ID: 905052352

View in Genome Browser
Species Human (GRCh38)
Location 1:35062564-35062586
Sequence TAGGATTACAAACCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905052352_905052355 7 Left 905052352 1:35062564-35062586 CCAGGCACAGGTTTGTAATCCTA 0: 1
1: 0
2: 1
3: 22
4: 260
Right 905052355 1:35062594-35062616 CACTTAACCAGTTGTGCCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 93
905052352_905052356 8 Left 905052352 1:35062564-35062586 CCAGGCACAGGTTTGTAATCCTA 0: 1
1: 0
2: 1
3: 22
4: 260
Right 905052356 1:35062595-35062617 ACTTAACCAGTTGTGCCCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905052352 Original CRISPR TAGGATTACAAACCTGTGCC TGG (reversed) Intronic
900669979 1:3845942-3845964 TGGGATTACAGGCATGTGCCTGG - Intronic
901566520 1:10120565-10120587 TAGGATTACAGGCATGAGCCTGG - Intronic
902040759 1:13490649-13490671 TAGGGATACTAACCTGTGTCTGG + Intronic
905052352 1:35062564-35062586 TAGGATTACAAACCTGTGCCTGG - Intronic
909979130 1:82077545-82077567 CAGGATTTCAAATCTCTGCCAGG + Intergenic
910589201 1:88911281-88911303 TAGGATGACAGACATGAGCCAGG + Intergenic
911891147 1:103373507-103373529 TGGGATTACAGACGTGAGCCTGG + Intergenic
912014549 1:105016787-105016809 TAGGTTTAAAAAACTGTGCAGGG + Intergenic
912601497 1:110939107-110939129 TAGGATTACAGGCGTGAGCCAGG - Intergenic
913176788 1:116280399-116280421 TAGGGTTCTAAAACTGTGCCTGG + Intergenic
915341779 1:155180432-155180454 TAGGAATACAAAACTTAGCCAGG + Intronic
915759648 1:158297663-158297685 TAGGATTACAGGCATGAGCCAGG - Intergenic
916094844 1:161339973-161339995 TAAAAATACAAACCTGGGCCAGG - Intronic
918273816 1:182930993-182931015 TAGGATTACAGGCATGAGCCTGG + Intronic
920133913 1:203754310-203754332 TGGGATTACAGGCATGTGCCAGG - Intergenic
920143358 1:203837025-203837047 TAGGATTACAGCACTATGCCAGG - Intronic
920343815 1:205292978-205293000 TGGGATTACAGGCATGTGCCTGG + Intergenic
920676397 1:208041319-208041341 GAGGACTCCAAAGCTGTGCCCGG + Intronic
920933020 1:210406658-210406680 TAGGATTACAGGCTTGAGCCTGG + Intronic
921171238 1:212551692-212551714 TAGGATACCACACCTGTCCCTGG - Intergenic
921198979 1:212786536-212786558 TGGGATTACAGGCCTGTGCCTGG - Intronic
922166722 1:223121787-223121809 TGGGATTACAGGCATGTGCCTGG + Intronic
922320902 1:224485733-224485755 TAGGATTACTAGCATGAGCCAGG + Intronic
922524971 1:226294435-226294457 TGGGATTACAGGCATGTGCCTGG - Intronic
923488987 1:234466349-234466371 TAAAATTACAAAACTGAGCCAGG + Intronic
923624658 1:235604194-235604216 GAGGAACACAAACCTGTGTCTGG + Intronic
923717184 1:236434869-236434891 CAGGCTTAAAAGCCTGTGCCTGG + Intronic
923725495 1:236502035-236502057 TGGGATTACAGGCATGTGCCAGG - Intergenic
924832972 1:247616658-247616680 TAGGATTACAAGCATGAGCCAGG + Intergenic
1065097638 10:22297410-22297432 TGGGATTACCCACCTGCGCCTGG - Intergenic
1066952228 10:42131336-42131358 TGGGATTACAGGCGTGTGCCTGG + Intergenic
1067276407 10:44838802-44838824 TGGGATTACAGCACTGTGCCCGG + Intergenic
1067360827 10:45576650-45576672 TAGGATTACAGGCTTGAGCCAGG - Intronic
1068937948 10:62654643-62654665 TGGGATTACAGGCATGTGCCCGG + Intronic
1069473556 10:68713887-68713909 TAGGATTACAGATGTGAGCCTGG - Intergenic
1069975891 10:72212711-72212733 TGGGATTACAGCCATGTGCCAGG - Intronic
1070993680 10:80755832-80755854 TGGGATTACAGGCATGTGCCCGG + Intergenic
1071266598 10:83970106-83970128 TAGGATTACAGGCATGAGCCAGG - Intergenic
1071356899 10:84806367-84806389 TAAGATTACAAACATGGGCTAGG - Intergenic
1072120764 10:92403765-92403787 TGGGATTACAAGCATGAGCCTGG - Intergenic
1074481486 10:113825541-113825563 TGGGATTACAGGCGTGTGCCCGG - Intergenic
1074873080 10:117592835-117592857 TGGGATTACAGACATGTCCCCGG + Intergenic
1075446005 10:122513524-122513546 TGGGATTACATGCATGTGCCAGG - Intronic
1075524751 10:123174465-123174487 AGGGATTAGAAGCCTGTGCCAGG + Intergenic
1076450819 10:130555920-130555942 CAGGATTCCAATCCTGTTCCTGG + Intergenic
1076455542 10:130591278-130591300 TAGAAAGACATACCTGTGCCTGG + Intergenic
1077986478 11:7356405-7356427 TAGCCTTAGCAACCTGTGCCTGG + Intronic
1078903960 11:15667113-15667135 TAGGATCAGAAATCTGTGCCTGG - Intergenic
1079124060 11:17706383-17706405 TGGGATTACAGGCGTGTGCCTGG - Intergenic
1079860776 11:25668772-25668794 TGGGATTACAGCACTGTGCCTGG - Intergenic
1080850779 11:36067803-36067825 TAGGACTACAGGCGTGTGCCTGG + Intronic
1081523173 11:43902729-43902751 TGGGATTACAGGCGTGTGCCAGG + Intronic
1081922919 11:46795688-46795710 AAGGAATTCAAACCTCTGCCTGG - Exonic
1082270648 11:50166486-50166508 TAGGCTTCCAAGCCTGTGACAGG - Intergenic
1083297094 11:61720669-61720691 CAGGATCACAAACCTGTCACAGG - Exonic
1083481275 11:62949202-62949224 TTGGATGACAAACCTGTGGATGG + Intronic
1083868090 11:65469332-65469354 TGGGACTACAGACATGTGCCAGG + Intergenic
1085369025 11:75980948-75980970 TGGGATTACAGACCTGGCCCTGG + Intronic
1088302341 11:108372805-108372827 TGGGATTACAGATGTGTGCCCGG - Intronic
1090370923 11:126251949-126251971 TGGGATTACAGGCATGTGCCTGG + Intronic
1094811847 12:34146344-34146366 TGGGATTACAAGCATGAGCCAGG - Intergenic
1095367696 12:41427818-41427840 TAGGATTACAGGTCTGCGCCAGG - Intronic
1095751719 12:45719906-45719928 TGGGATTACAAGCATGAGCCAGG - Intergenic
1096029204 12:48396917-48396939 TAGGAGTCTAGACCTGTGCCTGG - Intergenic
1096066167 12:48742547-48742569 TAGGATTACAGGCCCGTGCCCGG + Intergenic
1096395814 12:51265811-51265833 TGGGATTACAGGCCAGTGCCTGG - Intronic
1096423452 12:51480206-51480228 TGGGATTACAAGCATGAGCCTGG + Intronic
1098572272 12:72001558-72001580 TGGGATTACAGGCATGTGCCCGG + Intronic
1102567115 12:113803953-113803975 TTGGCTTACCAACCAGTGCCTGG + Intergenic
1102799004 12:115715246-115715268 TAGGATTACAGGCATGAGCCAGG + Intergenic
1103712538 12:122923556-122923578 TGGGATTACAGACATGAGCCAGG + Intronic
1104274598 12:127313868-127313890 TAGGATTACAGATGTGAGCCAGG - Intergenic
1104369256 12:128208528-128208550 TAACAATACACACCTGTGCCAGG - Intergenic
1104396930 12:128442058-128442080 TAAGATTGCAAAGCTGAGCCAGG - Intronic
1105504734 13:20999725-20999747 TAGGATTACAGACATGAGCTAGG + Intronic
1106378980 13:29217846-29217868 TAAGATTACAGACATGAGCCAGG - Intronic
1107152171 13:37124616-37124638 TGGGATTACAGGCCTGAGCCTGG - Intergenic
1108504560 13:51099793-51099815 TAAGATTATAAAGCTGGGCCAGG - Intergenic
1111307523 13:86434586-86434608 GAGGTTTAGAAACCTCTGCCTGG + Intergenic
1111587900 13:90306488-90306510 TGGGATTACAAGCATGAGCCTGG + Intergenic
1112200681 13:97271248-97271270 TGGGATTACAGGCGTGTGCCAGG + Intronic
1112529006 13:100182364-100182386 TAGGATTACAGCACTGTGCCTGG + Intronic
1114591964 14:23874120-23874142 TGGGATTACAGGCATGTGCCTGG + Intergenic
1114879619 14:26768374-26768396 TGGGATTACAGCCATGTGCCAGG - Intergenic
1116329640 14:43579037-43579059 TGGGATTACAAGCGTGAGCCAGG + Intergenic
1117154738 14:52927483-52927505 TGGGATTACAGACGTGAGCCTGG - Intronic
1118172211 14:63398521-63398543 TAGGATTACAGGCGTGAGCCAGG - Intronic
1119396301 14:74328726-74328748 TGGGATTACAAGCATGAGCCAGG - Intronic
1119621151 14:76132982-76133004 TATGCTTACAAACGTGTGCAGGG + Intergenic
1123394943 15:19923926-19923948 TGGGATTACAGGCGTGTGCCTGG - Intergenic
1125929599 15:43590882-43590904 TAGGATTAAAAACCTAGGGCTGG + Intergenic
1125942766 15:43690714-43690736 TAGGATTAAAAACCTAGGGCTGG + Intergenic
1128076137 15:64826858-64826880 TAGGATTACAGGCATGAGCCCGG + Intergenic
1129856369 15:78828145-78828167 TAGGATTACAGGCGTGAGCCCGG + Intronic
1131370951 15:91881369-91881391 CAGGAATACAGACCTGTGGCTGG - Intronic
1133790156 16:9003326-9003348 TAGGATTACAGGCGTGAGCCAGG + Intergenic
1133888964 16:9860311-9860333 TGGGATTACAGACCCATGCCTGG - Intronic
1135989999 16:27212597-27212619 TGGGATTACAGGCATGTGCCAGG - Intronic
1136469420 16:30469286-30469308 TGGGATTACAGCCCTGTGCCTGG - Intergenic
1137657291 16:50171129-50171151 TAGGATTACAGGCATGAGCCTGG - Intronic
1137980194 16:53062885-53062907 TGGGATTACAGGCATGTGCCTGG - Intronic
1138684204 16:58710499-58710521 TAGGATTACAGACATAAGCCTGG + Intronic
1138824564 16:60303607-60303629 TGGGATTACAGACGTGAGCCCGG + Intergenic
1140464126 16:75165654-75165676 TGGGATTACAGGCCTGAGCCTGG + Intronic
1140889924 16:79276335-79276357 TTGGATGACAAATCTGTGCTGGG - Intergenic
1142297033 16:89230978-89231000 CAGGATTTCAAACATGTGACAGG - Exonic
1142387933 16:89778491-89778513 TGGGATTACAAGCCTGTGCCTGG - Intronic
1142644971 17:1305713-1305735 TGGGATTACAGGCCTGAGCCAGG + Intergenic
1145890370 17:28410555-28410577 TGGGATTACAGGCATGTGCCGGG + Intergenic
1146938861 17:36829641-36829663 TGGGATTACAAGACTGTGGCAGG + Intergenic
1147357635 17:39910187-39910209 TGGGATTACAGATGTGTGCCTGG - Intronic
1147641935 17:42007978-42008000 TGGGATTACAGGCATGTGCCCGG + Intronic
1148684494 17:49493882-49493904 TGGGATTACAGGCATGTGCCTGG + Intergenic
1148969637 17:51468505-51468527 TGGGATTACAAGCGTGAGCCCGG + Intergenic
1149605185 17:57919447-57919469 TGGGATTACAGGCGTGTGCCCGG + Intronic
1149822428 17:59792712-59792734 TGGGATTACAGGCATGTGCCCGG - Intronic
1150106980 17:62469459-62469481 TGGGATTACAAGCATGCGCCAGG - Intronic
1150281237 17:63930756-63930778 GAGGATTTCAAGCCTGTGCAGGG - Intronic
1152243351 17:79171873-79171895 TAGAATTACCAACCTTTGGCTGG + Intronic
1152789599 17:82272057-82272079 TAAAATTACAAACTTGGGCCAGG + Intronic
1155593441 18:27454402-27454424 TAGGATTCCAACCCTCTGGCAGG - Intergenic
1156440378 18:37180776-37180798 TAAGATCACAAACCTCTGCTGGG + Intronic
1156669646 18:39452897-39452919 TGGGATTACAAATGTGAGCCTGG - Intergenic
1158999400 18:62957848-62957870 TGGGATTACAGGCATGTGCCTGG + Intronic
1161467315 19:4438466-4438488 TGGGATTACAGACCTGAGCCAGG + Intronic
1161558921 19:4959993-4960015 TGGGATTACAGGCATGTGCCTGG + Intronic
1161919190 19:7253505-7253527 TGGGATTACAGGCGTGTGCCTGG + Intronic
1162190934 19:8946241-8946263 TAGGAAGACAAACATGTCCCTGG - Exonic
1162347862 19:10131072-10131094 TGGGATTACAGGCGTGTGCCTGG - Intergenic
1162512931 19:11130731-11130753 TGGGATTACAACACTATGCCCGG + Intronic
1162819919 19:13216470-13216492 TGGGATTACAGACATCTGCCTGG + Intronic
1163510433 19:17732020-17732042 TAGAATTAAATATCTGTGCCTGG + Intronic
1163868824 19:19800858-19800880 CAGGATTAAAAACCTGTTTCAGG + Intronic
1165077750 19:33290259-33290281 GAGGCTGCCAAACCTGTGCCGGG + Intergenic
1165530485 19:36396173-36396195 TAGGATTACAGGCATGAGCCAGG + Intronic
1165802053 19:38558507-38558529 TAGGATTACAGGCATGAGCCAGG - Intronic
1166138869 19:40794842-40794864 TGGGATTAAAGACGTGTGCCAGG + Intronic
1166510558 19:43406110-43406132 TAGGATTACAGGCGTGAGCCAGG - Intronic
1166522531 19:43490416-43490438 TGGGATTACAGACATGCGCCAGG - Intronic
1167399837 19:49257737-49257759 TAGGATTACAAGCACGTGCCTGG - Intergenic
1167961185 19:53105367-53105389 TGGGATTACAAATGTGAGCCTGG + Intergenic
1168024658 19:53635149-53635171 TGGGATTACAAGCATGAGCCCGG + Intronic
1168134828 19:54343283-54343305 TGGGATTACAGGCCTGAGCCCGG + Intergenic
1168138762 19:54370333-54370355 TAGGATTCCCGACCTGTGCCTGG + Intronic
1168159261 19:54498164-54498186 TAGGATTCCCGACCTGTGCCTGG - Intronic
1202671195 1_KI270709v1_random:54416-54438 TGGGATTACAGGCGTGTGCCTGG - Intergenic
925722575 2:6843286-6843308 TAGGATTACAAACCACTGGATGG + Intronic
926196548 2:10767430-10767452 TAGGATTTCAGACATGTGCCTGG + Intronic
927232493 2:20837705-20837727 TGGGATTACAGGCATGTGCCCGG + Intergenic
928935915 2:36677905-36677927 TAGGATCAGAAGCCTGTGTCTGG + Intergenic
931368599 2:61641169-61641191 TGGGATTACAAGCATGAGCCCGG - Intergenic
931374938 2:61698379-61698401 TAGGATTACAGGCATGAGCCAGG + Intergenic
932223148 2:70016575-70016597 TGGGATTACAGACATGAGCCTGG - Intergenic
932378790 2:71262847-71262869 TAGGACTATAGACATGTGCCTGG + Intergenic
933670967 2:85006963-85006985 TGGGATTACAGGCATGTGCCTGG - Intronic
935038841 2:99405891-99405913 TAGGACTACAAAAATGTACCTGG + Exonic
935494251 2:103758907-103758929 TAGTTTTATAAACCTGTTCCTGG + Intergenic
937756356 2:125543496-125543518 TAGGATTACAGGCGTGAGCCAGG - Intergenic
938024766 2:127937703-127937725 TGGGATTACAGCACTGTGCCTGG - Intergenic
938075716 2:128333934-128333956 TGGGATTACAGGCATGTGCCCGG + Intergenic
938317615 2:130340951-130340973 TAGGATTCCAAACCAGTTCAGGG + Exonic
941116146 2:161474483-161474505 TGGGATTACAGGCGTGTGCCTGG + Intronic
941957666 2:171220914-171220936 TGGGATTACAGACGTGAGCCTGG - Intronic
943054066 2:182953661-182953683 CAGGATTACAGGCATGTGCCAGG - Intronic
943397897 2:187364706-187364728 TAGAATCACAGACCTGTGGCTGG - Intronic
943780888 2:191822501-191822523 TGGGATGACAATCCTGTGGCAGG - Intergenic
946936728 2:224729383-224729405 AAGGATTATAAACCTAGGCCGGG - Intergenic
947806994 2:232975929-232975951 TAGGATTATAGGCCGGTGCCTGG - Intronic
1169053035 20:2596496-2596518 TGGGATTACAAACACCTGCCAGG - Intronic
1170224764 20:13980348-13980370 TGGGATTACAGGCATGTGCCTGG + Intronic
1170644751 20:18187900-18187922 AAGGAATCCAACCCTGTGCCCGG + Exonic
1170921848 20:20686673-20686695 TAGGATTAGTGACCTTTGCCAGG - Intronic
1171477731 20:25426418-25426440 TGGGATTACAGGCATGTGCCCGG - Intronic
1172143192 20:32738424-32738446 TAAGAATACAAACATGAGCCGGG + Intronic
1172263795 20:33593059-33593081 TAGGATTACAGGCATGAGCCAGG - Intronic
1173807045 20:45933037-45933059 TAAAATTACAAACATGAGCCAGG - Intergenic
1174015776 20:47486940-47486962 TGGGATTACAGGCCTGAGCCAGG + Intergenic
1177441913 21:21136735-21136757 TAGGATTACAAGCATGAGCCCGG + Intronic
1180131849 21:45831843-45831865 TGGGATTACAGGCATGTGCCAGG + Intronic
1180242857 21:46523367-46523389 TAGGATTACAGGCGTGCGCCTGG + Intronic
1181597712 22:23927591-23927613 TGGGATTACAGACGTGAGCCAGG + Intergenic
1182310809 22:29404997-29405019 CAGGATTACAGCCATGTGCCAGG + Intronic
1183968187 22:41456103-41456125 TGGGATTACAAGCATGAGCCCGG + Intergenic
1184564148 22:45281734-45281756 TGGGATTACAGGCCTGTGCCTGG - Intergenic
1185237550 22:49723702-49723724 TTGAGTTACAAACCTGTGTCGGG + Intergenic
949704351 3:6798698-6798720 TGGGATTACAGTGCTGTGCCCGG + Intronic
951436054 3:22666117-22666139 TGGGCTTACAAACATGTGCACGG + Intergenic
951598924 3:24350877-24350899 TAAGAATACAAACATGTGGCAGG + Intronic
951914365 3:27784092-27784114 TGGGATTGGAAACCTATGCCTGG + Intergenic
953193907 3:40714091-40714113 TAGAATGACAAGCCTGTCCCAGG - Intergenic
953842475 3:46400258-46400280 TGGGATTACAAGCTTGAGCCCGG + Intergenic
954184871 3:48909183-48909205 TAGGATTAGAAACCCTTGACCGG - Intergenic
955723511 3:61908154-61908176 TAGGATTACAGGCGTGAGCCCGG - Intronic
956746265 3:72313188-72313210 TGGGATTACAGATCTGTACCAGG + Intergenic
958793343 3:98678880-98678902 TAGGATTACAGGCCCGAGCCTGG + Intergenic
959081603 3:101807591-101807613 TGGGATTACAGACATGTGCACGG + Intronic
959566133 3:107834681-107834703 TAGTATTTGAACCCTGTGCCTGG - Intergenic
959629410 3:108491288-108491310 TATGATTAAAAAGCAGTGCCTGG + Intronic
961023777 3:123533416-123533438 TGGGATTACAGGCATGTGCCTGG + Intronic
963224921 3:142852833-142852855 TAAGATTACAAGCATGAGCCTGG - Intronic
963639654 3:147843047-147843069 TGGGATTATAGGCCTGTGCCAGG - Intergenic
970035382 4:11728951-11728973 TGGGATTACACACGTGAGCCTGG + Intergenic
970534750 4:17019406-17019428 TTGGATTCCAGACCTTTGCCTGG - Intergenic
970899427 4:21141880-21141902 TGGGATTACAGACTTGAGCCAGG - Intronic
971589226 4:28445767-28445789 TAGGATTACAGGCATGAGCCAGG - Intergenic
973539217 4:51919317-51919339 TAGGATTACAAACCTTGTCCAGG - Intergenic
976225412 4:82791955-82791977 TTGGATTTAAAAGCTGTGCCTGG + Intronic
979263388 4:118673489-118673511 TGAGATTACAGACGTGTGCCTGG - Intergenic
980127217 4:128785701-128785723 TGGGATTACAGGCATGTGCCAGG + Intergenic
981778891 4:148402111-148402133 TAAGATTAAAAACCTGTACATGG - Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
981959647 4:150521522-150521544 TGGGATTACAAGCATGAGCCAGG + Intronic
982690088 4:158538676-158538698 TGGGATTACAGGCATGTGCCAGG - Intronic
982961634 4:161845774-161845796 TGGGATTACAGACGTGCGCCTGG - Intronic
983941780 4:173540880-173540902 TAAAATTAAAAACATGTGCCTGG + Intergenic
984780018 4:183516844-183516866 TGGGATTACAGGCCTGAGCCGGG + Intergenic
984920313 4:184758287-184758309 TAGGATTACAAGCATGAGACAGG - Intronic
985259551 4:188102579-188102601 TGGGATTACAGACGTGAGCCCGG - Intronic
985661070 5:1156708-1156730 TATGAATGCTAACCTGTGCCGGG + Intergenic
986446437 5:7825456-7825478 TGGAGTGACAAACCTGTGCCAGG - Intronic
988397898 5:30719349-30719371 TGGGATTAGAGGCCTGTGCCAGG + Intergenic
992940135 5:81752183-81752205 AAGGTGTACAAAGCTGTGCCAGG + Intergenic
993149035 5:84136394-84136416 TAGTATTACTAACCTGTGTTTGG + Intronic
996109711 5:119551099-119551121 TAGGACTACAGGCATGTGCCAGG - Intronic
997130290 5:131269789-131269811 TAGGATTACAGGCGTGAGCCAGG - Intronic
998075836 5:139235460-139235482 TAAGATTATAATCCTGTGGCTGG - Intronic
1003285462 6:4730130-4730152 TGAGATTACAAACCTTTGCTGGG + Intronic
1005985818 6:30874209-30874231 TGGGATTACAGACGTGAGCCAGG - Intergenic
1010090904 6:71980500-71980522 GAGGAATACAAACCTGTGAAAGG + Intronic
1010803018 6:80199800-80199822 TGGGATTACAGGCATGTGCCCGG - Intronic
1011058221 6:83230309-83230331 TGGGATTACAGGCATGTGCCCGG + Intronic
1012764385 6:103347828-103347850 TAGGATTACAGGCGTGAGCCAGG - Intergenic
1012927125 6:105278902-105278924 TAAGATTGCAAAACTGAGCCTGG - Intronic
1013113931 6:107086345-107086367 TGGGATTACCAACATGCGCCTGG - Intronic
1015743522 6:136484828-136484850 TAGGATTACAGACAAGTACCAGG + Intronic
1016926826 6:149359378-149359400 TTGGATTCCACACCTGTGCATGG + Intronic
1018941671 6:168312464-168312486 TGGGATTACAGGCATGTGCCTGG + Intronic
1020236200 7:6357502-6357524 TAGGATTACAGGCAGGTGCCTGG - Intergenic
1021840859 7:24720770-24720792 TGGGATTACAGGCATGTGCCTGG - Intronic
1021932097 7:25591587-25591609 TAGGTTCAAAAACCTGTGCCAGG + Intergenic
1022014703 7:26339361-26339383 TGGGATTACAGGCATGTGCCCGG + Intronic
1023713895 7:43023144-43023166 TGGGATTACAGGCATGTGCCAGG + Intergenic
1023773002 7:43576137-43576159 TAGGATTACAGGCATGAGCCCGG + Intergenic
1024078558 7:45836601-45836623 TGGGATTACAGGCATGTGCCAGG - Intergenic
1024271643 7:47646939-47646961 TGGGATTCCAAAGCTTTGCCTGG - Intergenic
1024394695 7:48852444-48852466 TGGGACTACAAACATGTGCCCGG - Intergenic
1024400565 7:48920197-48920219 TGGGACTACAAACATGTGCCTGG + Intergenic
1026269045 7:68820531-68820553 TGGGATTACAAGCATGAGCCTGG + Intergenic
1029523887 7:101083127-101083149 TAGGATTAAAAACCTCTGCTGGG + Intergenic
1030325053 7:108210623-108210645 TAGAATTCCAACCCTGTCCCTGG + Intronic
1032032048 7:128492425-128492447 TAGGATTACAGGCCTGCACCTGG + Intronic
1032782052 7:135171097-135171119 TAGGATAACAAACCGAGGCCGGG - Intergenic
1032819549 7:135511607-135511629 TGGGATTACAGACGTGAGCCAGG + Intergenic
1033340403 7:140487688-140487710 TGGGATTACAGACATGAGCCAGG - Intergenic
1033377415 7:140775480-140775502 TGGGATTACAGGCTTGTGCCTGG + Intronic
1033453859 7:141484829-141484851 TGGGATTACAGACGTGAGCCGGG + Intergenic
1033878082 7:145847317-145847339 TAGGATTACAGACATGAGCCAGG - Intergenic
1033989344 7:147264909-147264931 TAGGATTTGAAACCTCTGTCTGG - Intronic
1034344542 7:150378558-150378580 TGGGATTACAAACCCGCGCCCGG - Intronic
1035846745 8:2873842-2873864 TAGCATTACTAACCACTGCCTGG + Intergenic
1038715817 8:29990112-29990134 TAGGATTACAGATGTGAGCCTGG - Intergenic
1039493452 8:37964660-37964682 TAGGATTACAGGCCGGAGCCAGG - Intronic
1041700348 8:60781890-60781912 TAGGATTTCAACCCTGCTCCTGG - Intronic
1041709216 8:60877459-60877481 TAGTATTACAAACCTGAGAACGG + Intergenic
1044266798 8:90191349-90191371 TGGGATTACAAGCGTGAGCCAGG + Intergenic
1045274880 8:100694769-100694791 TAGGATTACAGGCATGAGCCTGG - Intronic
1046404242 8:113751756-113751778 CAGTATTAGAAACCTATGCCTGG + Intergenic
1046761798 8:118029157-118029179 TGGGATTACAAGCATGAGCCTGG - Intronic
1048700265 8:137080441-137080463 TAGGATTCCAAACTTTTTCCTGG - Intergenic
1049850641 8:144828290-144828312 TCAGATTACATCCCTGTGCCTGG + Intronic
1050498401 9:6268230-6268252 TAGGATTACAGGCGTGAGCCTGG - Intergenic
1057439442 9:95072386-95072408 TGGGATTACAAACATAAGCCTGG - Intronic
1059241371 9:112809219-112809241 TGGGATTACAGCACTGTGCCTGG + Intronic
1061100569 9:128488732-128488754 TGGGATTACAGACGTGAGCCCGG - Intronic
1062198637 9:135288661-135288683 TAGGATTTCAACCCCCTGCCAGG + Intergenic
1185661662 X:1733339-1733361 TAAAATTACAAAACTTTGCCAGG + Intergenic
1185720070 X:2374327-2374349 TGGGATTACAGCCCTGAGCCTGG - Intronic
1189474212 X:41336499-41336521 TGGGATTACAAGCATGAGCCCGG - Intronic
1190389876 X:49921573-49921595 TCGGATTACAAATTTGTCCCCGG + Intergenic
1190626933 X:52345679-52345701 TAGGATTACAGGCCTGAGCCTGG - Intergenic
1191925716 X:66307505-66307527 AAGAACTACAAACCTGGGCCGGG - Intergenic
1196811138 X:119629848-119629870 TAGGATTACAGGCCTGAGCCCGG - Intronic
1196852867 X:119955142-119955164 TGGGATTACAGGCGTGTGCCCGG + Intergenic
1197757837 X:130008740-130008762 TTGGGGTACAAAGCTGTGCCTGG + Intronic