ID: 905085800

View in Genome Browser
Species Human (GRCh38)
Location 1:35375299-35375321
Sequence TAATCACCGTGTAAATAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905085800_905085803 27 Left 905085800 1:35375299-35375321 CCCTCTTATTTACACGGTGATTA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 905085803 1:35375349-35375371 TGATTGTAAAATTGATGAGTTGG 0: 1
1: 0
2: 2
3: 37
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905085800 Original CRISPR TAATCACCGTGTAAATAAGA GGG (reversed) Intronic
902855229 1:19198349-19198371 TAATAACCGTGGACAGAAGAAGG + Intronic
905085800 1:35375299-35375321 TAATCACCGTGTAAATAAGAGGG - Intronic
905522079 1:38608174-38608196 TAATCCCCATGTAAATGAAAAGG + Intergenic
906013143 1:42548423-42548445 CAATCACTGTCTAAATAAAATGG - Intronic
908882888 1:68752719-68752741 TAATCACTCTGGAAATAAGAAGG - Intergenic
909281354 1:73758244-73758266 AAATCACCTTGCAAATAAGTAGG - Intergenic
911098103 1:94072188-94072210 TAATCACCATGTAGACAATAAGG + Intronic
912131886 1:106613599-106613621 TCATTGCCGTGTAAATGAGAAGG - Intergenic
920629183 1:207635084-207635106 TAATGACCGTGTAATTTATATGG + Intronic
1065206689 10:23363808-23363830 TAATCACGGTCTAAACAGGATGG + Intergenic
1065421164 10:25546004-25546026 TAAATAACGTGCAAATAAGATGG + Intronic
1072418697 10:95271131-95271153 TAAGCACCGTGAAAATCAGAGGG + Intronic
1073949395 10:108788897-108788919 TAATAACCGTGTTCATAAGAAGG + Intergenic
1078116528 11:8457911-8457933 TAATCTCAGTGTTAATAACATGG + Intronic
1079577834 11:22025407-22025429 TAATCACAGTGTAAACAATGTGG + Intergenic
1085883400 11:80495492-80495514 TAATGAAACTGTAAATAAGAAGG + Intergenic
1086430913 11:86736122-86736144 TAATCCCAGTGTAAATAAATTGG - Intergenic
1090248119 11:125231444-125231466 TATTCATCGTGAAAATAAAATGG - Intronic
1096923531 12:55116111-55116133 TAATCTCTTTGTCAATAAGATGG + Intergenic
1099867953 12:88307938-88307960 TAATCATGGTGGAAATAAAAGGG + Intergenic
1107177864 13:37420749-37420771 TATTCACCTTGTAAAAAGGAAGG + Intergenic
1108623115 13:52203159-52203181 CAATCCCATTGTAAATAAGAGGG + Intergenic
1108663612 13:52607882-52607904 CAATCCCATTGTAAATAAGAGGG - Intergenic
1111196614 13:84882774-84882796 TAATCAACGTGAAAATGACAAGG + Intergenic
1113344579 13:109464387-109464409 TAATCACAGTGTAGATTGGAAGG - Intergenic
1125867187 15:43063482-43063504 TATTAACCTTGTACATAAGACGG + Intronic
1127865669 15:63030615-63030637 TAATCACAGTGTAGATTTGAGGG + Intergenic
1129993655 15:79986225-79986247 TAACCACTATGTAAACAAGAAGG + Intergenic
1139227286 16:65244997-65245019 TGATCACAGGGTAAATACGAAGG - Intergenic
1140793144 16:78411356-78411378 TAATCAACGTGTTGATTAGAGGG + Intronic
1149228787 17:54507533-54507555 TAATAAACGTATAAATAAGAAGG - Intergenic
1155206376 18:23561700-23561722 TTATCACCCTGCAAATAATATGG + Intronic
1155398604 18:25414512-25414534 TTGTCTCCATGTAAATAAGAAGG + Intergenic
1157821838 18:50776984-50777006 TAACCACCCTTTAACTAAGAAGG + Intergenic
925587741 2:5479970-5479992 TAATAAACAAGTAAATAAGAGGG + Intergenic
935787242 2:106560340-106560362 TAATCACCTGGGAAAAAAGAGGG - Intergenic
936000685 2:108826551-108826573 TAAATACAGTGTAAATAAGAGGG + Intronic
941473316 2:165917615-165917637 TAATCAGAGGGTTAATAAGAGGG - Intronic
943947130 2:194081372-194081394 AAATCATCCTGGAAATAAGATGG + Intergenic
943971423 2:194412480-194412502 TAATCCCACTGTAAAGAAGAGGG + Intergenic
944442868 2:199760487-199760509 TTAACACCTTGTATATAAGAGGG + Intergenic
945578837 2:211566637-211566659 TATTCACAGTGTAAACCAGAGGG + Intronic
945880507 2:215320468-215320490 TAATCACAGTGGAAAGCAGAGGG + Intronic
1169610725 20:7377508-7377530 TAATCCTCTTGCAAATAAGAGGG - Intergenic
1177926562 21:27223180-27223202 TAATGACTGTGAAAATAACAGGG - Intergenic
1185062729 22:48615571-48615593 GAATCACCTTGTAAATAGAAAGG - Intronic
950866166 3:16190836-16190858 AAATCACCGTGGAAATAATCTGG - Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
955868113 3:63407273-63407295 TAAGCACTGTGTTAATAACAGGG - Intronic
957232287 3:77535955-77535977 TACTCACACTGTAAATAAGGTGG - Intronic
963571413 3:147001606-147001628 TAAAAACCATGTATATAAGATGG + Intergenic
966555416 3:181254066-181254088 AAATCCCCTTGTGAATAAGATGG - Intergenic
968869351 4:3233728-3233750 GAATCACAGTGGAAACAAGAGGG - Intronic
972580972 4:40395393-40395415 TGATCACAGAGTAAGTAAGAAGG + Intergenic
976504129 4:85826599-85826621 TACTCACTGGGGAAATAAGAGGG + Intronic
979879589 4:125938724-125938746 TAATGACTGTGGAAATAAGATGG + Intergenic
980319908 4:131257678-131257700 TAAACAATGTGTAAATATGAGGG - Intergenic
980455040 4:133028500-133028522 TGATCACCGTGTATTGAAGATGG - Intergenic
980598712 4:134990372-134990394 TAATCAAAGTGGAAATAAAAAGG - Intergenic
981000755 4:139826374-139826396 TAATCCCCAAGTTAATAAGAAGG - Intronic
985037761 4:185858293-185858315 TTCTCACCATGTAAAGAAGAAGG + Intronic
988572159 5:32378631-32378653 TAATCTGCCTTTAAATAAGAAGG + Intronic
988879720 5:35488061-35488083 TAAGCACAGTGAAAAAAAGAGGG + Intergenic
992429392 5:76693047-76693069 TAGTCTCCGTCTAAAAAAGAAGG + Intronic
994829792 5:104765473-104765495 TAATGACTGTGGAAATAAGTGGG + Intergenic
995668924 5:114577916-114577938 TAATCAATGTGTAAATACAAAGG - Intergenic
1002014871 5:176312942-176312964 TTATCCCCGTGTAAACTAGAAGG + Intronic
1003535343 6:6971105-6971127 TAATAACGGTGTGAATCAGAGGG - Intergenic
1007004074 6:38343447-38343469 TACACATCTTGTAAATAAGAAGG + Intronic
1011444239 6:87420598-87420620 TCTTCACCATGTAAATAAGGCGG + Intronic
1014782012 6:125575362-125575384 AAATTACCTTGTAAATTAGAAGG + Intergenic
1028549316 7:92040235-92040257 TAACCACTGTGTAAATTAAATGG + Intronic
1028619859 7:92813247-92813269 AAATAACCGTGAAAAGAAGATGG + Intronic
1030925648 7:115450604-115450626 TAATGATTGTGAAAATAAGAAGG - Intergenic
1031753059 7:125602287-125602309 TAATCACGATATAAATTAGAGGG + Intergenic
1032812552 7:135435879-135435901 TAATCACTGTTTTAATTAGAGGG + Intronic
1040873349 8:52124001-52124023 TAATCACCGTGTGAATCACGTGG - Intronic
1041189440 8:55338556-55338578 GAAACAATGTGTAAATAAGAGGG - Intronic
1047614616 8:126554005-126554027 TAACCACCGTGTAGACAAGTGGG - Exonic
1052153129 9:25144757-25144779 AAATCACTATGTAAATAAGTGGG + Intergenic
1052655568 9:31354345-31354367 TAATCACCATATAATTAAGTTGG - Intergenic
1055449637 9:76419207-76419229 CAATAATCATGTAAATAAGATGG - Intergenic
1189648903 X:43167047-43167069 TAATCACTGTGTAAACATCATGG + Intergenic
1190649053 X:52551196-52551218 TGCTCACAGTGTAAATAAGGAGG + Intergenic
1192081743 X:68054335-68054357 TAAACACTTTTTAAATAAGATGG + Intronic
1192329978 X:70167469-70167491 TAACCACCCTATAAACAAGAGGG - Intergenic
1194368398 X:93037985-93038007 TAATTAACTGGTAAATAAGAAGG - Intergenic
1200676602 Y:6154262-6154284 TAATTAACTGGTAAATAAGAAGG - Intergenic
1201425102 Y:13841423-13841445 AATTCACTGTGCAAATAAGAAGG - Intergenic