ID: 905104004

View in Genome Browser
Species Human (GRCh38)
Location 1:35551822-35551844
Sequence GGTGGTGTTAGGTGTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905104004_905104009 4 Left 905104004 1:35551822-35551844 CCAGAACTACACCTAACACCACC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 905104009 1:35551849-35551871 TTGCACTTCTATACTTAATTAGG 0: 1
1: 0
2: 2
3: 9
4: 163
905104004_905104010 5 Left 905104004 1:35551822-35551844 CCAGAACTACACCTAACACCACC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 905104010 1:35551850-35551872 TGCACTTCTATACTTAATTAGGG 0: 1
1: 0
2: 0
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905104004 Original CRISPR GGTGGTGTTAGGTGTAGTTC TGG (reversed) Intronic
903130939 1:21279242-21279264 GGTGGTGTTGGTGGTACTTCTGG - Exonic
903677494 1:25073526-25073548 GGTGGTGCACGGTGTAGCTCTGG - Intergenic
904430670 1:30462102-30462124 GTTGCTGTTCGGTGTAGATCTGG + Intergenic
905104004 1:35551822-35551844 GGTGGTGTTAGGTGTAGTTCTGG - Intronic
906076765 1:43057665-43057687 GGTGGTGTTGGTTGTGGTTATGG + Intergenic
907684049 1:56592564-56592586 AGTCATTTTAGGTGTAGTTCTGG - Intronic
908915513 1:69121128-69121150 GGTGGTGGTAAGCGTGGTTCAGG - Intergenic
912120636 1:106467671-106467693 GGTGGTGTTAGCAGTAGACCGGG - Intergenic
915742754 1:158131795-158131817 GGTGGTGCTAGCTGTAGGTATGG - Intergenic
918935187 1:190912676-190912698 GGTGGTGTCAGGTGGAGTAAAGG - Intergenic
919586992 1:199451315-199451337 GGTGGTGGGGGGTGTAGTGCAGG - Intergenic
919856415 1:201709299-201709321 GGTGGGGTAAGGTGAAGATCAGG + Intronic
1063852259 10:10206261-10206283 GGTAGGGACAGGTGTAGTTCAGG + Intergenic
1064093945 10:12408615-12408637 GGTGGTGGTGGGGGTGGTTCAGG + Intronic
1075029920 10:119016197-119016219 GATAGTGTTAACTGTAGTTCTGG - Intergenic
1077580949 11:3416957-3416979 GGTAGGGTTAGGTGTAGTCTAGG + Intergenic
1085514523 11:77104642-77104664 GCTGATGTTAGGTGCAGGTCAGG - Intronic
1086337647 11:85814669-85814691 GGTGGTGTTGGGTGGTGTTAGGG - Intergenic
1089643699 11:119864325-119864347 GGTGGTGTTAGGTGCTGAGCAGG - Intergenic
1090842690 11:130506688-130506710 GGTGGTCTTAGGTGGAGATGAGG + Intergenic
1096181038 12:49550445-49550467 GGTGGAGTCAGGAGTAGTTATGG + Intronic
1103553082 12:121750462-121750484 GGCGGTGTGAGGTGTGGGTCTGG - Intronic
1114547984 14:23516164-23516186 GTTGGTCTTAGGTGTGGTCCAGG + Intergenic
1116365082 14:44050251-44050273 GGTGGTGGTGGGAGTAATTCTGG - Intergenic
1116782455 14:49251104-49251126 GGTGCTGGTAGGTGTAGGGCTGG - Intergenic
1124470646 15:29982419-29982441 GGTGATATTAGGTGGAGATCAGG + Intergenic
1128958661 15:71976091-71976113 GGTGGGGTGAGGTGCAGTTTTGG + Intronic
1130785072 15:87087109-87087131 GGTGGTAATAGGTGTAGGACTGG + Intergenic
1130987302 15:88852964-88852986 GGTGGTGTCAGGTGCTCTTCTGG + Intronic
1133349515 16:5092214-5092236 GGTAGGGTTAGGTGTAGTCTAGG + Intronic
1134147226 16:11775492-11775514 TGTGGTGTTAGGTGAGGTGCTGG + Intronic
1134883683 16:17770918-17770940 GGTGGTGTAAGTTCCAGTTCAGG + Intergenic
1139579851 16:67866126-67866148 GGGGGTGTTAGGAGTAATCCAGG + Intronic
1141080129 16:81043479-81043501 TGTGGTGTTAGGTGTTGATCAGG + Exonic
1141560705 16:84866072-84866094 GCTGGTGTGAGGTGCAGTTGGGG + Intronic
1142067238 16:88069617-88069639 GGTGGGGTTAGGAGCAGTTTAGG - Intronic
1148684261 17:49491955-49491977 GGTGGTGATAGTTGTGATTCTGG + Intergenic
1151758765 17:76089085-76089107 GGTGGTGGTGGGTGGAGTTGAGG + Intronic
1152700444 17:81815781-81815803 GGTGGAGTTGGGTGGAGTTGGGG + Intergenic
1153615747 18:6931340-6931362 GGTGGTGGAAGGTGAAGTTGTGG - Intergenic
1154123774 18:11672237-11672259 GGTGGTGTTAGGAAGAGTTTGGG - Intergenic
1156635484 18:39023122-39023144 CTTGGAGTTAGGTGAAGTTCTGG + Intergenic
1157110310 18:44814321-44814343 GGTGGGGTTAGGAGGAGTTTTGG + Intronic
1157743666 18:50115831-50115853 GGTAGTGGTAGGTAAAGTTCTGG + Intronic
1166322432 19:42026916-42026938 TGAGGTGATAGGTGTAGTTAGGG - Intronic
1167251616 19:48401455-48401477 GGAGGTGTCAGGTGGAGGTCTGG + Intronic
925040785 2:731850-731872 GCTGGGGTTTGGTGGAGTTCCGG + Intergenic
927879987 2:26683589-26683611 CGTGGTGTGATGTGTATTTCTGG + Intergenic
929704678 2:44197980-44198002 GGTGGTGTTAGGGATGCTTCAGG - Intronic
931223099 2:60306051-60306073 GGTGGTGTTAGTGGTGGTTATGG - Intergenic
931257289 2:60584725-60584747 GGTGGTGTAGGGGGTAGTTAAGG - Intergenic
935821058 2:106893076-106893098 AGTGGAGTTAGGTGTCCTTCTGG - Intergenic
936344743 2:111666746-111666768 GGTGGTGTTAGTGGTAGTGCTGG + Intergenic
938171838 2:129085478-129085500 GGAGGTGTGAGCTGAAGTTCAGG - Intergenic
940291752 2:152084126-152084148 GCAGGTTTTAGGTGCAGTTCGGG + Intronic
941435205 2:165461759-165461781 GGTGGTTTATGGTGTAGCTCTGG - Intergenic
942277100 2:174331229-174331251 GGTGGGGTGAGGTGGAGTTAGGG - Intergenic
943092309 2:183389881-183389903 GGTGCTGGTAGGTGCAGGTCTGG + Intergenic
944852055 2:203729706-203729728 GGTGGTGGTTGGTGGAGTCCTGG + Exonic
946717642 2:222569571-222569593 TGAGGTGGTAGGTGTACTTCAGG - Intergenic
947255191 2:228155917-228155939 GCTGGTGTTTGTTGTAGCTCAGG + Intronic
1175837006 20:62002351-62002373 GGTGGAGTTGTGTGTATTTCAGG - Intronic
1178233456 21:30813885-30813907 TGTGATGTTAGGTATAGTTTAGG - Intergenic
1181019826 22:20093858-20093880 GGTGGTGTTGGGTGTACCCCAGG + Intronic
1182119597 22:27778346-27778368 GGTGGTCTTGGGTGCCGTTCAGG - Intronic
1184217459 22:43077202-43077224 GGTGGTGTGAGGTGTACCTGGGG - Intronic
951096667 3:18639922-18639944 GGTGGTGTTAGCTGGAGTTTGGG + Intergenic
951630830 3:24718120-24718142 GGTGGTGCTTGATGTAGTGCTGG - Intergenic
953336612 3:42099163-42099185 GGTGGTGTCAGGTGTAGGGGTGG + Intronic
956516338 3:70052586-70052608 GGTGGTGGTAAGTGGAATTCTGG + Intergenic
957260700 3:77897761-77897783 GGTGGTCTTAGGTGGAGATGAGG - Intergenic
960954935 3:123025624-123025646 GGTGGTGATAGGTGTTGATATGG + Intronic
961301026 3:125922126-125922148 GGTAGAGTTAGGTGTAGTTTAGG - Intergenic
962859234 3:139382550-139382572 GGTGTTTTTAGGTTTACTTCTGG + Intronic
963494907 3:146046158-146046180 GGTGGTCTTAGGTGGAGATGGGG - Intergenic
964095138 3:152922572-152922594 GGGGGTGGTAGGTGTAGTTAAGG - Intergenic
968996622 4:3949865-3949887 GGTAGGGTTAGGTGTAGTCTAGG + Intergenic
969757377 4:9158811-9158833 GGTAGGGTTAGGTGTAGTCTAGG - Intergenic
972404487 4:38733395-38733417 GGTGGTGTTAGTGGTAGTGATGG + Intergenic
976408934 4:84690828-84690850 GGAGGCGGTAGGGGTAGTTCAGG - Intronic
981780173 4:148420515-148420537 GGTTGTGGTAGGTGTTATTCTGG - Intronic
984209964 4:176834855-176834877 AGTGGTGTTAGGAGTCGTTGTGG - Intergenic
985575721 5:672588-672610 GGTGGTGTTTGGTGCAGTTGGGG + Intronic
987609481 5:20183093-20183115 GATGATGTTAGTTGTAGTTAAGG - Intronic
988022121 5:25634262-25634284 GGTGGTGTGTGCTGTAGTCCCGG - Intergenic
988217057 5:28288246-28288268 GATGGTGCTAGGTGTACCTCAGG + Intergenic
988227007 5:28425826-28425848 GGTGGTCTTAGATGGAGTTGAGG + Intergenic
988688582 5:33549482-33549504 AGAGGGGTTAGGTCTAGTTCCGG + Intronic
988837354 5:35046354-35046376 GTTGGAGTTAGGTGATGTTCTGG + Intronic
988948535 5:36233256-36233278 GGTGGTGTTAAGGTTAGTTAGGG - Intronic
991578661 5:68131405-68131427 GTTGGTGTTAGGTGTGGATCTGG - Intergenic
993311475 5:86338147-86338169 GGTGGTGTTAGGTGTGGGGCTGG - Intergenic
994102145 5:95905072-95905094 GTTGGTCTCAGGTGGAGTTCAGG + Intronic
995779887 5:115763619-115763641 GGTGGTCTTAGATGGAGTTGAGG - Intergenic
996959341 5:129226743-129226765 GATGGTGTGAGGTATGGTTCGGG + Intergenic
999684913 5:154093818-154093840 GGTGGTGTGAGGGGTTTTTCTGG - Intronic
1001439176 5:171725697-171725719 GGGGGTGGTAAGTGTAGTTGGGG - Intergenic
1005350287 6:24927403-24927425 GGTGGTGATAGTTATAGTTGTGG - Intronic
1005826082 6:29632617-29632639 GGTGGTGAGAGGTGGAGTCCCGG - Intronic
1006901925 6:37507972-37507994 GGTGGGGGTGGGGGTAGTTCTGG + Intergenic
1008451166 6:51652418-51652440 GGTGGGGTGAGGTGAAGTTGGGG + Intronic
1009317192 6:62234758-62234780 GGTGGTGTTAGAAGTTCTTCTGG - Intronic
1013479907 6:110544399-110544421 GGTGGAGATAGGTGTTGCTCTGG - Intergenic
1014771168 6:125459114-125459136 GGTGGTCTCAGGTGTAGATGAGG - Intergenic
1019529354 7:1495833-1495855 GGTGGTGTTTGGGGCAGTCCGGG - Intronic
1020320907 7:6938279-6938301 GGTAGTGTTAGGTGTAGTCTAGG + Intergenic
1026939118 7:74276777-74276799 GGTGGGGTGGGGTGTAGTCCTGG - Intergenic
1031342032 7:120614530-120614552 GGTGTTGTGAGGTGAAATTCAGG - Intronic
1032384335 7:131511096-131511118 TGTGGTGTTAGGTTTAGCTGTGG + Exonic
1034344431 7:150377748-150377770 AGTAGTCTCAGGTGTAGTTCAGG + Intronic
1036380617 8:8234140-8234162 GGTAGGGTTAGGTGTAGTCTAGG - Intergenic
1036848952 8:12188495-12188517 GGTAGGGTTAGGTGTAGTCTAGG + Intronic
1036870314 8:12430773-12430795 GGTAGGGTTAGGTGTAGTCTAGG + Intronic
1038926970 8:32151488-32151510 GGTGGGGTTAGGTGTAGAACAGG + Intronic
1039906238 8:41788452-41788474 TGTGGTCTGAGATGTAGTTCTGG - Intronic
1041807479 8:61868360-61868382 GGTCTTGTTAGGTGAAGTACAGG - Intergenic
1048815707 8:138331923-138331945 ATTGGTGTTAGGGGTGGTTCTGG - Intronic
1049543220 8:143218021-143218043 GGTGGTGTTGGGTGGTGTTGGGG - Intergenic
1049543258 8:143218122-143218144 GGTGGTGTTGGGTGGTGTTGGGG - Intergenic
1057435724 9:95038852-95038874 GGAGGTGATAGGAGCAGTTCTGG + Intronic
1057463900 9:95293317-95293339 TGTGGTGTTAGGTGTTGATCAGG + Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061845143 9:133383697-133383719 GGTGGTGTTGGTTGTGGTTGTGG + Intronic
1203790299 EBV:147939-147961 TGTGGTGTTTGGTGTGGTTTTGG + Intergenic
1186363856 X:8871419-8871441 GGAGGTGTTTGGTGTTGTGCTGG - Intergenic
1187654694 X:21458147-21458169 TGTGGTGTTAGATGCAGTGCAGG - Intronic
1188608024 X:32057921-32057943 GGTGATGCTAGGTTTATTTCTGG - Intronic
1190775311 X:53547827-53547849 GGTGGTGGTAGATGTGGTTGAGG + Exonic
1193175850 X:78391378-78391400 GGGGGAGTTAGGGGTAGTTGGGG + Intergenic
1197020058 X:121676135-121676157 GGTGGTGGTAGGAGTAGTGCTGG - Intergenic
1198956183 X:142134390-142134412 GGTGGTCTTAGATGGAGTTGAGG + Intergenic