ID: 905079946

View in Genome Browser
Species Human (GRCh38)
Location 1:35309671-35309693
Sequence TGCGATCTCAAAATACTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905079945_905079946 0 Left 905079945 1:35309648-35309670 CCTTTGTAATTACACTTTATATT 0: 1
1: 0
2: 8
3: 55
4: 540
Right 905079946 1:35309671-35309693 TGCGATCTCAAAATACTTTATGG 0: 1
1: 0
2: 0
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905079946 Original CRISPR TGCGATCTCAAAATACTTTA TGG Intronic
901468976 1:9442407-9442429 TTCGGTCTTAAAATACTTGATGG - Intergenic
902128824 1:14240712-14240734 TGGGATCTCAAAATTCTTTCTGG + Intergenic
905079946 1:35309671-35309693 TGCGATCTCAAAATACTTTATGG + Intronic
907528864 1:55072669-55072691 TGAAATCTGAAAACACTTTAAGG + Intronic
908152582 1:61318462-61318484 TGTGATCTCAATTCACTTTAAGG - Intronic
909324125 1:74327824-74327846 AGCTATCTTAATATACTTTAAGG - Intronic
909662847 1:78103395-78103417 TTCATCCTCAAAATACTTTATGG - Intronic
909989282 1:82202617-82202639 TGCAGTCTGAAAATCCTTTAAGG - Intergenic
911036228 1:93551775-93551797 TGAGACCTCAAAATATTTTGAGG + Intronic
911275817 1:95855790-95855812 TACGATCCCACAATACTTCAAGG - Intergenic
915999108 1:160597464-160597486 TGCCATGTGAAAAAACTTTATGG + Intergenic
916772433 1:167924795-167924817 TGCCATATAAAAATATTTTAGGG + Intronic
918699134 1:187585101-187585123 AGCAATATTAAAATACTTTAAGG + Intergenic
918956236 1:191211418-191211440 TGTGTTCTTAAAATACTTTCAGG - Intergenic
922524554 1:226290042-226290064 TGGGATTTTAAAATATTTTAAGG - Intronic
923388343 1:233488417-233488439 TGAGGTCTCAAAATAGCTTAGGG - Intergenic
923881980 1:238113564-238113586 TGAAAGCTCCAAATACTTTAAGG - Intergenic
1063330353 10:5152521-5152543 TGCAATTTAAAAATACTTCAAGG + Intergenic
1066706163 10:38180872-38180894 TGAGATCCCAAAAGACTTTAAGG - Intergenic
1066784246 10:38985277-38985299 TGAGATTCCAAAAGACTTTAAGG - Intergenic
1066983800 10:42445194-42445216 TGAGATCCCAAAAGACTTCAAGG + Intergenic
1067445806 10:46344148-46344170 TGAGATCCCAAAAGACTTTAAGG - Intergenic
1067591573 10:47516594-47516616 TGAGATCCCAAAAGACTTTAAGG + Intronic
1067638688 10:48024669-48024691 TGAGATCCCAAAAGACTTTAAGG + Intergenic
1067874793 10:49995636-49995658 TGAGATCCCAAAAGACTTTAAGG - Intronic
1068402508 10:56548685-56548707 TGTGATCTCAAACTTTTTTATGG + Intergenic
1070135672 10:73690818-73690840 TGAGATCCCAAAAGACTTTAAGG + Intronic
1071020026 10:81042337-81042359 TTCCATTTCAAAATACTTTGTGG + Intergenic
1071771522 10:88734228-88734250 TGGAATCACAAAATACTTTTTGG + Intronic
1076372816 10:129965779-129965801 TCCCATCTCAAAATCCATTACGG + Intergenic
1079676366 11:23231888-23231910 AGCCATCTTAAAATATTTTAGGG - Intergenic
1080147170 11:29000319-29000341 TGGGAACTGAAAATACTGTAAGG + Intergenic
1080229895 11:30008301-30008323 TTATATCTCAAAATAATTTAAGG - Intergenic
1084344799 11:68539636-68539658 TGGGATCTGAAAGTGCTTTAGGG + Intronic
1087207112 11:95408577-95408599 TGGGATCTCACAATTCTTTGAGG - Intergenic
1090515122 11:127416776-127416798 TGCGATCTCCAATTAAGTTAAGG - Intergenic
1092568368 12:9694109-9694131 TGGCCTCTCAAAATATTTTAAGG + Intronic
1092750181 12:11711651-11711673 TGACATCTGAAAATGCTTTAAGG - Intronic
1099035377 12:77580563-77580585 TGTTAAATCAAAATACTTTATGG + Intergenic
1099126812 12:78770042-78770064 TGTAATCTCAAAAAATTTTAAGG + Intergenic
1099631903 12:85160231-85160253 TGTTATCTGAAAATACATTAGGG + Intronic
1100268017 12:92996955-92996977 TGTAATCCCAAAATACTTTGTGG - Intergenic
1100527853 12:95436876-95436898 TGATATTTCAAAGTACTTTATGG + Intergenic
1100729288 12:97446247-97446269 TGCAAACTCAAAACACTTCATGG - Intergenic
1110255560 13:73430065-73430087 TGAGATCCCAAACTACATTACGG + Intergenic
1112974679 13:105303109-105303131 TGTGATCTCTAAATATTGTATGG - Intergenic
1112988816 13:105485856-105485878 TGCTCTCTCTAAAGACTTTAGGG - Intronic
1115353530 14:32422878-32422900 ATCAATTTCAAAATACTTTAAGG + Intronic
1115950021 14:38710444-38710466 TGAGATGTGAAAATAGTTTATGG + Intergenic
1117024339 14:51604981-51605003 TGTGATCTCAAGATACATGAGGG + Intronic
1131197972 15:90372150-90372172 GGAGATCTGGAAATACTTTATGG - Intergenic
1135034591 16:19066557-19066579 TTCCATCTTAAAATATTTTATGG + Intergenic
1149862309 17:60128866-60128888 TGCTATTTCAAAATATTTAAAGG - Intergenic
1159462092 18:68734881-68734903 TCAGACCACAAAATACTTTAGGG + Intronic
1167500846 19:49846772-49846794 TGCAATTACAAAATAGTTTATGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927448625 2:23187473-23187495 TGCTTTCTCAAGACACTTTATGG + Intergenic
927551531 2:24004824-24004846 ATTGCTCTCAAAATACTTTAAGG - Exonic
928210340 2:29319258-29319280 TGTGAGCTCACAACACTTTAGGG + Intronic
928543502 2:32307487-32307509 TGCTATTTTAAAATACTTTTTGG - Exonic
930996425 2:57724343-57724365 TGACATCTCAAAATACATCATGG - Intergenic
933624848 2:84586658-84586680 TTAAATCTCAAAACACTTTAGGG + Intronic
935660681 2:105464282-105464304 TGCCACCTCAAAATATTTTTCGG + Intergenic
935902969 2:107812223-107812245 TTCAATCTCAAAATACTTACTGG + Intergenic
938647014 2:133342203-133342225 TGGGATCTAAACATTCTTTAGGG + Intronic
939103792 2:137926061-137926083 TGGTATCCCAAAATACATTAAGG + Intergenic
940364545 2:152833365-152833387 TGCTATAACAAAATACTGTAAGG + Intergenic
942373769 2:175314459-175314481 TGCTATCTCAAAATGCTTTGAGG + Intergenic
942413042 2:175731594-175731616 TGTGAATTCAAAATACTCTATGG + Intergenic
943217472 2:185057314-185057336 TTAGAGCTCAAAATATTTTAAGG + Intergenic
948636621 2:239342115-239342137 TGCTATCATAAAATACCTTAGGG - Intronic
1169629811 20:7618075-7618097 TGACATCACAAGATACTTTAGGG - Intergenic
1177032139 21:15993829-15993851 TGCAATTTGAAAATACTTTTTGG + Intergenic
1177210399 21:18063739-18063761 TACTATTTAAAAATACTTTAAGG + Intronic
1178220550 21:30653092-30653114 TGAAATCTCAAAATAATTTATGG - Intergenic
950997851 3:17523452-17523474 AGGGGTCTCAAAAGACTTTATGG + Intronic
953153865 3:40351029-40351051 TGAGATCTCAAGATATTTTGGGG - Intergenic
955665865 3:61348635-61348657 AGCACACTCAAAATACTTTAAGG + Intergenic
955861380 3:63334077-63334099 TGTGAGCCAAAAATACTTTATGG - Intronic
956043144 3:65167935-65167957 ACAGATCTCAAAATTCTTTAGGG + Intergenic
962040065 3:131697768-131697790 TGTGATCACAAAATACTTAAGGG - Intronic
963416978 3:145009230-145009252 TGCTTTCTCAAAATACTTTTAGG + Intergenic
964736312 3:159922283-159922305 TACGAACTCAAAATATTTTCAGG + Intergenic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
971747046 4:30595560-30595582 TGCAAACTCAAAATACTTCATGG - Intergenic
972173087 4:36371035-36371057 TGTGTTCTCAAAATAATTTCTGG - Intergenic
973226997 4:47797307-47797329 TTCAATCTCAAAGTACTCTATGG + Intronic
974873777 4:67676749-67676771 TCCGAGCTCAAAATAATGTAAGG - Intronic
977431368 4:96934223-96934245 TGTGATTTCAAAATACTTAAAGG - Intergenic
980629157 4:135410923-135410945 TGCCATCCCAAGACACTTTAGGG + Intergenic
981401373 4:144317618-144317640 AGAGATCTCAAAAAACTTTCTGG + Intergenic
982457690 4:155629567-155629589 TGAGATCTCAAAATAGATTTAGG - Intergenic
982473764 4:155825656-155825678 TGATATTTCAAAATTCTTTATGG + Intergenic
982602762 4:157472274-157472296 TACGTTCTCTAAATGCTTTAAGG + Intergenic
983066995 4:163222815-163222837 AGCGATCGGAGAATACTTTAAGG + Intergenic
983087001 4:163458668-163458690 GGCTATCTCAAAATATTTTCAGG + Intergenic
983538071 4:168878531-168878553 TGCGATGTAAAAATTCTTAACGG + Intronic
984080373 4:175241511-175241533 TGACATCTGAAAATACTTTGAGG + Intergenic
985127563 4:186710273-186710295 TGCATTCTCACAATACTGTAGGG - Intronic
989028526 5:37092693-37092715 TGCCACCTCAAGACACTTTATGG + Intergenic
989240478 5:39197448-39197470 TCCAATCTCAAAAAATTTTAGGG + Intronic
989710722 5:44393632-44393654 TGAAATATCACAATACTTTATGG - Intergenic
991322879 5:65395352-65395374 TGCTATTTCAAAGTCCTTTAAGG + Intronic
995365471 5:111355134-111355156 TGAGATCTCAGAACACATTAAGG + Intronic
996253297 5:121365954-121365976 GCCAATCTTAAAATACTTTAGGG - Intergenic
997125303 5:131220650-131220672 TGCGATCACAAAATAAATCAAGG + Intergenic
1000302631 5:159970086-159970108 TGAGATCCCAAAACATTTTATGG - Intronic
1000393284 5:160747383-160747405 TGCGACCTCAACATATTTTTTGG - Intronic
1006064225 6:31450910-31450932 TGTGTTCTCACAATACTTCATGG + Intergenic
1007682370 6:43643415-43643437 TGTTATCTCAAAACAATTTATGG - Intergenic
1009348183 6:62643369-62643391 TACATTTTCAAAATACTTTAAGG - Intergenic
1010551969 6:77234641-77234663 TGCCATAACAAAATACTTAAGGG - Intergenic
1011979835 6:93359721-93359743 TGGGAGCTCAAAATAATTTAGGG + Intronic
1012764511 6:103349176-103349198 TGCTAACTCATAATACTTGAGGG + Intergenic
1015176042 6:130310431-130310453 TGCCTTCTAAAAATACTTTTTGG + Intronic
1016020554 6:139232541-139232563 TGGGATTTCTGAATACTTTATGG + Intergenic
1016279850 6:142404120-142404142 TGAGCTCCCACAATACTTTATGG - Intronic
1018378663 6:163237305-163237327 TGCAATCCCAATATATTTTATGG - Intronic
1025748177 7:64265424-64265446 TTTGATCTCAAAAGACTTAAAGG + Intronic
1028783549 7:94765743-94765765 TGCGATATAAAAATAATTTATGG + Intergenic
1029942695 7:104496922-104496944 TGACATCTAAAAATACTTTGGGG - Intronic
1030448122 7:109673074-109673096 GGCCATCTTAAAATACTTCATGG + Intergenic
1031234292 7:119153035-119153057 GGCGAGCTTAAACTACTTTAAGG + Intergenic
1032280525 7:130496918-130496940 TGCTATGTGAAAATACTTGAAGG - Intronic
1034091429 7:148367738-148367760 TGAGAGCTTAAAATATTTTATGG - Intronic
1037861852 8:22411047-22411069 TGCCATCTCAAAATTCTGCATGG + Intronic
1040604980 8:48922529-48922551 TTCAATCTAAAAATACTTTCAGG + Intergenic
1042361107 8:67884279-67884301 TAGGATCACAAAATACTTCAAGG + Intergenic
1043316553 8:78929443-78929465 TGCTCTTTTAAAATACTTTATGG + Intergenic
1045539775 8:103072723-103072745 TCAGATCTAAAAATACTCTAAGG - Exonic
1046189222 8:110767998-110768020 TGAGATCTAAAAATATTCTATGG + Intergenic
1050467652 9:5947010-5947032 AGAGATCTCAAAATGTTTTAGGG - Intronic
1051191739 9:14519924-14519946 TGGGATGTAAAAATACTTTTTGG - Intergenic
1056972019 9:91213209-91213231 AGCTATCTCAAATTACTTAAAGG + Intergenic
1059730183 9:117049405-117049427 TGCAATGTCTTAATACTTTAGGG - Intronic
1060461581 9:123860161-123860183 TCTGGTCTCTAAATACTTTAGGG + Intronic
1186395160 X:9200876-9200898 ATTGCTCTCAAAATACTTTAAGG - Intergenic
1190462308 X:50690071-50690093 GGACATCTAAAAATACTTTAGGG - Intronic
1196464276 X:115957428-115957450 TGTGATCTCATAAATCTTTATGG - Intergenic
1201865708 Y:18651733-18651755 TGCCATCTGAAAACATTTTATGG + Intergenic