ID: 905091759

View in Genome Browser
Species Human (GRCh38)
Location 1:35435935-35435957
Sequence GCTGAGGGGGTGCCACCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905091759_905091766 -6 Left 905091759 1:35435935-35435957 CCAACAGGTGGCACCCCCTCAGC 0: 1
1: 0
2: 1
3: 20
4: 225
Right 905091766 1:35435952-35435974 CTCAGCAGTGTTCTGGGTCCTGG 0: 1
1: 0
2: 3
3: 35
4: 283
905091759_905091768 11 Left 905091759 1:35435935-35435957 CCAACAGGTGGCACCCCCTCAGC 0: 1
1: 0
2: 1
3: 20
4: 225
Right 905091768 1:35435969-35435991 TCCTGGGAATGCCCACGCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
905091759_905091767 -5 Left 905091759 1:35435935-35435957 CCAACAGGTGGCACCCCCTCAGC 0: 1
1: 0
2: 1
3: 20
4: 225
Right 905091767 1:35435953-35435975 TCAGCAGTGTTCTGGGTCCTGGG 0: 1
1: 0
2: 6
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905091759 Original CRISPR GCTGAGGGGGTGCCACCTGT TGG (reversed) Intronic
900018611 1:171459-171481 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
900048869 1:530054-530076 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
900071099 1:771878-771900 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
900179651 1:1305608-1305630 GCTGAGGGGCTCCCAGCAGTGGG - Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900594051 1:3472430-3472452 GCCGGGGGGGGGCCAGCTGTGGG - Intronic
900618561 1:3576619-3576641 GCTGAGGGGGTGCTGCCTGCAGG - Intronic
901146303 1:7067098-7067120 GGTAAGGGGGTGCCCCGTGTGGG - Intronic
902163466 1:14551124-14551146 GCTGAGGGGTTGCGATCTATGGG - Intergenic
903228454 1:21907108-21907130 TCTCAGGGGGTGACTCCTGTCGG + Intronic
903653362 1:24934236-24934258 GTTGAGGGGTTGTCTCCTGTAGG + Intronic
905091759 1:35435935-35435957 GCTGAGGGGGTGCCACCTGTTGG - Intronic
905259773 1:36709108-36709130 GCTGAGGGGGCGCTACCTAGAGG + Intergenic
906148870 1:43576204-43576226 GCTGATGGGGTCCCTTCTGTGGG - Intronic
906380274 1:45327956-45327978 ACTGAGGGGGTGGCAACTGCTGG + Exonic
915194642 1:154180408-154180430 ACTGAGGAGGAGACACCTGTGGG - Intronic
915441020 1:155945551-155945573 GCTGTGAGGGTGGCACCTTTAGG - Intergenic
915460147 1:156065621-156065643 GGTGAGGGAGTGACATCTGTGGG - Intronic
918164044 1:181927348-181927370 TCTGAGGGGTTGCAACCTGCAGG - Intergenic
922106460 1:222517327-222517349 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
922706973 1:227795210-227795232 GCTGGGGGGGCGGCTCCTGTGGG - Intergenic
922800272 1:228361903-228361925 GCTGAGGGGGAGCTGCCAGTGGG + Intronic
923515917 1:234697995-234698017 GCTGAGTGGGTGCCGCTTGCAGG - Intergenic
924348645 1:243094893-243094915 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
1064199847 10:13275045-13275067 GCTGAGCAGGGGCCACCTGTGGG + Intergenic
1066727715 10:38410008-38410030 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
1070668668 10:78362992-78363014 GCTGAGTGGGTCCCTCCTGTGGG - Intergenic
1073186024 10:101615481-101615503 GCTGAGGAGGGGCAACCTGGGGG + Intronic
1073262442 10:102200913-102200935 GAGCAGGGGGTGGCACCTGTCGG + Intergenic
1074211357 10:111338253-111338275 TCTGAGGAGATGACACCTGTAGG - Intergenic
1075446342 10:122516075-122516097 GCTGAGGTGCTGCCACAGGTGGG + Intergenic
1076487668 10:130835252-130835274 GCTGGTGGGGTGCACCCTGTGGG - Intergenic
1076736770 10:132462500-132462522 GCTGAGGCTGCGCCTCCTGTGGG - Intergenic
1076830629 10:132992563-132992585 GCTGAGGGGGTGGCAGCCCTGGG - Intergenic
1076975216 11:166655-166677 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
1077571303 11:3340497-3340519 ACTCTGGAGGTGCCACCTGTGGG + Intronic
1078187161 11:9061831-9061853 GCAGAGGGGGTGCCAACAGCTGG + Intronic
1081621486 11:44621590-44621612 GCTGAGGAGGTGTCAGCGGTGGG + Intergenic
1083050741 11:59774339-59774361 GCTCAGGTGATCCCACCTGTGGG - Intronic
1083171422 11:60925666-60925688 GCTGAGAGGGAGCTAGCTGTGGG + Intronic
1083593437 11:63908158-63908180 TCTGGGGAGGTGCCACCAGTGGG - Intronic
1083763556 11:64831706-64831728 GCTGGGAGGTTGTCACCTGTGGG + Exonic
1091444518 12:535885-535907 CCTGAGGGGCTCCCACTTGTTGG + Intronic
1095409553 12:41907317-41907339 CCTGAGGGAATGCCACGTGTTGG - Intergenic
1096008235 12:48189684-48189706 GCTGTAATGGTGCCACCTGTCGG + Intergenic
1097196855 12:57247284-57247306 GCTGAGGTGCTGCCACCAATAGG + Intronic
1103088330 12:118079421-118079443 GCTGAGCGAGTCCCAGCTGTCGG - Exonic
1105016836 12:132791278-132791300 GCTGCAGGTGTTCCACCTGTGGG + Exonic
1106200611 13:27533578-27533600 GCACATGTGGTGCCACCTGTGGG - Intergenic
1106786163 13:33109988-33110010 GCTGAGAGAGCGCCACCTGTGGG - Exonic
1107079819 13:36362720-36362742 GCTGAGGGGCAGCAAGCTGTGGG - Intronic
1109829907 13:67772980-67773002 GAGCAGGGGGTGGCACCTGTAGG + Intergenic
1113241691 13:108345249-108345271 CCTGAGTGGGTGCCTCCTGGTGG + Intergenic
1114059735 14:19008080-19008102 CCTGAGTGGCTGCCACCTGATGG + Intergenic
1114060958 14:19015499-19015521 CCTGAGTGGCTGCCACCTGATGG + Intergenic
1114061070 14:19016138-19016160 CCTGAGTGGGTGCCACCTAATGG + Intergenic
1114061175 14:19016778-19016800 CCTGAGTGGCTGCCACCTGATGG + Intergenic
1114101186 14:19383841-19383863 CCTGAGTGGGTGCCACCTAATGG - Intergenic
1114101298 14:19384480-19384502 CCTGAGTGGCTGCCACCTGATGG - Intergenic
1114102810 14:19393671-19393693 CCTGAGTGGCTGCCACCTGATGG - Intergenic
1114593770 14:23893596-23893618 GCCGAGGGTGTGACACCTGCTGG - Intergenic
1114951699 14:27762187-27762209 CCTGATGGGGTGCCCCTTGTAGG - Intergenic
1115761032 14:36579854-36579876 GCTGAGGGAGGGCCGCCTGGGGG - Intergenic
1119642531 14:76325935-76325957 GCTGGGGGGCTGCAGCCTGTGGG - Intronic
1123553278 15:21401722-21401744 CCTGAGTGGCTGCCACCTGATGG - Intergenic
1123589524 15:21839110-21839132 CCTGAGTGGCTGCCACCTGATGG - Intergenic
1127704231 15:61531254-61531276 GAGGAGGGGGTGCCACTTGTTGG - Intergenic
1129247688 15:74289661-74289683 GCTGAGATGGTGCCACTTGGGGG + Intronic
1130900651 15:88204787-88204809 ACTGGGGGCGTGCCACCTGCTGG + Intronic
1202961627 15_KI270727v1_random:128942-128964 CCTGAGTGGCTGCCACCTGATGG - Intergenic
1132575451 16:661781-661803 GCTGAACGGGTGGCACCTGAAGG - Exonic
1132839407 16:1971761-1971783 GATGTGGGGGTACCAGCTGTCGG - Intergenic
1132891334 16:2206245-2206267 GCTGGGGGGATGCCTCGTGTGGG + Intronic
1132915190 16:2340341-2340363 GCTGAGGGAGCGGCACCTGCAGG + Intronic
1132937808 16:2490482-2490504 CCTGTGAGGGTGCCTCCTGTGGG - Intronic
1133100453 16:3476103-3476125 GCTGAGGGGTGTCCACCCGTGGG + Intronic
1134492143 16:14703329-14703351 GCTGCTGCGGTGCCGCCTGTAGG + Intergenic
1134497524 16:14742451-14742473 GCTGCTGCGGTGCCGCCTGTAGG + Intronic
1138700117 16:58853911-58853933 GCTGAAGGTGTGTCACCTCTTGG - Intergenic
1139288390 16:65835452-65835474 GCTGAGGGGTTTGCACCTGCTGG + Intergenic
1139379421 16:66521253-66521275 GGGGAGGGGGTCACACCTGTGGG + Intronic
1141217017 16:82034128-82034150 GCTCAGGGCGTGCCCCATGTGGG - Intergenic
1142035663 16:87861009-87861031 GCTGTGGGGGGCCCTCCTGTTGG + Intronic
1142174511 16:88639042-88639064 ACTGTGGGGGTGCCCCCTGAGGG - Exonic
1142445047 16:90131004-90131026 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
1142462463 17:104462-104484 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
1142597963 17:1038747-1038769 GCTGAGCGGGGGTCACCTTTAGG - Intronic
1142693996 17:1623443-1623465 GCTGAGGGCTTGCCACATGCTGG - Intronic
1143521500 17:7446796-7446818 GCTGAGGGGCTGCCCCGGGTTGG - Intronic
1143660395 17:8320999-8321021 GCTGAGGAGGGGGCACATGTTGG + Exonic
1143727162 17:8857003-8857025 GTCGAGGGGGAGCCAGCTGTGGG - Intronic
1145224385 17:21115971-21115993 GATGTGGGGGTGCCACATCTGGG + Intergenic
1148863086 17:50614704-50614726 GCTGGGAGGGCCCCACCTGTTGG - Intronic
1151883115 17:76906451-76906473 GCTCAGGGGCTGACACGTGTTGG + Intronic
1152547534 17:81009327-81009349 GCTGTGGAGGTGGCCCCTGTGGG + Intronic
1152724099 17:81936843-81936865 GCAGAGCCGGTGCCATCTGTGGG - Exonic
1152741492 17:82020363-82020385 CCTGAGGGAGTGCCACCAGTAGG + Intronic
1153940212 18:9970325-9970347 GCTGAGAGGGTGTCACCTGAGGG - Intergenic
1154453965 18:14503839-14503861 CCTGAGTGGCTGCCACCTGATGG - Intergenic
1158288782 18:55915485-55915507 GCTGAGGGAGAGCCTCTTGTGGG - Intergenic
1160512300 18:79459359-79459381 GCTGCGGGGCAGCCACCTGGAGG + Intronic
1160623467 18:80187245-80187267 GCTGAGGGGATGGCACGCGTGGG + Intronic
1160652169 19:236838-236860 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
1161686584 19:5705722-5705744 GCTGAGGAGGGGTCACCTGAGGG + Intronic
1161992347 19:7691158-7691180 GTTGAGGGGCTTCTACCTGTGGG - Intronic
1163235811 19:16029789-16029811 GATGTGGGGGTGCCACATGCTGG - Intergenic
1167001872 19:46750294-46750316 GATGAAGAGGTGCCACCTGCTGG - Intronic
1167497901 19:49830153-49830175 GCTGAGAGAGTGGCACCTGAGGG - Exonic
1167602299 19:50461377-50461399 GCTGGGTTGGTTCCACCTGTTGG + Intronic
1168717234 19:58536709-58536731 GCTTTGGGGGTGACACCTGAGGG + Intronic
1202649828 1_KI270706v1_random:170116-170138 CCTGAGGGGCTGCCTCCTGATGG + Intergenic
926220217 2:10931296-10931318 GCTGAGCAGCTGCCACCTGGGGG + Intergenic
927509486 2:23635472-23635494 GCAGAGGGGGAGGCACCTGCTGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
932267106 2:70377312-70377334 GAGGAGGGGGTGCCACGTGCAGG + Intergenic
932949983 2:76281658-76281680 GCTGAGCAGGTGCCACCTGCTGG - Intergenic
934485659 2:94707506-94707528 CCTGATGGGGTGCCCCTTGTAGG + Intergenic
935070370 2:99688749-99688771 CCTGAGGGGGTGGCACTTGGAGG - Intronic
937332803 2:121042765-121042787 CCGGAGGGGAGGCCACCTGTGGG - Intergenic
938163219 2:129005051-129005073 GTTGTGGGGGTGGCACATGTGGG + Intergenic
938280390 2:130059955-130059977 CCTGAGTGGCTGCCACCTGAGGG - Intergenic
938281106 2:130064285-130064307 CCTGAGTGGCTGCCACCTGAGGG - Intergenic
938281545 2:130067029-130067051 CCTGAGTGGCTGCCACCTGAGGG - Intergenic
938331973 2:130454397-130454419 CCTGAGTGGCTGCCACCTGGGGG - Intergenic
938358037 2:130667442-130667464 CCTGAGTGGCTGCCACCTGGGGG + Intergenic
938434270 2:131273056-131273078 CCTGAGTGGCTGCCACCTGAGGG + Intronic
938434592 2:131275046-131275068 CCTGAGTGGCTGCCACCTGAGGG + Intronic
938478207 2:131635048-131635070 GCTGAGTGGCTGCCACCTGATGG + Intergenic
938478549 2:131637138-131637160 CCTGAGTGGCTGCCACCTGATGG + Intergenic
947746173 2:232508435-232508457 GGTGTGGGGGTGCCTCCTGGTGG - Intergenic
948166093 2:235863756-235863778 GCTGAGGATGTGCCACCTGTGGG + Intronic
1168836754 20:882598-882620 GCTGAGGGGGTGCCAACAGGTGG - Intronic
1170836218 20:19886834-19886856 GCTGCTGGGGTGACATCTGTGGG + Intronic
1171437243 20:25133197-25133219 GCTCAGGTAGTGCCAACTGTTGG - Intergenic
1171881537 20:30621150-30621172 CCTGAGGGGCTGCCTCCTGATGG - Intergenic
1171885823 20:30651967-30651989 GCGGAGTGTGTGCCACCTTTGGG - Intergenic
1172250842 20:33478048-33478070 GCTGAGGTGGTGACAGCTGTGGG - Intergenic
1172468845 20:35176113-35176135 GCAGAGAGGGTGCCAGGTGTGGG - Intronic
1172517036 20:35542168-35542190 CCTGCGGGGGCGCCACCGGTAGG + Exonic
1175518884 20:59587138-59587160 GCACACGGGGTCCCACCTGTGGG - Intronic
1176601991 21:8802431-8802453 CCTGAGGGGCTGCCTCCTGATGG - Intergenic
1176820205 21:13649457-13649479 CCTGAGTGGCTGCCACCTGATGG + Intergenic
1180038352 21:45262691-45262713 GCTGGGCGTCTGCCACCTGTGGG - Intergenic
1180344275 22:11693982-11694004 CCTGAGGGGCTGCCTCCTGATGG - Intergenic
1180478216 22:15730692-15730714 CCTGAGTGGCTGCCACCTGATGG + Intergenic
1180479441 22:15738111-15738133 CCTGAGTGGCTGCCACCTGATGG + Intergenic
1180479553 22:15738750-15738772 CCTGAGTGGGTGCCACCTAATGG + Intergenic
1180479660 22:15739390-15739412 CCTGAGTGGCTGCCACCTGATGG + Intergenic
1181159962 22:20954022-20954044 TCTGTGGTGGTGCAACCTGTGGG - Intergenic
1181512702 22:23395937-23395959 GCTCTGGGGCTGCCCCCTGTGGG + Intergenic
1182417281 22:30229411-30229433 TCGGAGGGGCTGCCACCTGGTGG - Intergenic
1182417889 22:30233021-30233043 GCTGAGCGGGTGCCAGCCATGGG - Intergenic
1183963662 22:41428345-41428367 GTTGGGGGGGTCCCACCTGATGG + Intergenic
1184784259 22:46664211-46664233 CCTGAGGAAGTGCCACCTGGGGG - Intronic
949281534 3:2352703-2352725 GAGCAGGGGGTGGCACCTGTCGG - Intronic
950147791 3:10664210-10664232 GCTGCGGGGGTGACAGCTGCAGG - Intronic
952853907 3:37752104-37752126 GCAGAGGGTGTGCCAGCTGTGGG - Intronic
952920169 3:38278496-38278518 GGTCAGGGGCTGCCAGCTGTAGG - Intergenic
953890912 3:46750895-46750917 GCTGGGGAGGTGCCACCTGGCGG + Intronic
954800793 3:53185900-53185922 TCTGAGGAGGTGCCATCTCTCGG + Intronic
954870888 3:53766734-53766756 GCTAAGGGGCTGTCTCCTGTAGG + Intronic
958733155 3:97979830-97979852 GCTGGGAGGGTGCCATCTGTTGG - Intergenic
967055067 3:185824215-185824237 GCCGAGGGGGTGCCAAAAGTGGG + Intronic
968365663 3:198183134-198183156 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
968746303 4:2362377-2362399 GCTGTGGGGGTCACAGCTGTGGG - Intronic
968865825 4:3210605-3210627 GCAGTGGGGGGGCCACCTCTTGG + Intronic
969265665 4:6062661-6062683 GCTGAGGAGGTGCCTCCTCCTGG - Intronic
969338785 4:6527764-6527786 GCTGAGGTGGTGGGGCCTGTGGG - Intronic
969425826 4:7123084-7123106 GCTGGGGAGTTGCCACCTGTGGG - Intergenic
973365316 4:49204238-49204260 CCTGAGGGGCTGCCTCCTGATGG - Intergenic
973395275 4:49588216-49588238 CCTGAGGGGCTGCCTCCTGATGG + Intergenic
973715375 4:53670682-53670704 GCTGAGGGGGCACGACCTGCTGG - Intronic
974526196 4:63052864-63052886 CCCGAGGGGGTGGCCCCTGTTGG - Intergenic
974648686 4:64726812-64726834 CCTTAGGGGGTGCCACATGCAGG - Intergenic
978151823 4:105445259-105445281 GCTTAGGGGATGCAGCCTGTAGG - Intronic
979254700 4:118598301-118598323 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
979334262 4:119447730-119447752 GCTGAGGGGGTGGGGCATGTGGG + Intergenic
979632944 4:122923334-122923356 GCCGAGGGGGCGCAACCTGAGGG + Intronic
985657665 5:1140472-1140494 GGTGAGTGGGTGCCCCCTGCTGG + Intergenic
985720043 5:1484148-1484170 TCTGAGTGGCTGCCACCTGATGG + Intronic
988400413 5:30753851-30753873 GCTGAGGGGGTGGCTCTTGGAGG - Intergenic
991011209 5:61884693-61884715 GCTGAGGAGGAGGTACCTGTGGG + Intergenic
991812652 5:70488148-70488170 GATGTGGGGGAGCCACCCGTTGG - Intergenic
998951329 5:147395633-147395655 CCTGCGGGGGTGCCACCTTTGGG + Exonic
999239533 5:150119551-150119573 GGGTAAGGGGTGCCACCTGTTGG + Exonic
1000084793 5:157879596-157879618 GAGCAGGGGGTGGCACCTGTTGG - Intergenic
1000645607 5:163757067-163757089 CCAGAGAGGGTCCCACCTGTGGG + Intergenic
1001411531 5:171515720-171515742 GCTGAGGAGGGGCCAGCTGGAGG - Intergenic
1001557617 5:172647274-172647296 GGTGAGCGTGTGCTACCTGTCGG - Intronic
1011640663 6:89413296-89413318 GCTGAGCTGCTGGCACCTGTAGG - Intergenic
1015766544 6:136723999-136724021 GCTGAGTGGCTGGCACCTGTGGG - Intronic
1018209918 6:161470791-161470813 CCTGAAGGGCTGCCACATGTAGG + Intronic
1019538523 7:1541046-1541068 GCTGAGGGGGTGCAGCTTGCTGG + Exonic
1019597465 7:1864753-1864775 GGTGAGGGGGTTCCCACTGTTGG + Intronic
1019728752 7:2617891-2617913 GCTGAGGGGGTAGCCCCTGTGGG - Intergenic
1019855099 7:3597484-3597506 GCGGCGGGGAGGCCACCTGTTGG + Intronic
1023838245 7:44080812-44080834 GCTGGGGGGGTGCAACCCGGGGG + Exonic
1023989469 7:45119485-45119507 GCTGAGGGGGCGCCACAAGGAGG - Intergenic
1024055845 7:45659463-45659485 GCTGAGACGATGCCAACTGTGGG + Intronic
1024069793 7:45775967-45775989 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
1025004213 7:55342663-55342685 GCTGAGGGGGGGCGGCCTGCGGG + Intergenic
1025835124 7:65086425-65086447 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
1028052943 7:86207766-86207788 GCTGAGGGAGTGACACCTTAAGG - Intergenic
1030126217 7:106154852-106154874 GCTGAGGAGGTGCAACATTTTGG + Intergenic
1032018733 7:128395064-128395086 GCTGGGGGGGTGGCACTAGTGGG - Intronic
1032047183 7:128620253-128620275 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
1032538267 7:132682852-132682874 GCTGAGGGACTGGCATCTGTGGG - Intronic
1035088127 7:156278951-156278973 GTTGAGGGGCTGGCAACTGTGGG + Intergenic
1035318339 7:158012126-158012148 GCTGAGAGAGTCCCACGTGTTGG + Intronic
1037860278 8:22399915-22399937 GCTGAGGGGGGAACATCTGTTGG + Intronic
1039182361 8:34880653-34880675 GCCGAGGGGGTGCAGCCTGTAGG - Intergenic
1041169197 8:55123739-55123761 GGTGCGGGGGTGTCCCCTGTGGG - Intronic
1041200746 8:55450740-55450762 GCTGGAGGGGTTCCACCTGCTGG - Intronic
1043725948 8:83611206-83611228 GAGCAGGGGGTGGCACCTGTTGG + Intergenic
1048937301 8:139367678-139367700 TCTGAGGGGATGCCTGCTGTGGG - Intergenic
1049247603 8:141571175-141571197 GCTGGGTGGGTGACACCTGGGGG + Intergenic
1049485626 8:142858461-142858483 GCTGAGGGAGTCCCACATGGGGG - Intronic
1049592679 8:143469684-143469706 GGGGAGGGGGTGCCATCTGGAGG + Intronic
1052877200 9:33575867-33575889 CCTGAGGGGCTGCCACTTGACGG + Intergenic
1053218493 9:36292510-36292532 GTTGAGGAGATGCCACCTTTAGG + Intronic
1053498801 9:38568527-38568549 CCTGAGGGGCTGCCACTTGACGG - Intronic
1053672131 9:40376816-40376838 CCTGATGGGGTGCCCCTTGTAGG - Intergenic
1053921947 9:43003174-43003196 CCTGATGGGGTGCCCCTTGTAGG - Intergenic
1054383246 9:64516860-64516882 CCTGATGGGGTGCCCCTTGTAGG - Intergenic
1054512492 9:65999494-65999516 CCTGATGGGGTGCCCCTTGTAGG + Intergenic
1055081865 9:72275539-72275561 GCTGAAGGGATTCCACCTTTGGG + Intergenic
1057410313 9:94811750-94811772 GCTGAGGAGATGCCGCCTCTGGG - Intronic
1057678255 9:97153020-97153042 CCTGAGGGGCTGCCACCTGACGG - Intergenic
1060106475 9:120876438-120876460 GCTGGGGGGGCGCCACCCGGGGG - Intronic
1060247764 9:121960621-121960643 GCTGAGGGCTTGCTACATGTAGG - Intronic
1060522603 9:124302134-124302156 GCTGAAGGGTTTCCACCAGTAGG - Intronic
1061032309 9:128092655-128092677 GCTGCGGGTCTGCCAACTGTGGG + Intronic
1061297921 9:129687003-129687025 GCTGAGGGACAGCCACCTGCAGG + Intronic
1061680487 9:132240555-132240577 GCTGAGTTTCTGCCACCTGTCGG + Intronic
1061837917 9:133341546-133341568 GGGCAGGGGCTGCCACCTGTAGG + Exonic
1062386254 9:136312656-136312678 GGGGAGAGGGTGCCACCTGCTGG - Intergenic
1062428115 9:136515400-136515422 CCTGAAGGGGTGGCACGTGTCGG + Exonic
1062750032 9:138246001-138246023 GCTGAGGGGGTGGGGCATGTGGG - Intergenic
1203527155 Un_GL000213v1:100094-100116 CCTGAGTGGCTGCCACCTGATGG - Intergenic
1190224246 X:48533425-48533447 GATGAGTGGGAGGCACCTGTGGG - Intergenic
1192333607 X:70199805-70199827 GCTGAACGCCTGCCACCTGTGGG - Exonic
1192965627 X:76173665-76173687 GCTGAGTGGGTGGGAGCTGTGGG - Intronic
1195786401 X:108528140-108528162 GCTGCGGTGGTGGCACCAGTGGG - Intronic
1197819735 X:130531075-130531097 GCTGAGGGGAGGTCACCAGTAGG - Intergenic
1199429687 X:147745178-147745200 GCTGAGGGTGTACCACATGCAGG - Intergenic
1202142776 Y:21745353-21745375 GCTGTGGGTGTGTCTCCTGTAGG - Intergenic
1202144082 Y:21760265-21760287 GCTGTGGGTGTGTCTCCTGTAGG + Intergenic