ID: 905052692

View in Genome Browser
Species Human (GRCh38)
Location 1:35065556-35065578
Sequence CTTTAAATACAGTTGACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905052692 Original CRISPR CTTTAAATACAGTTGACTCT TGG (reversed) Intronic
900118137 1:1037213-1037235 CTTTAAATCCAGTTGGCTCCAGG - Intronic
900377357 1:2361699-2361721 CTGGAAATGCAGTTGACCCTTGG + Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
904086079 1:27909208-27909230 CTTAGAACACAGTAGACTCTTGG + Intronic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905372626 1:37492327-37492349 CTTAAAATATTTTTGACTCTTGG - Intergenic
906408261 1:45559221-45559243 ATTTAAATACATTTTTCTCTTGG + Intronic
907422769 1:54358310-54358332 ATTTAGATACGGTGGACTCTTGG + Intronic
907538841 1:55193358-55193380 TTCTAAATACAGTTGTCCCTTGG - Intronic
907581018 1:55572844-55572866 CTTAAAATACATCTGCCTCTAGG - Intergenic
908691690 1:66787187-66787209 CTAAAAATTCAGTTAACTCTGGG + Intergenic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
912582360 1:110732148-110732170 TTATAAATACAGTCGTCTCTAGG - Intergenic
913585972 1:120276220-120276242 GTTTAAAAAGCGTTGACTCTGGG - Intergenic
913622213 1:120622149-120622171 GTTTAAAAAGCGTTGACTCTGGG + Intergenic
914330860 1:146670089-146670111 ATTTAAATGCAGATGACACTTGG + Intergenic
914567979 1:148888078-148888100 GTTTAAAAAACGTTGACTCTGGG - Intronic
914604845 1:149242170-149242192 GTTTAAAAAACGTTGACTCTGGG + Intergenic
916992925 1:170264406-170264428 CATGAAATCCTGTTGACTCTAGG + Intergenic
917087833 1:171321314-171321336 ATATATATACAGTTGTCTCTTGG + Intronic
917169733 1:172157874-172157896 TGTTAACTACAGTTGTCTCTTGG - Intronic
918783829 1:188737742-188737764 TTTAAAATACAGTTGACCCTTGG + Intergenic
921423598 1:214976884-214976906 CTTTAAATCCAGCTGACACCTGG + Intergenic
921643885 1:217589584-217589606 ATTTAGGTACAGTTAACTCTTGG - Intronic
921759307 1:218894562-218894584 CTATAAATATTGTTAACTCTAGG + Intergenic
921898290 1:220423860-220423882 TTTCAAATACAGTTGTCCCTTGG - Intergenic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG + Intronic
923314045 1:232762193-232762215 GATAATATACAGTTGACTCTTGG + Intergenic
1065642334 10:27796417-27796439 CTATAATTTCAGTTGACTCATGG - Intergenic
1066311679 10:34203407-34203429 TTCCAAATACAGTTGTCTCTTGG + Intronic
1066449534 10:35516080-35516102 CTTGAAATACAGTTGATTTAGGG - Intronic
1067999370 10:51313641-51313663 CTATATATACAGTTGTCCCTTGG + Intronic
1069010630 10:63367685-63367707 ATTTAAAAGCATTTGACTCTGGG - Intronic
1069207696 10:65713034-65713056 CTCAAAATACAATTGACTCCAGG + Intergenic
1070346641 10:75549419-75549441 ATTTAAATACAGTGGTCTGTTGG - Intronic
1070686352 10:78485717-78485739 GTATAAATACAGTTGACCCTTGG - Intergenic
1070862122 10:79679369-79679391 TTTTAAATTAAGATGACTCTTGG + Intergenic
1070875016 10:79795087-79795109 TTTTAAATTAAGATGACTCTTGG - Intergenic
1071641940 10:87317252-87317274 TTTTAAATTAAGATGACTCTTGG - Intergenic
1072584133 10:96766304-96766326 CTTTTAAAACAGTTGTGTCTGGG - Intergenic
1074376301 10:112943581-112943603 CTTTAAAAATATTTGACTTTGGG - Intergenic
1074791598 10:116894223-116894245 CTCTAAATACATGTGACTTTTGG - Intronic
1079929613 11:26541681-26541703 CTTAAAGTAAAGTAGACTCTAGG - Intronic
1080126492 11:28740593-28740615 CCTTGAATACAGCTGACTTTAGG + Intergenic
1081088508 11:38831304-38831326 ATTTCTATACAGTTGACTCTAGG - Intergenic
1083493852 11:63033521-63033543 TTTTAAAAACTTTTGACTCTAGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086279074 11:85164621-85164643 CTTTCAACAGAATTGACTCTGGG - Intronic
1087188515 11:95229704-95229726 CTCTAAATACGGTTCACTTTGGG - Intronic
1087778548 11:102278934-102278956 TTGCAAATACAGTTGTCTCTTGG - Intergenic
1088096138 11:106103345-106103367 ATTTCAACACAGTTGACTGTAGG - Intergenic
1088416109 11:109590718-109590740 CTTGAAATACAGTGGATTCAGGG + Intergenic
1090970253 11:131636304-131636326 CTTTATATATAGCTGTCTCTTGG + Intronic
1091348789 11:134875939-134875961 CTATAAATACAGTTAACATTTGG + Intergenic
1091646023 12:2273055-2273077 ATCTAAATACAGTTGTCCCTTGG + Intronic
1092267377 12:6992762-6992784 TTTTGAATACAGTTATCTCTTGG + Intronic
1092702134 12:11243695-11243717 CTTTAAAGAAAGTAGAATCTGGG + Intergenic
1092779356 12:11970886-11970908 CTTTAAAGAGAGTTGAGACTGGG - Intergenic
1093125234 12:15321400-15321422 CTGTACATACCGTTGACACTTGG + Intronic
1093472478 12:19517635-19517657 AAATAAATACAGTTGTCTCTCGG - Intronic
1094407643 12:30135022-30135044 ATTTAAATACAGTTGACTGTTGG + Intergenic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1099055030 12:77828952-77828974 CTTTATATACAATTTATTCTAGG + Intergenic
1099081314 12:78185744-78185766 CATAAAATACACTTGACTCATGG - Intronic
1099466598 12:82995588-82995610 CTTCAAACACAGTTAATTCTGGG + Intronic
1099658060 12:85521130-85521152 ATCGAAATACAGTTTACTCTTGG - Intergenic
1099776767 12:87143277-87143299 CTTTAAATTCAGTTTCCTCAAGG - Intergenic
1100501663 12:95180323-95180345 GTTGAAGTACAGTTGCCTCTGGG + Intronic
1101390847 12:104298925-104298947 GTATAAATACAGTTGTCCCTCGG + Intronic
1103626095 12:122221204-122221226 CTTTAAATAGAGGTGAGACTTGG + Intronic
1104141480 12:125990589-125990611 TTTTTAATCCTGTTGACTCTTGG - Intergenic
1104533599 12:129596436-129596458 TTTTATATACAGTTGTCCCTTGG + Intronic
1105537614 13:21283338-21283360 TTTTAAGTACAGTTGACCCTTGG + Intergenic
1105711797 13:23017144-23017166 CTGTGAATACATTTGACTCAAGG + Intergenic
1107137637 13:36961612-36961634 ATATATATACAGTTGTCTCTTGG - Intronic
1107887099 13:44882706-44882728 CTTTTAATAAAGTTGTCCCTGGG + Intergenic
1107982010 13:45742957-45742979 CTCTAACTACAGATGACTCTTGG + Intergenic
1108112516 13:47091123-47091145 TTTGAAATGCAGTTGACTGTGGG + Intergenic
1109431029 13:62235330-62235352 ATTTCAACACAGTTCACTCTCGG + Intergenic
1110010858 13:70331767-70331789 CCTTCCATACAGTTGACTTTGGG - Intergenic
1110171520 13:72506381-72506403 CTTTTAATACAACAGACTCTTGG - Intergenic
1110197068 13:72802207-72802229 CCTTAAATAGACTTGACCCTTGG - Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1115274630 14:31593594-31593616 TATTATATACAGTTGTCTCTAGG - Intronic
1116699773 14:48225307-48225329 CTCTAACTACAATTGATTCTAGG - Intergenic
1116907690 14:50421166-50421188 TTTTAATAACAGTTAACTCTGGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1122677376 14:103426959-103426981 CTTTAAATTTAGCTGACTCTGGG - Intronic
1123959018 15:25374723-25374745 CTTAAAATACAATTGCCTCTGGG + Intronic
1126540723 15:49819856-49819878 TATTAACTACAGGTGACTCTGGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128879398 15:71229330-71229352 ATTTAAATACAGTTGTCCCTTGG + Intronic
1129434972 15:75531895-75531917 CTTTAAATACAGTTCTCTAGTGG + Intronic
1130293872 15:82629040-82629062 TTTTTAGTCCAGTTGACTCTTGG - Intronic
1130811739 15:87386202-87386224 CTTTAAATTCAGATACCTCTGGG + Intergenic
1132944409 16:2524690-2524712 CTTTCAACTCAGTGGACTCTTGG + Intronic
1133434578 16:5768065-5768087 ATTTAAATGCAGTCTACTCTTGG - Intergenic
1133931093 16:10232672-10232694 CTTAAAATTCAGGAGACTCTGGG + Intergenic
1134314169 16:13102845-13102867 TTTTAAATTAAGATGACTCTTGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135375885 16:21946956-21946978 CTTCACATACAGTTGAATCTGGG - Intergenic
1135687556 16:24510297-24510319 ATTTATATACAGTTGACCCTTGG - Intergenic
1135688548 16:24517690-24517712 ATTTATATACAGTTGACCTTTGG + Intergenic
1135797982 16:25463837-25463859 CTTTAAATACATTTATCTCATGG - Intergenic
1138030051 16:53552740-53552762 CTTTAAATTAAGTTGACTTGTGG + Intergenic
1139026665 16:62826215-62826237 ATATAAATACAGTTGTCTCTTGG - Intergenic
1140002694 16:71040817-71040839 ATTTAAATGCAGATGACACTTGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142388421 16:89782073-89782095 CTATAAAAACAGTTAACACTTGG + Intronic
1144232658 17:13223634-13223656 GTTTGTATACAGTTGTCTCTTGG + Intergenic
1150147376 17:62780249-62780271 CTTTCAATACAGTGGCCACTAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151420266 17:73992533-73992555 CTTTATAAACGGTTGACTCCGGG - Intergenic
1152402174 17:80073614-80073636 ATTTCAATACTGTTGAGTCTTGG - Intronic
1153054115 18:928598-928620 CTTTAAAAATACTTGTCTCTGGG - Intergenic
1153731895 18:8022202-8022224 CTTTAAATAAAGTAATCTCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156897252 18:42259791-42259813 CTTTAAACAAAAATGACTCTTGG + Intergenic
1157159662 18:45301950-45301972 TTTCAAAGACAGGTGACTCTAGG - Intronic
1158308153 18:56128945-56128967 CTTGAACTGCAGTTGACTATGGG - Intergenic
1159523769 18:69561478-69561500 TTTTAAATACATTTCACTTTGGG + Intronic
1159545049 18:69830318-69830340 CTTTAAATACAGTTGTATGTGGG - Intronic
1159688283 18:71451627-71451649 CTGTAAATGCAGTTTATTCTGGG + Intergenic
1160488299 18:79313533-79313555 CTTCAAATACAGTTTTCTTTGGG - Intronic
1164926975 19:32138545-32138567 CTTTAACTATAATTGACTCAAGG - Intergenic
1165038657 19:33053342-33053364 CTGGAAATACAGTTGATTCATGG - Intronic
1165696186 19:37902757-37902779 TGTTAAAGAGAGTTGACTCTAGG + Intronic
1166353518 19:42213029-42213051 CTTGAAAAACAGCTGATTCTAGG + Intronic
924994595 2:346859-346881 ATTTAAATACAATTCAGTCTAGG - Intergenic
927822028 2:26275467-26275489 CTTTAAATAGAGGTGGCTATTGG - Intronic
928740517 2:34346817-34346839 TATTAAGTACAGATGACTCTTGG - Intergenic
929725369 2:44420609-44420631 TTTTATACACAGTTGACTCCTGG - Intronic
931605293 2:64046448-64046470 TTTTAAAAACAGTTGAGGCTGGG + Intergenic
933061010 2:77736147-77736169 ATATATATACAGTTGACCCTTGG - Intergenic
934562243 2:95319435-95319457 CTTTGAAGACAGTGGACCCTGGG + Intronic
935044804 2:99471289-99471311 TTTTAAACACAGATGACCCTGGG - Intronic
935669998 2:105546949-105546971 CTTAAAATACGGATGAGTCTAGG + Intergenic
936551435 2:113445362-113445384 CTCTAAGTACAGTTGTCCCTTGG + Intronic
938251315 2:129817686-129817708 ATGTTAATACAGTTGTCTCTTGG + Intergenic
938601038 2:132839406-132839428 GTATAAGTACCGTTGACTCTTGG + Intronic
939507327 2:143062450-143062472 CTTTAAATAGAGTTGATATTTGG - Intergenic
939664955 2:144940388-144940410 CTTTAAACACTGTAGACTCCAGG + Intergenic
942580074 2:177408677-177408699 CTTTAAATTCACTTCACTATAGG - Intronic
1168928650 20:1603649-1603671 CTTTTAATAGTGATGACTCTTGG + Intronic
1173054024 20:39594037-39594059 CTTAAATTACAGTTGATTCTAGG + Intergenic
1173090212 20:39963555-39963577 CTTTCATTACATTTTACTCTAGG + Intergenic
1176947355 21:14998961-14998983 TTGTGAATACAGTTGACCCTTGG - Intronic
1178079654 21:29050559-29050581 CTTTAAATATAGTTGAGGCATGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178661770 21:34512474-34512496 TTTTATATATAGTTGTCTCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182390685 22:29992647-29992669 CTTCAAGTAAAGTTTACTCTTGG + Intronic
949130952 3:499793-499815 CTTTCGATACAGATGACTCAGGG + Intergenic
949526037 3:4905111-4905133 TTTTGAAGACAGTTGAATCTGGG + Intergenic
949702748 3:6778201-6778223 TTTTAAATTCAGTTAACGCTAGG - Intronic
950502451 3:13373003-13373025 CTTTAGATAGAGGTGGCTCTGGG + Intronic
950955466 3:17048256-17048278 TTGAAAATACAGTTGACCCTTGG + Intronic
951670790 3:25179721-25179743 TCTTAAATACACATGACTCTGGG - Intronic
952275654 3:31873332-31873354 TTTTAAATAAAGTTGTCTTTGGG + Intronic
952480750 3:33759288-33759310 CTTCAACTACAGTTGGATCTGGG - Intergenic
953011747 3:39032656-39032678 CTTATGAGACAGTTGACTCTAGG + Intergenic
953859230 3:46528187-46528209 TTGTAAATGCAGTAGACTCTCGG - Intronic
954060943 3:48066752-48066774 TTTCAAATACAGTTGTCCCTCGG - Intronic
954269931 3:49499877-49499899 CTTTAAATATACCTGCCTCTAGG + Intronic
955822773 3:62913861-62913883 TTTGAACTACAGTTGACTGTGGG + Intergenic
956247302 3:67198201-67198223 CTTTAAACACAGTCCACACTAGG + Intergenic
957875770 3:86144318-86144340 ATTTAAGTACAGTTGTCCCTTGG + Intergenic
959824298 3:110774801-110774823 CTTTAAATGCAAGTGACCCTGGG - Intergenic
962799889 3:138881324-138881346 CATTGAATGCTGTTGACTCTTGG - Intergenic
963157676 3:142116871-142116893 CTGTAAGTTCAGTTGACTCTTGG + Intronic
963335293 3:143968570-143968592 ATTTAAATACAGTTGTCTGTTGG + Intergenic
963595828 3:147323046-147323068 CTTGTAATACAATTGACTTTAGG - Intergenic
965971916 3:174569692-174569714 TTTAAAATACAGTTTATTCTAGG + Intronic
966452934 3:180083049-180083071 GTTTACATAAAGTTTACTCTTGG - Intergenic
966898417 3:184463025-184463047 TTTTGAATACAGTTGTCCCTTGG - Intronic
967463536 3:189775789-189775811 CTTTAAATTCAGTTAAATGTTGG - Intronic
968246117 3:197150198-197150220 GTTTAAAAACAGTTCACTGTGGG - Intronic
970240950 4:14008313-14008335 ATTTAAATACATTTGACCCTGGG - Intergenic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
970965251 4:21920764-21920786 CAGTAAATACAGTTGTCCCTTGG - Intronic
973153937 4:46924581-46924603 CTTTAAAGACAGTAGAATATTGG - Exonic
973667257 4:53175002-53175024 CTCTAATTTCAGTTTACTCTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974900185 4:67987429-67987451 CTTGAATTACAGTTGACCCTTGG + Intergenic
976100358 4:81555584-81555606 CTCTCAAGGCAGTTGACTCTGGG + Intronic
978614120 4:110576612-110576634 CTTTAAATAAACTTGACACATGG - Intergenic
981749394 4:148079255-148079277 CTTTAAATACAGTCAACTTACGG - Exonic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
986218831 5:5748068-5748090 CTTTAATAGCAGTTTACTCTGGG + Intergenic
986610043 5:9558026-9558048 CTTTAAAAACAGGTGAGTTTTGG - Intergenic
987634075 5:20516460-20516482 ATTTTAATACAGGTGACTTTGGG + Intronic
989110361 5:37901653-37901675 CTTTTTAAACAATTGACTCTTGG + Intergenic
990159230 5:52918426-52918448 CCCAAAATACAGTTGATTCTGGG + Intronic
991374552 5:65953199-65953221 CTCTGCATACAGTTGACTCTTGG + Intronic
992727475 5:79623315-79623337 GGTTAACTACAGTTGGCTCTTGG - Exonic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
994246338 5:97482646-97482668 TTTTAAATACACTTGAATGTAGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994696750 5:103080979-103081001 CTTCTAATACAGTTGTCCCTTGG + Intergenic
996037844 5:118778274-118778296 TTTCAAAAACAGTTGAATCTGGG + Intergenic
996125434 5:119720788-119720810 GATGAAGTACAGTTGACTCTTGG - Intergenic
998306766 5:141085099-141085121 TTTTAAATACAGGTAATTCTTGG - Intergenic
999688180 5:154121472-154121494 CTTTAGTTACAGTTTACTCCTGG + Intronic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1002876126 6:1211045-1211067 CTTTGAAGCCAGCTGACTCTGGG - Intergenic
1003066404 6:2906953-2906975 CAGCAAATACAGTTGTCTCTTGG - Intergenic
1003964259 6:11238079-11238101 CCTTCAATACAACTGACTCTTGG + Intronic
1004584017 6:16982054-16982076 CTTATAATACTGTTGACCCTTGG - Intergenic
1007395683 6:41576303-41576325 CTTTAAATCTAGTTTACCCTAGG - Intronic
1007449027 6:41929211-41929233 CTTTAAATACATTTCAGTCTGGG + Intronic
1008034479 6:46731987-46732009 CTTTATAAAGAGATGACTCTGGG - Intronic
1008653586 6:53588418-53588440 ATTAAAAAACATTTGACTCTCGG - Intronic
1009538313 6:64919990-64920012 AGTTAAATACATTTGAATCTGGG + Intronic
1009612682 6:65966267-65966289 CTGTATCTACAGTTGCCTCTGGG - Intergenic
1009650128 6:66465291-66465313 CTGTCAAATCAGTTGACTCTTGG + Intergenic
1010367202 6:75065150-75065172 CTTGAAATAAAGTTGTCTCTTGG + Intergenic
1011414484 6:87103193-87103215 CTGAAAATACATTTGACCCTTGG + Intergenic
1012316694 6:97790108-97790130 CTTTAAATCCACTTGTCTTTTGG + Intergenic
1012969038 6:105706922-105706944 TCCTAAATACAGTTGACCCTTGG + Intergenic
1013865168 6:114688273-114688295 CATTAAATTCAGTTAACTCAAGG - Intergenic
1014415117 6:121174403-121174425 CTTTTGATTCAGTTTACTCTGGG - Intronic
1016302034 6:142643557-142643579 CTTTATATAAAGTTCACTGTGGG + Intergenic
1017304856 6:152905390-152905412 ATTTGATTACAGGTGACTCTGGG + Intergenic
1017865736 6:158441716-158441738 CTCTAAATACTGCAGACTCTCGG + Intronic
1019474825 7:1238963-1238985 CTTTAAATACAGTTTAATGGGGG - Intergenic
1021098403 7:16559653-16559675 ATTTAAAAACAGTTACCTCTCGG - Intronic
1022763683 7:33385381-33385403 CTTTGAATACAGTTGGGTTTTGG + Intronic
1023448783 7:40259257-40259279 CTTAATGTACAGTTGACCCTTGG + Intronic
1026444264 7:70470527-70470549 GTTTAGATAGCGTTGACTCTAGG - Intronic
1028086391 7:86642828-86642850 CTTGATATACAGTTGTCTATTGG + Intergenic
1028572830 7:92310567-92310589 CAATAAATACAGTTGTCACTTGG + Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030137360 7:106267889-106267911 CTTTTAATAAAGTTAGCTCTAGG + Intronic
1031558081 7:123203014-123203036 ATTTGAATACAGTTGGCTCAAGG - Intergenic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1033037293 7:137886644-137886666 TTTTAAAGACCCTTGACTCTGGG - Intronic
1034047830 7:147948681-147948703 ATATATATACAGTTGACCCTTGG + Intronic
1037336679 8:17799160-17799182 CTTGAAATACAGTTGATGGTTGG - Intronic
1038582501 8:28761354-28761376 TATAAAATACAGTTGACTTTTGG + Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039535884 8:38312289-38312311 CTTTAAAAACAGTTAAGTATGGG - Intronic
1040778923 8:51083025-51083047 CTTAAAATTCAGTTAAATCTTGG - Intergenic
1040937129 8:52793107-52793129 TTTTAAATTAAGTAGACTCTAGG + Intergenic
1041133862 8:54734963-54734985 CTTTAAAGACAGTTTATTTTAGG + Intergenic
1042972660 8:74428019-74428041 CTTTAGGTACTGTTGTCTCTGGG - Intronic
1045675346 8:104601283-104601305 CTTTAAATCAAGTTGAGTCCGGG - Intronic
1045816499 8:106282826-106282848 TTATTAATACAGTTGACCCTTGG - Intronic
1045985665 8:108247017-108247039 TTCTAAGTACATTTGACTCTTGG - Intronic
1046183433 8:110682769-110682791 ATCTATATACAGTTGATTCTGGG + Intergenic
1046540146 8:115569895-115569917 TTTTTAATAAAATTGACTCTAGG - Intronic
1049901560 9:171752-171774 CTCTAAGTACAGTTGTCCCTTGG - Intronic
1050382727 9:5047394-5047416 TTTTAAATTCAGTTTCCTCTGGG + Intronic
1050620584 9:7448129-7448151 TTTTATATACAGTTGTCCCTCGG + Intergenic
1050647245 9:7733337-7733359 CTATATATACAGTTGTCCCTCGG + Intergenic
1050653325 9:7796986-7797008 ATATATATACAGTTGACCCTTGG - Exonic
1050705837 9:8395940-8395962 CTTAAAATACAGTAGACCTTAGG + Intronic
1051009731 9:12396765-12396787 CTTTAAGCACAGCTGAGTCTAGG + Intergenic
1051418463 9:16868685-16868707 CTTTTAATACAGCGCACTCTGGG + Intronic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1053744590 9:41182046-41182068 CTCTAAGTACAGTTGTCCCTTGG - Intronic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054482681 9:65683164-65683186 CTCTAAGTACAGTTGTCCCTTGG + Intronic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1055707421 9:79021194-79021216 CTTTGTGTAAAGTTGACTCTTGG + Intergenic
1055907516 9:81311269-81311291 CTTTAAAAATTATTGACTCTTGG - Intergenic
1058343353 9:103925667-103925689 CTTTTAATACATTTGATACTTGG + Intergenic
1058896903 9:109408311-109408333 ATTTACTTACAGGTGACTCTGGG + Exonic
1059384414 9:113953072-113953094 TTTTTAATACAGTAGACCCTGGG - Intronic
1061575055 9:131501159-131501181 CTGTAAATACAGTTGCCTGCAGG + Intergenic
1062332862 9:136052118-136052140 CTTTAAAAACAGTGGAGTGTTGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186708784 X:12171134-12171156 CCTTAAATACAGTTGACGAGAGG + Intronic
1186964771 X:14775329-14775351 CTTTCAATACAATTGATACTTGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1188357724 X:29212964-29212986 CTGAATATACAGTTGACTCTCGG - Intronic
1188386656 X:29568964-29568986 CTTTAAAAAGTGTTGACTATAGG + Intronic
1189404745 X:40711066-40711088 TTTAATATACAGTTGACCCTTGG - Intronic
1189712873 X:43832778-43832800 CTTCATAAACAGTTGACTCTTGG - Intronic
1190406078 X:50088944-50088966 TATTAAACACAGTTGACTGTAGG + Intronic
1190786269 X:53652311-53652333 TTTTAAAAACATTTGACTTTTGG + Intronic
1192344106 X:70287201-70287223 CTTTAAATACTGATGACTAGAGG - Intronic
1192347384 X:70322195-70322217 ATGTAAATATAGTTGACTGTGGG + Intronic
1192637922 X:72837752-72837774 CTTTTCATATAGTTGACTTTAGG + Intronic
1192643792 X:72883063-72883085 CTTTTCATATAGTTGACTTTAGG - Intronic
1192971957 X:76241442-76241464 CTTGAAAAAGAGTTAACTCTAGG - Intergenic
1193993520 X:88338587-88338609 CTATGAATACAGTTGTCCCTTGG + Intergenic
1196242436 X:113358120-113358142 CTTTTAATACATTTTTCTCTAGG + Intergenic
1201419669 Y:13784630-13784652 GTTTACATACACTTCACTCTTGG + Intergenic
1201545817 Y:15160839-15160861 CTTTAAATACAGTCCCCTCGGGG + Intergenic
1202054534 Y:20815548-20815570 CTTTAATTCTAGTTCACTCTGGG - Intergenic