ID: 905063446

View in Genome Browser
Species Human (GRCh38)
Location 1:35159443-35159465
Sequence TGCCTTGGCCTCCCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905063441_905063446 -8 Left 905063441 1:35159428-35159450 CCTTGTGATTGGCCCTGCCTTGG No data
Right 905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG No data
905063437_905063446 15 Left 905063437 1:35159405-35159427 CCAGGATGGTCTCGAACTCCTGG 0: 167
1: 13177
2: 168130
3: 277697
4: 183744
Right 905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG No data
905063440_905063446 -3 Left 905063440 1:35159423-35159445 CCTGGCCTTGTGATTGGCCCTGC No data
Right 905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905063446 Original CRISPR TGCCTTGGCCTCCCACAGGC TGG Intergenic
No off target data available for this crispr