ID: 905066844

View in Genome Browser
Species Human (GRCh38)
Location 1:35192089-35192111
Sequence TGCGCGCGCCGCTGCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 246}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905066844_905066858 21 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066858 1:35192133-35192155 CAAAATGGAAGCCCAGCGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 139
905066844_905066860 25 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066860 1:35192137-35192159 ATGGAAGCCCAGCGCGGGGGCGG 0: 1
1: 0
2: 2
3: 18
4: 225
905066844_905066853 6 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066853 1:35192118-35192140 CCTTCCGGCAGCCGACAAAATGG 0: 1
1: 0
2: 0
3: 0
4: 47
905066844_905066863 28 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066863 1:35192140-35192162 GAAGCCCAGCGCGGGGGCGGGGG 0: 1
1: 0
2: 4
3: 54
4: 461
905066844_905066849 -9 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066849 1:35192103-35192125 GCGCGCGCAAGCGCCCCTTCCGG 0: 1
1: 0
2: 0
3: 0
4: 33
905066844_905066861 26 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066861 1:35192138-35192160 TGGAAGCCCAGCGCGGGGGCGGG 0: 1
1: 0
2: 2
3: 33
4: 299
905066844_905066859 22 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066859 1:35192134-35192156 AAAATGGAAGCCCAGCGCGGGGG 0: 1
1: 0
2: 5
3: 52
4: 559
905066844_905066862 27 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066862 1:35192139-35192161 GGAAGCCCAGCGCGGGGGCGGGG 0: 1
1: 0
2: 2
3: 33
4: 374
905066844_905066857 20 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066857 1:35192132-35192154 ACAAAATGGAAGCCCAGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 143
905066844_905066856 19 Left 905066844 1:35192089-35192111 CCGCCCCCGCAGCGGCGCGCGCA 0: 1
1: 0
2: 4
3: 22
4: 246
Right 905066856 1:35192131-35192153 GACAAAATGGAAGCCCAGCGCGG 0: 1
1: 1
2: 3
3: 38
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905066844 Original CRISPR TGCGCGCGCCGCTGCGGGGG CGG (reversed) Intronic
901012377 1:6209103-6209125 TGCGTGCAGCGCTGCGGGGGCGG - Exonic
901050698 1:6424663-6424685 TCCCCGCGTCGCGGCGGGGGCGG + Intronic
901050821 1:6425134-6425156 GGCGCGGGCCGCGGCGGGGAGGG - Exonic
904614568 1:31742942-31742964 TGCTCCCGCAGCTGCGGGCGGGG - Exonic
904642051 1:31938341-31938363 TGCGCGCGCAGCGGTGGTGGTGG - Exonic
905028450 1:34866360-34866382 TGGGCGCGGGGGTGCGGGGGCGG - Intronic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
906027123 1:42682894-42682916 TGCGCGCGCGCCTGCCGGGCGGG - Intronic
906214605 1:44031420-44031442 TGCGAGCGGCGCGGCGGGGCGGG - Intronic
906960905 1:50419067-50419089 TGCCTGCGCCGCTGCAGGCGGGG - Exonic
909629793 1:77759619-77759641 TGAGCGCGGCGCTGCTGGGAGGG - Intronic
910200192 1:84690727-84690749 TGCGGGCGCAGCTGCGGCTGCGG + Intronic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
911184834 1:94893033-94893055 TGGGCGCTCCGCTGAGGGTGTGG - Intronic
912435183 1:109656589-109656611 TGCGTGCGCCGGGGTGGGGGGGG + Intronic
912492711 1:110070728-110070750 GGCGCGCGCCGCGGGGGGCGGGG + Intronic
915142494 1:153776124-153776146 CGCGCGCGCCGCAGCTGCGGAGG - Exonic
918215942 1:182391930-182391952 GGCGGGCGCCGCTGGGGTGGGGG + Exonic
920528511 1:206685341-206685363 TGCGGGAACTGCTGCGGGGGCGG - Exonic
921172100 1:212558982-212559004 TGCGCGCGGCCCGGCGGGGGCGG + Intergenic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
921909052 1:220528175-220528197 TGCGCGCGGAGCAGCGGGCGCGG - Intronic
922351393 1:224737201-224737223 TGCGTGCTCCGCTGCGGGGGTGG + Intronic
923592163 1:235328488-235328510 TGCGTGGACCGGTGCGGGGGCGG + Intronic
1062857106 10:784840-784862 TGCCCCGGGCGCTGCGGGGGCGG - Intergenic
1064086709 10:12350547-12350569 TGTGCGCGTCGCTGCGCGGGCGG + Intronic
1064354278 10:14603974-14603996 GGCGGGGGCCGCTGCGGGGAAGG - Intronic
1064442981 10:15370670-15370692 TGCTGTCGCCGCTGCGGCGGGGG - Intronic
1066080802 10:31928842-31928864 GGAGCGCGCCGGCGCGGGGGCGG + Intronic
1068560786 10:58512791-58512813 TGAGCGCGCGGCTGTAGGGGCGG + Intergenic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1069976285 10:72215990-72216012 TGCGCGCGCCCGTGCCGTGGTGG - Exonic
1071794672 10:88991362-88991384 TGCGCGCCGCCCCGCGGGGGCGG + Exonic
1072970174 10:100010166-100010188 TCGGCGCGCTGCGGCGGGGGCGG - Intergenic
1074655963 10:115587601-115587623 TGCGCGAGCCGAAGCGGGCGAGG - Intronic
1074843265 10:117375390-117375412 GGCGCGGGCCGCTGCGGGCTCGG - Exonic
1075040688 10:119104536-119104558 TGCGAGGGGCGCTGCGCGGGCGG + Intronic
1076116967 10:127907451-127907473 TGGGCGCGCCGCGGGGGCGGCGG - Intronic
1076624689 10:131814625-131814647 TGCGTGCTCCGCGGAGGGGGAGG - Intergenic
1076708937 10:132320524-132320546 TGCCCCAGCCTCTGCGGGGGTGG - Intronic
1077103643 11:832862-832884 AGCGCCCGCCGCCGCGGGAGGGG + Exonic
1081528278 11:43942077-43942099 CGCGCGCGCGCCTGCGGAGGGGG + Intronic
1084526665 11:69702471-69702493 TGCGCGCGGGGCCGCGGGAGGGG + Intronic
1084526910 11:69703604-69703626 TGCGCGCGGCGGGGCGGGCGGGG + Intronic
1085332953 11:75668209-75668231 TGCGCCTGCTGCTGCGGCGGCGG + Exonic
1085641587 11:78196378-78196400 GGCGCGCGCCTCTACGTGGGCGG + Exonic
1086064904 11:82733805-82733827 CGCGCGCGCCGCGCCGGGGCGGG - Exonic
1087672972 11:101128410-101128432 TCCGCAGGCCGCTGCGGTGGAGG - Exonic
1087755133 11:102047389-102047411 TCGGAGCGACGCTGCGGGGGCGG - Intergenic
1088604187 11:111512732-111512754 AGCGGGCGGCGCTGCCGGGGAGG - Intergenic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1090211022 11:124921209-124921231 TGCGCGAGGCGCTGCGCGAGCGG + Exonic
1090699331 11:129279691-129279713 CGCGCGCGCGGCCGAGGGGGCGG + Intergenic
1091218931 11:133919432-133919454 AGCGCGTGCCCTTGCGGGGGTGG - Intronic
1091404967 12:203513-203535 TGGGCGTGGCGCTGCGCGGGAGG + Intronic
1092193198 12:6534644-6534666 TGTTCGCGCCGCTGCGGGGTGGG + Intronic
1093464840 12:19439368-19439390 TGCAGGCGCCGGGGCGGGGGCGG + Intronic
1096024812 12:48351102-48351124 CGCGCCCGCCGCTGTGGGGAGGG + Intronic
1096491414 12:52015017-52015039 TGCGCGGGCCCTGGCGGGGGCGG + Exonic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101605905 12:106247685-106247707 TGCGGGTGCTGCTGCGGGTGCGG + Exonic
1101716661 12:107318523-107318545 TGCCCGCGGAGCTGCGGCGGCGG + Exonic
1102853962 12:116277522-116277544 TTCGCGCTCCGCGGCGGCGGCGG - Intergenic
1103562413 12:121799705-121799727 CGCGCTCGCAGCTGGGGGGGGGG + Intronic
1103604792 12:122078726-122078748 AGCGCGCGGCGCGGCGGGAGGGG - Exonic
1103954291 12:124567703-124567725 GGGGCGCGTCGCTGCGGGCGGGG - Intergenic
1104915245 12:132261010-132261032 TCCGCGCGCGGCTGCAGGGCTGG - Intronic
1104987842 12:132607053-132607075 TGCCCGCACTGCTGCGGGGCTGG - Intronic
1105698545 13:22915563-22915585 TGCCCGCGCCGGCGCAGGGGCGG + Intergenic
1106510510 13:30408648-30408670 TGCGCGCGCTGCGGCAGGCGCGG + Intergenic
1106516974 13:30464814-30464836 TGCGGGCGCGGCGGCGGCGGCGG + Intronic
1107468027 13:40666652-40666674 CGCGCGCGCCGCCGCGGGCGGGG - Intergenic
1108196568 13:48001284-48001306 TGCGCGCGGCGCCGAGGGGACGG - Exonic
1108590090 13:51905568-51905590 CGACCGCGCCGCTGCGAGGGAGG - Intergenic
1112461443 13:99606722-99606744 GGCGCGCGGAGCTGCGGCGGCGG + Exonic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1117141079 14:52791610-52791632 TGCGCGCGGCCCTGCGTGAGGGG - Intronic
1118761079 14:68880433-68880455 TGCGCGCGTGGCTGTGGGGTTGG - Intronic
1122162295 14:99793296-99793318 GGCTCGCGCGGCTGCGGCGGCGG + Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122270766 14:100567682-100567704 GGCCCGGGCCGCTGCGGCGGGGG - Intronic
1122691682 14:103534740-103534762 TGGGCGTGCCGCTGCGGAAGGGG - Exonic
1122775919 14:104116942-104116964 TCCGCGCGCCCGCGCGGGGGTGG - Intergenic
1123500787 15:20878737-20878759 TCGGCGCGCCGCTGCGGACGCGG + Intergenic
1123558037 15:21452430-21452452 TCGGCGCGCCGCTGCGGACGCGG + Intergenic
1123594265 15:21889711-21889733 TCGGCGCGCCGCTGCGGACGCGG + Intergenic
1124957227 15:34367322-34367344 TGCGGGCGCCGCGGCGGGCGCGG - Intergenic
1126766910 15:52019074-52019096 TGCGCGCGCCGCGGAGGCGGTGG - Intronic
1126849871 15:52790373-52790395 AGGGCGGGCCGCTGCGGCGGCGG - Intronic
1129267964 15:74404094-74404116 GGCGCGGGCGGCTGTGGGGGAGG + Intergenic
1129675996 15:77632679-77632701 GGCGCGCTCCGCCGCGGGGCCGG + Intronic
1129740743 15:77988463-77988485 TGCTCGCGCAGCTGCGGTGGAGG + Intronic
1129844988 15:78764077-78764099 TGCTCCCGCAGCTGCGGCGGAGG - Exonic
1129983561 15:79896742-79896764 TGCGCGCGCCGGGGGGTGGGGGG + Intronic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1130564497 15:84981974-84981996 TGCGGGCGCTGCGGCGGCGGCGG - Exonic
1131097469 15:89665706-89665728 CGGGCGCGGCGCTGCGGGCGTGG + Exonic
1131290178 15:91100290-91100312 TGCACGCGGGGCTGCCGGGGCGG + Exonic
1132055538 15:98648449-98648471 TCGGCGCGCCGCTGCTGCGGCGG + Intergenic
1132724674 16:1333610-1333632 GGCGGACGCCGCTGCGGGGGCGG - Intronic
1132896908 16:2233527-2233549 TGAGCGCGCTGCTGGGGAGGAGG + Exonic
1132947170 16:2538068-2538090 GCCGCGCAGCGCTGCGGGGGAGG + Exonic
1133784570 16:8964053-8964075 GGGGCGCGGCGCTGCGGGGCAGG - Intronic
1134134169 16:11668628-11668650 GGCGCGCGCGGCGGCGGGGCCGG + Intronic
1136110798 16:28062899-28062921 GGCGCGCGCCGTTCCGGGGCCGG - Intronic
1136267812 16:29131345-29131367 TGCCCCCGCCGCTGCAGGCGAGG + Intergenic
1136428209 16:30183231-30183253 TGCGCTCGCGTCTGCGGGGCCGG + Intronic
1136517360 16:30775952-30775974 AGCGCGGGCCGCGGCAGGGGAGG + Exonic
1136546521 16:30957982-30958004 TGCGCGCGCCGGGGAGGTGGTGG + Intronic
1138179732 16:54933219-54933241 AGGGCCCGCCGGTGCGGGGGGGG - Exonic
1138180032 16:54935026-54935048 TGCCCGCTCAGCTGCGGGGCTGG + Intergenic
1140033849 16:71358606-71358628 GGGGCGCGGCGCGGCGGGGGCGG - Intergenic
1141692231 16:85602858-85602880 TGTGTGGGCCCCTGCGGGGGAGG - Intergenic
1141698751 16:85632841-85632863 TGGGGGCGTCTCTGCGGGGGAGG + Intronic
1141972314 16:87492388-87492410 GGCGGGCGCCGGGGCGGGGGCGG + Intergenic
1142071115 16:88091692-88091714 TGCCCCCGCCGCTGCCGGCGAGG + Intronic
1147661924 17:42121307-42121329 GCCGCTCTCCGCTGCGGGGGAGG - Exonic
1147996762 17:44363818-44363840 AGCGGGCGCCGCAGCGGGAGCGG - Exonic
1148818232 17:50346006-50346028 GGCGCGCGCCGGGGCGGGGCCGG - Intergenic
1151153804 17:72110429-72110451 TATGCGCGCGGCGGCGGGGGAGG + Intergenic
1151156116 17:72123887-72123909 TGTGGGGGCTGCTGCGGGGGTGG - Exonic
1151708398 17:75784997-75785019 TGCGCGCGCGGCGGGGGGGGGGG - Intronic
1152356750 17:79811271-79811293 TGCGCGCGCCTCGGCGGGTTGGG - Intergenic
1152396543 17:80036540-80036562 GGCGCGCGCCTCTGCGTGCGTGG + Intergenic
1152721882 17:81927473-81927495 TGGGGGCGGCGCGGCGGGGGCGG - Intronic
1152745752 17:82037840-82037862 TGGGCGCGCCGGGGCGGGGCGGG + Intergenic
1153515385 18:5896129-5896151 TGCGCCCGTCCCGGCGGGGGCGG - Intergenic
1153935204 18:9914541-9914563 CGCGCGCACCGCAGCGAGGGCGG - Intronic
1154125572 18:11689540-11689562 TGGGCGCGGCACAGCGGGGGCGG - Exonic
1155654276 18:28176874-28176896 TCCCCGCGCCGCTGCGGGGCCGG - Intronic
1156275697 18:35581400-35581422 TGGGCTCGCCGCAGCGGAGGGGG + Intronic
1158137732 18:54224626-54224648 CGCGCGCCGCGCTGCGGGCGGGG - Exonic
1158579878 18:58671741-58671763 TGCGGGAGCCGCTGCTGCGGAGG + Exonic
1160739634 19:680003-680025 CGCGCGGGCCGGGGCGGGGGGGG - Intronic
1160873143 19:1286005-1286027 CGCGCGCGCGGAGGCGGGGGCGG + Intergenic
1160895884 19:1401595-1401617 CGCGCGCGCGGCTCCGGGAGCGG + Intergenic
1160902960 19:1438333-1438355 TGCGCGCACGGCCGAGGGGGCGG + Intergenic
1160947907 19:1652113-1652135 TTCGCGCGGCGCCGGGGGGGCGG - Intronic
1161104461 19:2436625-2436647 TGGGTGCGCGGCTGTGGGGGTGG - Intronic
1161157497 19:2740182-2740204 TGCGCCCGCCGCTCAGCGGGAGG - Intergenic
1161210407 19:3062551-3062573 CGTGCGCGCCGCCGAGGGGGGGG + Intronic
1161264599 19:3358603-3358625 CGCGCGAGCCGCTGCGGGTTGGG - Intergenic
1161264780 19:3359285-3359307 CGCGCGCGCCGCGGCGAAGGTGG + Intergenic
1161265157 19:3360342-3360364 CGCGCGCGCGGCAGCGGGGCCGG - Intronic
1162033162 19:7925940-7925962 GGGGCGCGCCGGGGCGGGGGCGG - Intronic
1162372957 19:10289955-10289977 TCCGCGCGGCGCGGCGGGTGGGG - Intergenic
1162412944 19:10517449-10517471 AGCGGACGCCGCTCCGGGGGCGG + Exonic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163248561 19:16112069-16112091 TGGGCGCGCCCCTGAGGGGCTGG + Intronic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165775648 19:38403087-38403109 TGCGCGCGGCGCTTTTGGGGCGG + Intergenic
1166306905 19:41940413-41940435 GGGGCGCGCGGCGGCGGGGGAGG - Intergenic
1166948583 19:46412109-46412131 TGCGCTCTCCACTGCGGTGGAGG + Exonic
1167633491 19:50639823-50639845 GGCGCGCGGGGCTGCGGCGGCGG - Intronic
925610503 2:5697197-5697219 TGCGGGCGCCGCAGCTCGGGAGG - Exonic
926083403 2:10006517-10006539 TGCGCGCGGCGCTCCTGGGCCGG - Intergenic
932496404 2:72147860-72147882 TGTGCCGGCCGCGGCGGGGGAGG + Exonic
932812299 2:74835131-74835153 TCCCCGCGGCCCTGCGGGGGTGG + Intronic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
935349691 2:102142703-102142725 TAGCCCCGCCGCTGCGGGGGCGG - Intronic
937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG + Intronic
940830078 2:158457058-158457080 TGGGAGAGCCGCTCCGGGGGCGG + Intronic
942890517 2:180981087-180981109 TCCGCGAGCCGCGGCGGGGCCGG + Intronic
947641203 2:231708783-231708805 TCCGCGCGCCGCCGCTCGGGCGG + Intronic
948115941 2:235494396-235494418 GGAGCGCGCCGCGGCGGGTGCGG - Exonic
948208919 2:236178269-236178291 TGCGCGCGCCGGGGCGGGAGAGG + Intergenic
948813574 2:240498497-240498519 TGTGCGGGCAGCTGTGGGGGTGG + Intronic
948813585 2:240498531-240498553 TGTGCGGGCAGCTGTGGGGGTGG + Intronic
1170026072 20:11891013-11891035 GGCGCGCGCCCCTGCCCGGGCGG - Intronic
1173734305 20:45348481-45348503 TGCGGGCGGCGGGGCGGGGGCGG - Intergenic
1174317520 20:49713907-49713929 AGCGGGCGCAGCGGCGGGGGCGG + Intergenic
1174386496 20:50190908-50190930 TGCTGCCGCCGCTGCCGGGGTGG - Exonic
1175091008 20:56504133-56504155 AGCAGGCGCCGCTGCCGGGGAGG - Intronic
1175428744 20:58888781-58888803 GGCGCGCGCCGCTGGGAGGGCGG + Intronic
1176073816 20:63239569-63239591 TGCGCACGCGGCTGCGGACGGGG - Exonic
1176159769 20:63642096-63642118 TGCGCGAGAAGGTGCGGGGGCGG - Exonic
1177157435 21:17513278-17513300 TGGGGGCGCTGCTGCAGGGGCGG + Intronic
1178707649 21:34888856-34888878 AGCGCGCGGCGCGGCGGCGGGGG - Intronic
1179563939 21:42234805-42234827 CGCGCGCGCAGGTGCGGGCGGGG + Intronic
1179710198 21:43208891-43208913 TGCCCCCGGCTCTGCGGGGGTGG + Intergenic
1180044772 21:45300202-45300224 GGCACGCGCTGCTCCGGGGGCGG + Intergenic
1180093067 21:45542459-45542481 CGGGCGCGCGGCTGCGGGGTGGG + Exonic
1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG + Intergenic
1181084090 22:20431361-20431383 GGCACGCGCCGCTCCGCGGGTGG + Exonic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1183744459 22:39685009-39685031 TGAGGGCTCCGCTGTGGGGGTGG + Intronic
1184996141 22:48209105-48209127 TGGGCGCCCAGCTGCAGGGGAGG + Intergenic
952942685 3:38455501-38455523 TCCCCACGCTGCTGCGGGGGTGG + Intronic
953705071 3:45225203-45225225 TGCGGGCACTGCGGCGGGGGTGG + Exonic
954469025 3:50675453-50675475 TGCGGGTGCGGGTGCGGGGGTGG + Intronic
960691366 3:120349415-120349437 TGCGCGCGCCGCTCCGGGGCGGG + Intergenic
961780174 3:129316437-129316459 GGGGCGCCCCGCTGCGGGCGCGG - Intergenic
963091493 3:141487256-141487278 TGGGCGCGAGGCTGAGGGGGCGG + Intronic
968090375 3:195895353-195895375 TGCCGGTGCCGCTGCGGGGCGGG - Exonic
969240376 4:5893114-5893136 GGCGCGCGCCGGGGCGGGGCCGG + Intergenic
970332789 4:15002874-15002896 TGCCCGCGCCGCCGCCGAGGGGG - Exonic
971257885 4:25030725-25030747 AGCGCGCGGCGCGGCGGTGGGGG - Exonic
975689422 4:76949638-76949660 TGCGCGCCCGGCCGCGGTGGTGG - Intergenic
976297332 4:83485193-83485215 TGCGCGCTCCGCAGAGGGGCGGG + Intronic
980027338 4:127782256-127782278 TGCGCGCTCGGCTGCCCGGGAGG - Exonic
984888642 4:184473243-184473265 GGCGCGGGCCGCGGCGGGGTGGG - Intronic
984999835 4:185471791-185471813 AGCGCGCGCCGCCGAGGGTGGGG - Intronic
985784468 5:1886712-1886734 TGCGCGGGCCGGCGCGGGGCGGG - Intronic
985964047 5:3326210-3326232 AGCGCCCGCCGCGGCGCGGGTGG - Intergenic
987340447 5:16935472-16935494 GGCGCGCGCCGGGGCGCGGGCGG - Intronic
989379338 5:40798183-40798205 TGCGCATGGCGCTGCGGGAGGGG + Exonic
989577350 5:43000616-43000638 TGCGAGGGAGGCTGCGGGGGCGG - Intergenic
990872584 5:60449051-60449073 TGCGCGGGCAGTTGGGGGGGTGG - Intronic
993502385 5:88678449-88678471 TGCGCGCTCGGCTGCCGGGCTGG - Intergenic
996091454 5:119355846-119355868 CGAGCGCGCGGCTCCGGGGGCGG + Intronic
996478695 5:123949406-123949428 TGAGCCAGCAGCTGCGGGGGTGG - Intergenic
997201337 5:132011704-132011726 TCCCCGCGCCGCTGCGGAGACGG + Intronic
997950968 5:138242216-138242238 CGCCCGCGCCGGTGCGGGGCTGG + Intergenic
998166670 5:139848281-139848303 CGCGCGCGCGGCCGCGGCGGCGG + Exonic
999128507 5:149264803-149264825 TGCGCGCCTGGCTGCAGGGGAGG + Intergenic
1002691372 5:181053005-181053027 GGCGCGCGCGGCGGAGGGGGCGG - Intronic
1002691382 5:181053029-181053051 AGCGCGCGCGGCGGAGGGGGCGG - Intronic
1003107465 6:3227463-3227485 TGGGCGCGCCGCAGCGGAGGGGG - Intronic
1003325240 6:5085713-5085735 AGCGCGCGCGGCAGCGGCGGCGG - Exonic
1003345265 6:5260913-5260935 GTCCCGCGCCGCTTCGGGGGCGG + Intronic
1004044580 6:12012111-12012133 GGCGCGCGCCGCGGCGGGGCGGG - Intronic
1004924470 6:20403703-20403725 GGCGGGCGCCGGTGGGGGGGTGG - Intronic
1007927806 6:45663790-45663812 GGCGCGCTTCGCTGCTGGGGAGG - Intronic
1015273254 6:131358631-131358653 TGCACCCGCCTCTGCTGGGGTGG + Intergenic
1016713995 6:147203734-147203756 AGCGCGGGCCGCGGCGGTGGCGG - Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1019110038 6:169702251-169702273 TGGGCGCCGCGCTACGGGGGAGG + Exonic
1019150192 6:170000496-170000518 TGCTTGCGCTGTTGCGGGGGGGG + Intergenic
1019828111 7:3300887-3300909 CGCCCGCACCGCTGCGGGGCCGG + Intergenic
1021600190 7:22356869-22356891 TGCCCGCGCTGCTGCGGAGCGGG - Exonic
1022410466 7:30135466-30135488 TGCGGGCTCCGCTGCCCGGGTGG + Intronic
1022722940 7:32957315-32957337 TGTGCGTGCCGCAGCGGGGAGGG - Intergenic
1026013453 7:66654498-66654520 TGCGCAGGCCGCGCCGGGGGCGG + Intronic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1028556784 7:92134122-92134144 GGCGCGCGCCGCAGCTGAGGCGG - Intronic
1028985557 7:97006128-97006150 TGCGAGTGCGGCTGCGGCGGCGG - Exonic
1029054948 7:97732268-97732290 TGGGGGCGCCGCTGCGGCGAGGG + Intronic
1032187990 7:129744088-129744110 TGCAAGCGCCGCAGCGGGGCTGG + Intronic
1034147060 7:148883588-148883610 GGCGCGGGCCGCTGCCGGGGTGG - Intronic
1034223064 7:149460376-149460398 TGGGCGCGCGGCTGTGCGGGCGG + Intronic
1034469881 7:151249394-151249416 TGCGCGCGCGCCTGCGTGTGTGG + Intronic
1034494288 7:151410547-151410569 GGTGCGAGCCGCTGCGGGGTCGG + Intronic
1037820320 8:22131925-22131947 TCCCGGCTCCGCTGCGGGGGTGG + Intronic
1038035365 8:23682481-23682503 CGCGCGCGTGGCTGCGGAGGCGG + Intronic
1038311437 8:26449144-26449166 TGCGGGGGCCGCTGCGGGTGCGG - Intronic
1042235968 8:66613369-66613391 AGCGCGCGCGGCTGAGGGCGGGG + Intronic
1043053279 8:75407535-75407557 TGCGCGCGCCGAGGCGGTGGCGG + Intergenic
1049411413 8:142475506-142475528 TGCACGCGGGACTGCGGGGGAGG + Exonic
1049470749 8:142774110-142774132 TGCGCATCCCGCTGCGGGGGAGG + Intronic
1049585495 8:143430782-143430804 GGCGCGCGCCCCTCCCGGGGAGG - Intergenic
1049850529 8:144827792-144827814 ACCTCGCGCCGCCGCGGGGGAGG - Intronic
1050472543 9:6008037-6008059 TGCGCGCGCCGCCGCCGGGGGGG - Intergenic
1051079604 9:13279326-13279348 TGCGCGCGCGCCGGCGGGGAAGG - Intronic
1051419018 9:16871616-16871638 TCCGCGCGCCGCTGGGGAGAAGG + Intergenic
1051566482 9:18504898-18504920 TGCTCACGCACCTGCGGGGGTGG + Exonic
1057294295 9:93826544-93826566 TGGACGCGCACCTGCGGGGGAGG + Intergenic
1057643781 9:96854184-96854206 GGCGCGAGCGGCGGCGGGGGTGG - Exonic
1058045400 9:100352586-100352608 TGCGGCCGGCACTGCGGGGGCGG - Intronic
1058110737 9:101028865-101028887 TGCGCGCGCCCGTGGGGCGGAGG - Exonic
1058467518 9:105244495-105244517 CGCGCGCGGCGCTGAGGAGGCGG + Intergenic
1059107669 9:111525400-111525422 TGCGCACTCCGCTGCGGGATGGG + Intronic
1060700489 9:125746596-125746618 CGCGCGCACCGCCCCGGGGGCGG + Intergenic
1061052166 9:128203383-128203405 TGGGCGCGCGGCTGCAGCGGCGG + Exonic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1062583871 9:137240419-137240441 AGGGCGCGCAGCTGCGGGGGAGG + Intergenic
1186768113 X:12791657-12791679 TGGGCACGCGGCTGCGGGGCCGG + Intronic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1190714805 X:53094240-53094262 TGCGCGCGCGGCAGGGGCGGCGG + Intergenic
1198005622 X:132489819-132489841 TCCGCGCGCCGCTGCGGGACGGG + Intronic
1199772398 X:150983441-150983463 TGCGGGCGCTGCGGCGGCGGCGG - Intronic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic