ID: 905081892

View in Genome Browser
Species Human (GRCh38)
Location 1:35330101-35330123
Sequence GCTGCTTGGGAGATTGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114471
Summary {0: 1, 1: 7, 2: 428, 3: 9807, 4: 104228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905081892 Original CRISPR GCTGCTTGGGAGATTGAGTC AGG Intronic
Too many off-targets to display for this crispr