ID: 905056089

View in Genome Browser
Species Human (GRCh38)
Location 1:35095076-35095098
Sequence GCATAGATCAAGTTTAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905056088_905056089 -9 Left 905056088 1:35095062-35095084 CCATGGACATTCAGGCATAGATC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 905056089 1:35095076-35095098 GCATAGATCAAGTTTAGATATGG 0: 1
1: 0
2: 0
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905056089 Original CRISPR GCATAGATCAAGTTTAGATA TGG Intronic
901010934 1:6201739-6201761 CTAAAGATCAAGTGTAGATAAGG - Intronic
905056089 1:35095076-35095098 GCATAGATCAAGTTTAGATATGG + Intronic
905751947 1:40472970-40472992 GCATAGAGCAGGTTCAGAAATGG - Intergenic
908870518 1:68605870-68605892 GCTTAGAGCAAGTTTGAATAAGG - Intergenic
909522077 1:76580738-76580760 GCATAAATCTATTTTAGATATGG + Intronic
910961549 1:92769120-92769142 AGAGAGATCAAGTTAAGATAAGG - Intronic
911760867 1:101614715-101614737 GCATAAATCTAGTAAAGATATGG - Intergenic
916418509 1:164614544-164614566 GCAAACATCAATTTTAGGTAGGG - Intronic
918484126 1:185011475-185011497 GCAGAGAGCAGGTTAAGATATGG + Intergenic
919412513 1:197263759-197263781 GAATAGATCAATGTGAGATAAGG - Intergenic
920840542 1:209550228-209550250 GGAAAGTTCAAGTTTACATAGGG + Intergenic
922050335 1:221983333-221983355 GGATAGTGAAAGTTTAGATATGG - Intergenic
1063807186 10:9658901-9658923 CCATAGATCAATTCTAGATGAGG + Intergenic
1064237656 10:13590888-13590910 ACATAGAACTAGTTTTGATAGGG + Intronic
1065266427 10:23981070-23981092 GCAGAGATAAACTTTAGTTAAGG + Intronic
1069017374 10:63445310-63445332 GAAGAGGTCAATTTTAGATAAGG + Intronic
1069281547 10:66660757-66660779 GTAGAGATCAATTTTAAATAGGG - Intronic
1074894189 10:117760721-117760743 GTTTAGAACAAGTTTAGAAATGG - Intergenic
1083910191 11:65703477-65703499 TCAGAGATTAAGTTTAGTTATGG + Intergenic
1086489917 11:87348951-87348973 GCACAGATCAATTTTTGCTATGG - Intergenic
1088347514 11:108844786-108844808 CCATAGATCTAGTTAAGACATGG + Intronic
1091198395 11:133751242-133751264 GCCTAGATCAGGATTAGATTTGG + Intergenic
1092964019 12:13624593-13624615 TCATGGATCAAATTTAAATATGG - Intronic
1093318489 12:17681541-17681563 TCATAGAATAAGTTAAGATATGG + Intergenic
1096742509 12:53704231-53704253 AGATAGATGAAGTTTATATAGGG + Intergenic
1099152834 12:79136820-79136842 GCAGTGATCAATTTTAAATATGG + Intronic
1103718647 12:122961490-122961512 CCAGAGATCAATTTTAAATAGGG + Intronic
1106509175 13:30398316-30398338 GCATAGGTCAAGGTTAGGGATGG + Intergenic
1107298892 13:38945123-38945145 GCATAGATCACTTGTAGATCTGG + Intergenic
1109593324 13:64515789-64515811 GGATAAAACAAGATTAGATATGG - Intergenic
1117646728 14:57860984-57861006 GCATAGAACAAGTAGAGATAAGG - Intronic
1120612721 14:86662551-86662573 AAATAGATAAAGTTTAAATAAGG - Intergenic
1126171508 15:45699082-45699104 TCATAGATCAATTTTAGGTGAGG + Intergenic
1134835324 16:17356275-17356297 GAATAGATGAAATTTACATAAGG + Intronic
1135007545 16:18839975-18839997 GAAAAGATCAATTTTATATAAGG + Intronic
1136017084 16:27407372-27407394 GCGTAGACCCAGTTCAGATAGGG + Intronic
1139638159 16:68271602-68271624 GCCAAGGTGAAGTTTAGATATGG + Intronic
1151090078 17:71428712-71428734 GGAAAGATCAATTTTATATATGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1156249234 18:35335509-35335531 GCTTGGATCAAGTTTAAAAATGG - Exonic
925162368 2:1694822-1694844 ACACAGATCAAGTACAGATAAGG + Intronic
928377137 2:30784531-30784553 ACATAGATCAACTTTAGAGAGGG + Intronic
933555902 2:83830388-83830410 ACATAAATAAAGTTGAGATAAGG + Intergenic
936848201 2:116863558-116863580 GCATAGATCAACTTAATATATGG + Intergenic
937631063 2:124101609-124101631 GTAAAGAGCAAGTTCAGATAAGG + Intronic
939767601 2:146270947-146270969 GTATAAATCAAGTATAAATATGG + Intergenic
940115164 2:150200740-150200762 GTATATATCAAGATTAAATAAGG - Intergenic
941499030 2:166245947-166245969 GCATTGATCCAGTTGATATAAGG + Intronic
946725192 2:222655382-222655404 GCCAAGAACAACTTTAGATAGGG - Intronic
947013515 2:225591745-225591767 AGATTGATCAAGTATAGATAAGG - Intronic
1170982326 20:21226380-21226402 GCATAGAACAAGGTTGGAGAAGG - Intronic
949672934 3:6420773-6420795 GAATATAGCAAGCTTAGATAAGG + Intergenic
949862504 3:8518982-8519004 GCATAGATGAAGCATAGATGAGG + Intronic
952609169 3:35186316-35186338 GATTAAGTCAAGTTTAGATAAGG + Intergenic
964655405 3:159061479-159061501 GCAAAGAGCAAGGCTAGATAAGG + Intronic
971064803 4:23018743-23018765 TAATAAATCAGGTTTAGATAGGG + Intergenic
972730982 4:41794840-41794862 CCAAATATAAAGTTTAGATATGG + Intergenic
976549739 4:86380455-86380477 GAATAGGTCAATTATAGATAAGG + Intronic
976576552 4:86678956-86678978 GAATAGAACAAGATTATATATGG - Intronic
976577381 4:86689844-86689866 GTATAGATCCAGATCAGATAGGG - Intronic
976674066 4:87685102-87685124 GGATAGAACAAGTCTGGATAGGG - Intergenic
980802514 4:137770125-137770147 GCATTGATGAGGTTTAGGTAGGG + Intergenic
982209770 4:153024946-153024968 GCATACATCAACTTTACTTAGGG - Intergenic
986524494 5:8658740-8658762 GCAGTGATTAAGTTTAGATGAGG + Intergenic
986961723 5:13220872-13220894 GAATAAATTAAGTTTAGATGAGG - Intergenic
988373536 5:30404037-30404059 GAATATAACAAATTTAGATAAGG - Intergenic
988643770 5:33070899-33070921 GGATAGAGAAAGTTTGGATATGG + Intergenic
989430903 5:41354342-41354364 GCATAGAGCAAGTTGAGGGAGGG - Intronic
990724560 5:58739419-58739441 GCAAAGATAAATTCTAGATAAGG - Intronic
993053615 5:82954474-82954496 ATATAGATAAAGTATAGATAAGG + Intergenic
993293979 5:86110291-86110313 GCAGATATAAAGTTAAGATAAGG + Intergenic
994041318 5:95263052-95263074 GCATAGATAATGTTTTCATAAGG - Intronic
995975292 5:118028267-118028289 GCATAGATCAAATTTTGCTAGGG + Intergenic
996254931 5:121388324-121388346 ATATAGATAAAGCTTAGATATGG + Intergenic
997814016 5:136998954-136998976 GCAAAGAGCAAGTGTAAATAAGG + Intronic
998343990 5:141444589-141444611 GCAAAAATCAATTTTAAATAAGG - Intronic
999356639 5:150940873-150940895 GCAAATATCATGTTTAGAAAAGG + Intergenic
999656843 5:153818809-153818831 CCTTAGAGCCAGTTTAGATAGGG - Intergenic
1012037457 6:94160851-94160873 GACTAGATCATGTTAAGATAAGG + Intergenic
1012234397 6:96796595-96796617 GCCTAGAACAAGTTTTAATAGGG - Exonic
1013784752 6:113767226-113767248 CCAGAGATCAAGTATAGAGAAGG + Intergenic
1014533612 6:122590691-122590713 GCATTTTTCAAGTTTAGAGAAGG + Intronic
1015404225 6:132819133-132819155 GCAGAGTTCAAGGTTAGATTTGG - Intergenic
1016041958 6:139440826-139440848 GCCCAGATCAAGTTTTGATAAGG + Intergenic
1016158781 6:140849372-140849394 GATTAGATCAAGTATAGATCAGG + Intergenic
1018843560 6:167537429-167537451 GCATAGCTAAATTTTATATAGGG - Intergenic
1020561571 7:9734172-9734194 GTATATATTAAGTTTAGATTGGG - Intergenic
1020824775 7:13013068-13013090 TCATAAAACAAGTCTAGATAAGG - Intergenic
1021491578 7:21225064-21225086 CCATGGATGAAGTTTACATAAGG - Intergenic
1022729690 7:33010653-33010675 ACAGAGATCTATTTTAGATATGG - Intergenic
1023279459 7:38554822-38554844 TCAGATATAAAGTTTAGATACGG + Intronic
1030717478 7:112826983-112827005 GCATAGACCAAGTTTGGTTTAGG + Intronic
1032177922 7:129647873-129647895 GCACAGTTCAAGTTTAGAAGTGG - Intronic
1032981460 7:137288664-137288686 GCTAAGATCAAGTGTAGAGATGG + Intronic
1041138329 8:54785862-54785884 GCTAAGATCAAGTATAAATATGG - Intergenic
1049841420 8:144775323-144775345 TCATAGATCAGCTTTAGATAAGG - Intronic
1052182751 9:25550445-25550467 GCATAGATGAGGATTAAATATGG - Intergenic
1053221457 9:36316408-36316430 GAATAGCTAAAGTTTAGTTAGGG - Intergenic
1056504849 9:87248572-87248594 TTATGGATCAAGTTTAAATATGG + Intergenic
1057837546 9:98457505-98457527 GCATATGTAAAGTTTATATAGGG - Intronic
1058787682 9:108406261-108406283 GCATATTTTAAGTTAAGATAAGG - Intergenic
1061548529 9:131318716-131318738 GCATGCATGAAGTTTAGATATGG - Intergenic
1061729228 9:132600603-132600625 GGAGAGATCATATTTAGATATGG + Intronic
1187019828 X:15369387-15369409 GCATAGAGCAAGTTTAGAAGTGG + Intronic
1193599475 X:83492052-83492074 GCTTAGAACAATTTTAGAAATGG + Intergenic
1195578492 X:106476136-106476158 GAAAAGTTCAAGTTAAGATAAGG - Intergenic
1196315538 X:114218319-114218341 GCACAGATAAAGATTAGAGAAGG + Intergenic
1196532521 X:116805912-116805934 GCCTAGAGCAGGTTTAGAAATGG + Intergenic
1196765609 X:119239348-119239370 GAATAGATCAAGTTTCAATATGG - Intronic
1198861903 X:141079914-141079936 GCAGAGTTTAAGTTTAGATAGGG - Intergenic
1198900787 X:141507458-141507480 GCAGAGTTTAAGTTTAGATAGGG + Intergenic
1199364431 X:146963036-146963058 GCAGATATCAAGGTCAGATAGGG + Intergenic