ID: 905076174

View in Genome Browser
Species Human (GRCh38)
Location 1:35272537-35272559
Sequence CTAGTACAGCAGAGGCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905076174 Original CRISPR CTAGTACAGCAGAGGCTCTA TGG Intronic
901098617 1:6702096-6702118 CTAGTACAGGAAAAGCCCTAGGG - Intergenic
905076174 1:35272537-35272559 CTAGTACAGCAGAGGCTCTATGG + Intronic
908046399 1:60174327-60174349 CAATTACATCAGAAGCTCTATGG + Intergenic
908798923 1:67858882-67858904 CTGGTTCAGCAGGGGCTCTCAGG - Intergenic
914827665 1:151146934-151146956 CTGGCACAGGAGAGGCTCTGGGG + Intergenic
921081837 1:211746128-211746150 CTAGTTCAGAAGAGTCTTTAAGG + Exonic
921716712 1:218424526-218424548 CTATTAAATCAGAGGCTCTGGGG + Intronic
923081976 1:230666343-230666365 CTAGAGCAGCAGAGTCTCCAGGG - Intronic
1071304982 10:84291605-84291627 CTAGGACAGCACTGGCTCTCTGG - Intergenic
1072673934 10:97451778-97451800 CTAGTACAGCGCTGGCGCTACGG + Exonic
1074211182 10:111336613-111336635 CTTGCACAACAGAGGCTCAAAGG - Intergenic
1074458904 10:113619351-113619373 CTAGTTCAGGAGAGGCCCTCTGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1077772232 11:5232610-5232632 CTGGCACTGCAGAGGTTCTAGGG - Intergenic
1078060127 11:8037945-8037967 CTAGCTCAGAAGTGGCTCTAGGG + Intronic
1085747856 11:79129876-79129898 CTACCACAGCTGAGGCTCTCTGG + Intronic
1087910953 11:103752836-103752858 CACTTACTGCAGAGGCTCTATGG - Intergenic
1088206451 11:107397659-107397681 CTACTACAGCTGATGCTCTCTGG + Intronic
1092967947 12:13663024-13663046 CTTCTACACCAGAAGCTCTAGGG - Intronic
1094501343 12:31023501-31023523 CTAGTACAGCTGATGCTTTCTGG + Intergenic
1098268832 12:68750615-68750637 CTGGAACAGCAGGGGCTCTCAGG - Intronic
1107147327 13:37072637-37072659 CTAGTATATTAGAGGCTCTCAGG - Intergenic
1113818522 13:113193473-113193495 CTAGTTCAGCAGAGGCAATCTGG - Intronic
1115866118 14:37748351-37748373 CTAGTACAGTAGCAGCCCTATGG + Intronic
1117092712 14:52267209-52267231 CTAGTAGAGAAGAGGAGCTAAGG + Intergenic
1117639869 14:57786408-57786430 CTACTACAGCTGATGCTCTCTGG + Intronic
1119685232 14:76625909-76625931 GTAGCACAGAAGAGGCTCCAAGG - Intergenic
1119749362 14:77066618-77066640 CTGGTTCAGCAGAGGCTGAAGGG - Intergenic
1121016188 14:90550774-90550796 CTGGTACAGAAGAGGCTCTTGGG + Intronic
1123014039 14:105365138-105365160 TTAGTCCAGCAGATGCTCTGTGG - Intronic
1125269370 15:37921467-37921489 CTACTACAGCTGATGCTCTCTGG - Intergenic
1125630559 15:41143649-41143671 CATGTACAGCATAGGCCCTATGG + Intergenic
1131359138 15:91773836-91773858 CTATTGCAGCAGAGTCTCCATGG - Intergenic
1133653825 16:7839765-7839787 CTAGTACAGCAGAGGCTGGAAGG - Intergenic
1137863435 16:51869619-51869641 TTAATACAGCAGAGGCTGGAGGG + Intergenic
1141620489 16:85234694-85234716 CTGGTCCAGCAGAGGGTCAAGGG - Intergenic
1143873162 17:9972110-9972132 CTAGTACAGTAGAAGCTTGAGGG + Intronic
1148552354 17:48558069-48558091 CTAGGACAGCAGAGGTTTTGAGG - Intronic
1148758305 17:49986141-49986163 CTAGTCCAGCAGAGCCACTGGGG - Intergenic
1149555427 17:57570245-57570267 CAAGTAAATCAGAGGCTCTGAGG + Intronic
1152015063 17:77745030-77745052 CTGCTACAGCAGAGCCTCTTTGG + Intergenic
1155136222 18:22995565-22995587 CTAGGACTGCAGAGGGTATATGG - Intronic
1159787121 18:72727349-72727371 CTACTACAGCTGATGCTCTCTGG + Intergenic
1163326753 19:16608754-16608776 GCAGTACAACAGAAGCTCTACGG + Intronic
925764091 2:7214295-7214317 CCAGGACAGCTGAGGCTCTGGGG - Intergenic
926370098 2:12170796-12170818 CAAGCACATCAGAGGCACTAAGG + Intergenic
926967695 2:18433227-18433249 CTGGAACAGCAGATCCTCTAAGG - Intergenic
927287562 2:21372358-21372380 TCAGTAGAGCAGAGGTTCTAAGG + Intergenic
928194222 2:29203079-29203101 CTAATACAACAGAAACTCTAGGG - Intronic
932180118 2:69639507-69639529 CTAGTCCAGCAGGGGCTGTTTGG - Intronic
937710106 2:124970791-124970813 CAATTACATCAGAGGCTCTGAGG + Intergenic
937905609 2:127051397-127051419 CTTGTCCAGCAGAGGCTCCCTGG - Intronic
937924001 2:127153959-127153981 CTATCCCAGCAGAGGCTCTGAGG + Intergenic
940233185 2:151481095-151481117 GTAGTATAGCAGAGTCTGTATGG + Exonic
941391178 2:164916818-164916840 GATGAACAGCAGAGGCTCTAAGG + Intronic
942895246 2:181045609-181045631 CTAATACATCAGAATCTCTAGGG + Intronic
1169318764 20:4613867-4613889 CTAGAACAGGTGAGGCTCTGCGG - Intergenic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1181003570 22:19999144-19999166 CCAGTACAGGAGGGGCTCCAGGG - Intronic
1181682502 22:24505585-24505607 ATGGTTCAGCAGAGGCTCTCTGG - Intronic
1185184034 22:49381903-49381925 CCAGTACAGCAGGGGCTTTCAGG - Intergenic
949476380 3:4450057-4450079 CTACTACACCAGTGGCTCTCAGG + Intronic
953393345 3:42547033-42547055 CTAGTGGAGGAGAGGCTCTAAGG - Intergenic
955878350 3:63518037-63518059 CAAGTACAGCAGTGGCCCCAGGG + Intronic
960478339 3:118158446-118158468 CCAGTTCAGCAGTGGCTATAAGG - Intergenic
963650238 3:147970218-147970240 CTACTACAGCATAAACTCTAAGG - Intergenic
963719205 3:148840595-148840617 CTACTAAAGCAGTGGCTCTGGGG + Intronic
964508718 3:157426252-157426274 CCAGTTCAACAGAAGCTCTAGGG + Intronic
968484193 4:850805-850827 GTGGTACAGCAGATGCTCCAGGG + Intronic
970365244 4:15351612-15351634 CTAGTACATCAGAATCTCTGGGG + Intronic
972961341 4:44456482-44456504 CTAGAACAGTTGAGGCTCTTTGG + Intergenic
973261895 4:48173561-48173583 CTACCACAGCAGAGGCTGTTGGG + Intronic
973703243 4:53556759-53556781 CTAACACAGCAGATGCTCTTTGG - Intronic
975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG + Intergenic
976708445 4:88042941-88042963 AGAGCAGAGCAGAGGCTCTAGGG + Intronic
978057529 4:104290959-104290981 GTTGTATACCAGAGGCTCTAAGG + Intergenic
978738613 4:112112697-112112719 CTAGAACAGCAGAGTTCCTATGG + Intergenic
979296770 4:119041843-119041865 CTAGTAAATCAGAATCTCTAAGG - Intronic
980878420 4:138685596-138685618 TTAGTGCAGCAGATGCTCTCTGG + Intergenic
982365616 4:154574880-154574902 TTATTACATCAGAGACTCTAAGG + Intergenic
984191621 4:176612921-176612943 CTATTACGGCAGAGCCTCTGAGG + Intergenic
986006332 5:3672083-3672105 CTTGTACTCCAGAGGCTGTAGGG + Intergenic
988902263 5:35745812-35745834 CTACTACAGCTGATGCTCTCTGG + Intronic
990536044 5:56723680-56723702 CTAGAACACCACAGGGTCTAAGG - Intergenic
991260616 5:64663697-64663719 GTAGTACAGCAGAATCTCTAAGG + Intergenic
991446447 5:66705058-66705080 CTAGGTCAGCAGAGGAACTATGG - Intronic
992316276 5:75558993-75559015 CTATTTCATCAGAGGCTCTCTGG + Intronic
994222147 5:97208514-97208536 CTACCACAGCTGAGGCTCTCTGG - Intergenic
995817842 5:116191782-116191804 CTACTACAGCTGATGCTCTCTGG + Intronic
996032858 5:118725881-118725903 CTAGTGCAGTAGAGGGTCAAGGG + Intergenic
999823876 5:155255784-155255806 CTACTGCATCAGAGGCTCTGGGG + Intergenic
1000246231 5:159450683-159450705 CTAGAACAGCAGAGGATCCTTGG - Intergenic
1000886526 5:166754017-166754039 GTAGTACAGCAGAGACTACATGG - Intergenic
1002530120 5:179839351-179839373 GCAGTACAGAAGAGGCTCTGCGG + Intronic
1005013379 6:21356708-21356730 CAAGTACAGAAGTGGCTCCAGGG + Intergenic
1005191394 6:23228323-23228345 CTACTACAGCTGAGGGTCTCTGG - Intergenic
1007933713 6:45714948-45714970 CTAGGGCAGCAGAGGCTGTAAGG - Intergenic
1008385307 6:50882554-50882576 ATCCTACAGAAGAGGCTCTAAGG - Intergenic
1015663275 6:135600242-135600264 CTACTACAGCTGATGCTCTCTGG - Intergenic
1015849754 6:137559963-137559985 CTAGCACAGCTGATGCTCTCTGG - Intergenic
1019514248 7:1432803-1432825 CTAACACAGCAGAGGCCCTGGGG + Intronic
1021262857 7:18480472-18480494 CTGGCACAGCAGTTGCTCTATGG - Intronic
1022124725 7:27344646-27344668 GTAGACCTGCAGAGGCTCTAAGG + Intergenic
1022467040 7:30658977-30658999 CTAGCAGAGCAGAGGCTCAAAGG - Intronic
1022673979 7:32481092-32481114 TTAGTACAGCAGAGACTCAAGGG + Intergenic
1023236145 7:38090359-38090381 CTACTAAAACATAGGCTCTATGG + Intergenic
1024102471 7:46046650-46046672 CTAGTACAGCAGTGGCTCAGAGG + Intergenic
1024545523 7:50513964-50513986 CTACTACAGCTGATGCTCTCTGG + Intronic
1024669254 7:51577321-51577343 CTACTACAGCTGATGCTCTCTGG - Intergenic
1030761341 7:113356181-113356203 CTAGTCTAGCAGTTGCTCTAGGG - Intergenic
1032904036 7:136343697-136343719 CTAGTAAATCAGAGGCTCTGGGG + Intergenic
1034374031 7:150627703-150627725 CAAGTCCAGCACAGGCTCAAAGG + Exonic
1035795636 8:2354149-2354171 CTGGGACAGCAGAGGCTAGATGG + Intergenic
1039824902 8:41164599-41164621 TGAGTACAGCAGAGGCTGGATGG + Intergenic
1040780747 8:51106689-51106711 GTGGTACACCAGGGGCTCTATGG - Intergenic
1042680608 8:71379329-71379351 CCAGCACAGCACAGGCACTAAGG + Intergenic
1043190399 8:77214151-77214173 TTAGAACAGCAGACGCTTTATGG - Intergenic
1045254256 8:100506405-100506427 CAGGTAGAGCAGAGGCTCTCAGG - Intergenic
1046255027 8:111685248-111685270 GGAGTCCTGCAGAGGCTCTATGG - Intergenic
1047060986 8:121225659-121225681 CTAGCAAAGCAGAGGCTTCATGG - Intergenic
1051362716 9:16295056-16295078 CTACTACAGCTGATGCTCTCTGG + Intergenic
1055311352 9:74984994-74985016 GTGGTACAGCAGAGGACCTATGG + Exonic
1055346948 9:75349869-75349891 CTACTACAGTTGAGGCTCTCTGG - Intergenic
1056790949 9:89624974-89624996 CTCCTCCAGCAGAGGCACTAGGG - Intergenic
1057524408 9:95786029-95786051 CTGGTGTAGCAGAGGCTCCAAGG - Intergenic
1057759947 9:97863877-97863899 AGAGTACAGCAGAGGCTTCAAGG - Intergenic
1059550755 9:115226480-115226502 ATGGTAGACCAGAGGCTCTAAGG + Intronic
1059609569 9:115878154-115878176 CTACTACAGCTGATGCTCTCTGG - Intergenic
1186366930 X:8905304-8905326 CTAGAACAGCAGATGTCCTAAGG + Intergenic
1194701458 X:97119553-97119575 CTACCACAGCTGATGCTCTATGG - Intronic
1196590455 X:117481342-117481364 CTACTACAGCTGATGCTCTCTGG - Intergenic
1197259650 X:124304641-124304663 CCAGATCAGCAGTGGCTCTAAGG - Intronic
1197839083 X:130726292-130726314 CTTGTAAAGCAGAGGCTCCATGG + Intronic
1199668564 X:150121427-150121449 CTAGCACAGCTGATGCTCTCTGG + Intergenic
1200001992 X:153066885-153066907 GTACTACAGCAGGTGCTCTACGG + Intergenic
1200005740 X:153083140-153083162 GTACTACAGCAGGTGCTCTACGG - Intergenic