ID: 905061477

View in Genome Browser
Species Human (GRCh38)
Location 1:35143326-35143348
Sequence GTTTGGGGGTGCACCTGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905061469_905061477 15 Left 905061469 1:35143288-35143310 CCGACTGAACAAAATCTTATAGG No data
Right 905061477 1:35143326-35143348 GTTTGGGGGTGCACCTGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905061477 Original CRISPR GTTTGGGGGTGCACCTGACT CGG Intergenic
No off target data available for this crispr