176-54028198 ATCAATCAACTGGACAAATTAGG + Intronic
974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG + Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
978071556 4:104478492-104478514 ATTAGACCTATGGCCAAAATGGG - Intronic
978387814 4:108193187-108193209 AACAGCAATCTGACCAAATTTGG - Intergenic
978600016 4:110417947-110417969 ATTAGACACCTTGCCACATTCGG - Intronic
980212790 4:129811479-129811501 AACTAACATCTGGCAAAATTTGG - Intergenic
983217657 4:165017073-165017095 ATCAGTCATGTGGCACAATTGGG - Intergenic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
986499810 5:8387039-8387061 ATGACACACCTGGCCAAGTTTGG + Intergenic
986888741 5:12273897-12273919 AACTGACATTTGGCCATATTGGG + Intergenic
987669246 5:20985994-20986016 AACAGACAAAAGGCCAAATTTGG - Intergenic
988968166 5:36440568-36440590 CTCAGACATCTGGGCATATGGGG + Intergenic
989106608 5:37868871-37868893 AGGAGACATCTGGCAAAATCTGG - Intergenic
989730199 5:44639877-44639899 ATCACACATCTGGCAAAAGCAGG + Intergenic
990428091 5:55708878-55708900 ATCTGTCAGCAGGCCAAATTTGG + Intronic
991654061 5:68885373-68885395 ATCAGAAAAATGGCCAATTTGGG + Intergenic
992680270 5:79145863-79145885 ATCAGAAATTGGGACAAATTGGG + Intronic
995373733 5:111450495-111450517 AACAGACATGTGGCCAGATGCGG + Intronic
995606983 5:113867456-113867478 AACAGACATCTGGAGAAACTGGG - Intergenic
999464950 5:151794043-151794065 ATGAGACATCTGGCAATATCTGG - Intronic
999617269 5:153437561-153437583 ATCAGACATCTGGGAGAAGTGGG - Intergenic
1000718269 5:164674522-164674544 AACAGACCTCTGGGCAGATTAGG - Intergenic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1003059526 6:2851930-2851952 ATCAGCCAACTGGGCAAATGTGG - Intergenic
1008204414 6:48636669-48636691 ATTAAACATATGGCCAAATGTGG + Intergenic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1010050599 6:71499423-71499445 ATAAGTCATCTGGCCTTATTTGG + Intergenic
1010082550 6:71881202-71881224 AACAGTCATTTGGCTAAATTTGG + Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1010816750 6:80366872-80366894 AACAGACATCTGGCAGAATTAGG + Intergenic
1016411984 6:143792991-143793013 ATCACAATTGTGGCCAAATTTGG + Intronic
1016647574 6:146427504-146427526 AGCAGACATTTGAACAAATTGGG - Intronic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1018187631 6:161280764-161280786 CTCAGAGAACTGGCCAAGTTGGG - Intergenic
1021206305 7:17785507-17785529 ATCCAACATCTGGGCAAACTAGG + Intergenic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG + Intergenic
1024331124 7:48156338-48156360 ATCAGACCTGTGTACAAATTTGG + Intergenic
1024562313 7:50654923-50654945 GTCAGACACTTGGCTAAATTTGG - Intronic
1029309946 7:99653761-99653783 TTCAGACTTCTGCCCAAACTGGG - Intronic
1029321304 7:99762941-99762963 TTCAGACCTCTGCCAAAATTGGG - Intronic
1041419880 8:57654719-57654741 ATCAGAAATTTGGAAAAATTGGG + Intergenic
1042080880 8:65049543-65049565 ATCAGACATTTGGCAAACATTGG - Intergenic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045185576 8:99834180-99834202 ATCAGACAATTTGCCAAATGTGG - Intronic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1050192702 9:3045004-3045026 ATCTGACATATGACCAAATCAGG + Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1052912141 9:33892759-33892781 TTCTGATATATGGCCAAATTTGG - Intronic
1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG + Intergenic
1056575657 9:87854356-87854378 ATCAGACTTCAGGCCAAAGCTGG - Intergenic
1060374116 9:123103264-123103286 ATCACACATCTGGCCAAAGAAGG - Exonic
1060803492 9:126559495-126559517 AACAGACACCTGACCAAATAAGG + Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192553003 X:72068958-72068980 AACAGAAATCTGGGAAAATTTGG - Intergenic
1194699543 X:97096751-97096773 CTCAGACATCTGACCACGTTGGG + Intronic
1194736449 X:97517814-97517836 ATCAGCCATATGTCCAACTTTGG - Intronic
1194838356 X:98709783-98709805 ATTATACATCTGGCAGAATTTGG + Intergenic
1196235068 X:113270056-113270078 ATCAGACCTCTCCCCAAACTAGG - Intergenic
1198687640 X:139244520-139244542 ATCACACATCTTGCCATATAAGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200954765 Y:8931767-8931789 ATCACACATCCGGCCCAGTTTGG + Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic
1202193278 Y:22267424-22267446 ATCATACATTTGGTAAAATTAGG - Intergenic