ID: 905107200

View in Genome Browser
Species Human (GRCh38)
Location 1:35571317-35571339
Sequence AACCCAAGGAAGCCACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905107200 Original CRISPR AACCCAAGGAAGCCACAGAC AGG Intergenic
900477343 1:2882189-2882211 AGCCCAGGGAACCCACACACAGG + Intergenic
901551879 1:10001551-10001573 AACCCAAGCAAGGCAGAGGCAGG - Intronic
902098801 1:13967964-13967986 AAACCATGGAAACCACAGATTGG + Intergenic
902919538 1:19657771-19657793 AAGCCAAGGAAGCCAGAGAAAGG - Exonic
902957577 1:19936266-19936288 AGCCCCAGGAAGCCACTGGCTGG - Intergenic
902980099 1:20116332-20116354 AACCCAAAGATGCCACGGACTGG - Exonic
903256729 1:22107451-22107473 AACCCAAAGCAGCCACTGCCAGG - Intergenic
905107200 1:35571317-35571339 AACCCAAGGAAGCCACAGACAGG + Intergenic
906026661 1:42680009-42680031 TGCCCAAGGAAGTCACAGTCTGG + Intergenic
906856558 1:49312530-49312552 AAGAAAAGGAAGTCACAGACTGG + Intronic
908677804 1:66625343-66625365 AATTCAATGCAGCCACAGACTGG + Intronic
908686602 1:66727136-66727158 AAACAAAACAAGCCACAGACTGG + Intronic
909720770 1:78767277-78767299 GACCCCAGGAAACCACAGATTGG + Intergenic
911852192 1:102834069-102834091 AACCCATGGTTTCCACAGACAGG + Intergenic
913069352 1:115285221-115285243 CAGCCAGGGAAGCCAGAGACGGG - Intergenic
913658164 1:120981638-120981660 AAGCCAAGGAAACTACAGTCTGG - Intergenic
914009520 1:143764707-143764729 AAGCCAAGGAAACTACAGTCTGG - Intergenic
914648146 1:149673382-149673404 AAGCCAAGGAAACTACAGTCTGG - Intergenic
915031388 1:152883102-152883124 ATCCCAAGGATGCCAGAGGCTGG + Intronic
915288953 1:154870085-154870107 AACCGAAGCAAGCCAAAGAGAGG - Exonic
916438112 1:164795345-164795367 AGCCCAAGGAAGTAACAGAGAGG - Intronic
918180725 1:182084371-182084393 AACCCAAGGAAGCAGGAGGCAGG - Intergenic
918474500 1:184908825-184908847 CCCCCAAGGAAGCTACAGATTGG + Intronic
920073830 1:203322571-203322593 AACCCATGGAAGACACACAGTGG - Intergenic
920078011 1:203351066-203351088 AACCCAAGGAGGCCAGACAGAGG - Exonic
920753148 1:208701475-208701497 AAAATAAGCAAGCCACAGACTGG + Intergenic
921068825 1:211642468-211642490 TTCCCAAGGAAGCCAAAGATGGG - Intergenic
924843327 1:247737860-247737882 AAACACAGGAAGCGACAGACAGG - Intergenic
1063896733 10:10690288-10690310 AACTCAAGGAAGCTACAGTCTGG - Intergenic
1067539980 10:47144152-47144174 AACTCCAGGGACCCACAGACTGG + Intergenic
1070392912 10:75986798-75986820 AACCCAAAGAGGCAAAAGACAGG - Intronic
1071832353 10:89384215-89384237 AAATCAAGGAAGCTACAAACTGG + Exonic
1072837510 10:98731874-98731896 ATCCTAAGGAATCCACACACAGG + Intronic
1076438708 10:130464444-130464466 GACCCTAGGAAGACACAGACAGG - Intergenic
1076694947 10:132242918-132242940 CACCCAGGGGAACCACAGACCGG + Intronic
1077474795 11:2781309-2781331 GTCCCAAGGAGGACACAGACAGG + Intronic
1078338618 11:10483384-10483406 AATTCAAGGAAGCCAGAGACTGG - Intronic
1080783983 11:35457986-35458008 AGCCAAAGAAAGCCTCAGACAGG + Intronic
1082680963 11:56169524-56169546 TACCAAAGGAAGACACATACAGG + Intergenic
1083587648 11:63872180-63872202 AGCCCAAGGCTGCCACAGAGAGG - Intronic
1083736929 11:64686669-64686691 AAGCCAAGGACGGCGCAGACAGG + Intronic
1084311905 11:68321932-68321954 AACCCAAGGTGGCCAGAGCCTGG - Intronic
1085629792 11:78105210-78105232 AACCCAGACAAGCCACATACTGG + Intronic
1087199082 11:95327712-95327734 AACTCGAGGAAGCCAAAGATTGG + Intergenic
1090269938 11:125378847-125378869 AACACAAGGGAGCCAGAGAGTGG - Intronic
1091081821 11:132677954-132677976 AATTCAAAGAAACCACAGACTGG + Intronic
1093706844 12:22283738-22283760 AGCCCAAGTGAGACACAGACAGG + Intronic
1095192281 12:39271292-39271314 AAACCAAGGAAGGCTTAGACAGG - Intergenic
1096034864 12:48457727-48457749 AAGCCAAGGAGGCAGCAGACTGG - Intergenic
1100524232 12:95405022-95405044 GACCCTAGGAAAGCACAGACTGG - Intergenic
1100993236 12:100273129-100273151 AAGCTATGGAAGCCACAGAAGGG - Intronic
1101374975 12:104163793-104163815 AACCTAACGATGCCACAGGCTGG - Intergenic
1103355602 12:120317499-120317521 GACCCCAGGAAGCTGCAGACAGG + Intergenic
1103926603 12:124426863-124426885 GACCCAGGGAAGACACAGAGGGG + Intronic
1106517338 13:30466194-30466216 AACCCAAGCCAGCCCCACACCGG + Intronic
1106622777 13:31387305-31387327 GGCCCAAGGAAGCCAAAGATTGG + Intergenic
1108826216 13:54415821-54415843 AGCCCAAGCAAGGCACAGGCAGG - Intergenic
1109662055 13:65473502-65473524 AACCCAAGGGTGACACAGAATGG - Intergenic
1110471709 13:75866927-75866949 GACCCAAAGAAGTCACACACGGG - Intergenic
1111127276 13:83927623-83927645 AAACCAGGGAAGTCACTGACTGG + Intergenic
1111353342 13:87062918-87062940 AGCCCAGGGAAGTCAAAGACCGG + Intergenic
1111667021 13:91282480-91282502 AACCTATGGAACCCACAGAGAGG - Intergenic
1112200546 13:97269700-97269722 AACCAAAGGGAGCCTCAGAGAGG - Intronic
1113130436 13:107030778-107030800 AACCCAAGGAAGGGACAGTAAGG - Intergenic
1114172957 14:20292731-20292753 AATTCAATGAAGCCACAGATTGG + Intronic
1114617934 14:24078022-24078044 CACCCAAGGAAGTCACTGAGGGG - Exonic
1114693594 14:24607156-24607178 GATCCAAAGAAGACACAGACCGG - Exonic
1116673025 14:47868244-47868266 AAAACATAGAAGCCACAGACTGG - Intergenic
1117021310 14:51573547-51573569 ATCCCAGGGAAGGCACAGAAAGG + Intronic
1117033360 14:51699462-51699484 AACCTAAGGAAGCTATAAACTGG - Intronic
1118014345 14:61643158-61643180 GAGCCAAGGAAGCCAAGGACTGG - Intronic
1118990672 14:70794328-70794350 AACCCAAAGAAGGTACAGGCAGG + Intronic
1120277565 14:82396723-82396745 AACCCCAGGCAGCCACAGCAGGG + Intergenic
1120509737 14:85398801-85398823 AAGCTAAAGAAGCCACAGCCAGG - Intergenic
1120546455 14:85818154-85818176 AACACAAGAAAGGCACAGTCAGG - Intergenic
1121221765 14:92290758-92290780 AACCCTTGGAAGTCACAGAGAGG - Intergenic
1121456460 14:94041798-94041820 GGCCCAAGGAACCCACAGCCGGG - Intronic
1121506999 14:94485212-94485234 AACCCCAGGAAGGCAGAAACCGG + Intergenic
1122275348 14:100587993-100588015 AAGCCCTGGAAGCCACCGACTGG - Intergenic
1123123880 14:105930567-105930589 AACCCAGGGAAGCCATTGCCAGG - Intronic
1123922930 15:25083270-25083292 TAACCAGGGAAGCCAGAGACAGG + Intergenic
1124186061 15:27530629-27530651 AACCCTTGGAGGCCACAGGCAGG - Intronic
1127706629 15:61553575-61553597 AAAAAAAGTAAGCCACAGACTGG + Intergenic
1128332326 15:66763720-66763742 TCACCAAGGAAGCCACAAACAGG + Intronic
1128903121 15:71443283-71443305 AACCCAGGGAGGCCAGAGAAGGG - Intronic
1132334076 15:101032485-101032507 AAAAAAAGGAAGTCACAGACTGG - Intronic
1133229127 16:4358204-4358226 AACTCATGGAAGCCCCAGGCTGG - Intronic
1133306303 16:4811830-4811852 AGCCCAAGAATGCCACAGACAGG + Intronic
1133319336 16:4903268-4903290 GAGCCAAGGAAGCCAGGGACAGG + Intronic
1134252659 16:12585441-12585463 AACCACAGGAAGCCAAAGAAGGG + Intergenic
1134368467 16:13601432-13601454 AATCCAAGCAAGCCAAACACTGG - Intergenic
1134880995 16:17745443-17745465 AACAATAGGAAGCCACAGGCAGG + Intergenic
1135405603 16:22195369-22195391 AACCCCAGGAAGACCCAGACAGG + Intergenic
1135613452 16:23888682-23888704 AACCCAGGGAAGGTCCAGACAGG - Intronic
1135774422 16:25243909-25243931 AACCCCAGGAACCTACAGGCTGG - Exonic
1136493072 16:30623543-30623565 AACCCATGGTTTCCACAGACAGG - Intronic
1140521014 16:75581772-75581794 AACAAATAGAAGCCACAGACTGG + Intergenic
1140930889 16:79626745-79626767 ACCCCAAGGAAGGCACAGTGAGG - Intergenic
1142625515 17:1189335-1189357 AAAAAAAGGAAGCCATAGACAGG - Intronic
1143261797 17:5605031-5605053 AAGCCAATGAAACCACAGAGAGG - Intronic
1143644770 17:8223166-8223188 AACCAAAGGAAGCAACAACCCGG - Intergenic
1143954111 17:10655551-10655573 AACCCAAGGAAGCAAAAGGCAGG - Intronic
1144504125 17:15815733-15815755 CACCCAAGCAAGGCACAGAGGGG - Intergenic
1144633869 17:16891362-16891384 CACCCAAGGAAGGCACAGAGGGG - Intergenic
1145063845 17:19748796-19748818 AACCCTGGGGAGCCACAGGCTGG + Intronic
1145167985 17:20631240-20631262 CACCCAAGCAAGGCACAGAGGGG - Intergenic
1146704016 17:34986743-34986765 AACACAAGGAAGTAAAAGACAGG - Intronic
1147538215 17:41334698-41334720 AACCCTAGGAAGCAGCAGATGGG - Intergenic
1147609593 17:41793721-41793743 ACCCCAAGGAAGGCAAAGACGGG + Intergenic
1150138437 17:62708907-62708929 AACCCCAGGAAGCCCCAGCCAGG + Intronic
1152279762 17:79378542-79378564 GACCCCAGGAAGCCAAGGACAGG + Intronic
1157741782 18:50099895-50099917 AACCCATGGCAGGCACACACGGG - Intronic
1161383932 19:3981057-3981079 AAGCCAAGGAAGCCAAAGTCAGG + Intronic
1161423494 19:4188763-4188785 AACTGAAGGAAGCCACAGAGGGG - Intronic
1161458957 19:4385233-4385255 ATCCCAAGGAAGCCAGAGCAGGG - Intronic
1165114109 19:33518708-33518730 ATCACAGGGCAGCCACAGACTGG + Intronic
1166071468 19:40390428-40390450 ACCCCACAGTAGCCACAGACTGG - Intergenic
1167097392 19:47381657-47381679 CACCCAGGGATGCCACACACTGG + Intronic
1167883169 19:52479073-52479095 AACCCATGGTTTCCACAGACAGG - Intronic
925237479 2:2292290-2292312 AAACCAAGGAGGCCGCAGGCTGG - Intronic
925740704 2:7003791-7003813 AACCCAAGGAAGGCCCAGAGTGG - Intronic
925860458 2:8170501-8170523 GATCCAAGGAAGCCACTGTCTGG - Intergenic
925972355 2:9114629-9114651 AGCCCAAGGGAGCCACAGTGTGG + Intergenic
926249417 2:11145578-11145600 AACCAAGGGAAACCACAGCCTGG - Exonic
926737930 2:16088463-16088485 AAGCAAAGCAAGCCACATACAGG + Intergenic
927083350 2:19651699-19651721 AAACCAAGGAATCCACAAAGAGG + Intergenic
927204031 2:20595726-20595748 AAGCCAAGGAAGCCGCTGGCTGG + Intronic
928950732 2:36811045-36811067 AATCCAAAGTAGCCAGAGACGGG + Intronic
929116231 2:38446647-38446669 TACCCCAGGAGGCCACAGAGAGG - Intergenic
930010737 2:46936600-46936622 GGCCCGAGGAAGCCATAGACAGG - Intronic
930862017 2:56084333-56084355 AAGACATGGAAGCCACAGGCGGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933325323 2:80828770-80828792 AACCCAAGGAAGACTCAAAAAGG - Intergenic
934546976 2:95225931-95225953 AGCCCAGGAAAGCCACAGAGTGG - Intronic
935632457 2:105223400-105223422 AGCCCATGGAAACCACAGCCGGG + Intergenic
936290795 2:111222474-111222496 AGCCCAAGGAAGCCACGGTGTGG - Intergenic
937614290 2:123902427-123902449 ATCCCAAGGAAGCAAGAGCCAGG - Intergenic
938620169 2:133043429-133043451 GGCCCAAGGAAGCCAAAGATTGG - Intronic
940702144 2:157058757-157058779 AGTCCTAGGAAGCCAGAGACGGG + Intergenic
941336152 2:164245948-164245970 TACTCAAGGAAGTCACACACCGG - Intergenic
942297685 2:174533638-174533660 GAACCAAGGAGGCCACAGTCTGG + Intergenic
944680566 2:202073174-202073196 AACCCAGGCAAGGCAGAGACGGG - Intergenic
945381563 2:209146925-209146947 TACCCAAGCAAGGCACAGATTGG - Intergenic
947589019 2:231374239-231374261 CTACCAAGGAAGCCACAGAGAGG + Intronic
1169046486 20:2537796-2537818 AGCCCAAGGAAGCCATAGGCGGG + Intronic
1169819113 20:9689298-9689320 AATGAAAGGAAGCCAAAGACTGG - Intronic
1170946749 20:20898104-20898126 AACCCAAGGAGGCCAAAACCGGG - Intergenic
1172076595 20:32303082-32303104 GGCCCAAGGAAGCCAAAGATTGG + Intronic
1175630889 20:60535350-60535372 GACCCAAGAGAGGCACAGACAGG - Intergenic
1175906800 20:62384352-62384374 AAAGAAAGAAAGCCACAGACTGG - Intergenic
1176119533 20:63447970-63447992 CACCCCAGGAAGCTGCAGACAGG + Intronic
1177148357 21:17430269-17430291 CACCCAAGCAGGCCACAGCCTGG + Intergenic
1177487185 21:21774435-21774457 AACCCAAGGAGTTCACAGAATGG + Intergenic
1181742535 22:24932892-24932914 AGCCCAAGGTGGCCACAGAGTGG + Intergenic
1182303039 22:29349433-29349455 AACCCAGGGAAGCCAGACAGGGG + Intronic
1183128112 22:35804870-35804892 AACTGAAAAAAGCCACAGACTGG + Intronic
1183499371 22:38169224-38169246 AACCCCAGGAACTCACAGAGTGG - Exonic
1183678429 22:39312770-39312792 AACCCAGCGAAGCTACAGAAAGG + Intergenic
1185251723 22:49805520-49805542 AACGGAAGGAAGCCAGAGGCTGG + Intronic
951375222 3:21906584-21906606 AACCCAGGGAAACCAAAAACAGG - Intronic
952342244 3:32456219-32456241 ATTCCAAGGAGGTCACAGACAGG - Intronic
952889530 3:38030858-38030880 AAACCAAGGAAGGAACTGACAGG - Intergenic
953496662 3:43393524-43393546 AAGCCCAGGAAGCCACCGAAGGG - Intronic
954618126 3:51980662-51980684 AACCCCCCCAAGCCACAGACAGG - Intronic
954673524 3:52303385-52303407 GGCCCCAGGAGGCCACAGACTGG + Intergenic
956354195 3:68372854-68372876 AAGCCAAGGAATCCTCATACAGG + Intronic
956906821 3:73774579-73774601 AATGCAAGCAAGCCACAGAAAGG - Intergenic
960870975 3:122249496-122249518 AACCCATGGAACCCATTGACTGG + Intronic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
962992596 3:140592715-140592737 AAGTCAATGAAGCCACAGATAGG - Intergenic
965548436 3:169938879-169938901 AACCCAATGAAACCACAGAGAGG + Exonic
966579099 3:181539524-181539546 AACACAAGGAAACAACACACTGG + Intergenic
969247056 4:5941921-5941943 AACCCAAGAAAGACAAAGAAAGG - Intronic
970311828 4:14790777-14790799 AACCAAAAAAAGCCATAGACTGG + Intergenic
971743801 4:30552636-30552658 AACCCAAGGAAGAAAGAGAAAGG - Intergenic
972633346 4:40860531-40860553 AGCCCAAGGAAGACACACATAGG - Intronic
973775076 4:54234315-54234337 AACCTAAGGAAGGAAGAGACTGG + Intronic
973843615 4:54888584-54888606 AACCCAAGGAAGTCACTGGAAGG + Intergenic
975147129 4:70980677-70980699 TACCCAAGCAAGCAACAGAAGGG - Intronic
975737883 4:77399395-77399417 AACCCATGGTTTCCACAGACAGG - Intronic
977963788 4:103118470-103118492 AATCAAGAGAAGCCACAGACTGG - Intronic
978768269 4:112427537-112427559 AACACAAAGAAGTCACAGATCGG - Intronic
981944836 4:150329449-150329471 AAGCCATTGAAGCCACAGAAGGG - Intronic
986083407 5:4417561-4417583 AACCCCAGCAAGTCACAGGCTGG + Intergenic
986409857 5:7466622-7466644 CCCCCTAGGAAGCCACAGACTGG + Intronic
987020550 5:13866235-13866257 AGCCCCAGGAAGCCAGTGACAGG - Exonic
989367585 5:40674123-40674145 AACCCCAGAAATCCAAAGACTGG - Intergenic
990133894 5:52621374-52621396 ATCCCAAGAAAGCCACTAACAGG + Intergenic
993504966 5:88697600-88697622 AAACCAAGGAAAGCACAGTCTGG + Intergenic
994078375 5:95679233-95679255 AATCCTAGGAAGCCAGAGACAGG - Intronic
996831255 5:127743077-127743099 AGCCCAAGAGAGACACAGACAGG + Intergenic
997891724 5:137682965-137682987 AAGTCAAGGAAGTCACAGATGGG - Intronic
998967966 5:147561168-147561190 AACACAAGGAAGCATCATACTGG - Intergenic
1001932669 5:175684288-175684310 CCCCCCAGGGAGCCACAGACAGG + Exonic
1002680005 5:180954443-180954465 AAACTAAAGCAGCCACAGACAGG + Intergenic
1003444286 6:6170568-6170590 AAGCCAAGGGAGACACAGACTGG + Intronic
1003684841 6:8292261-8292283 AAGCTAACCAAGCCACAGACTGG - Intergenic
1005485523 6:26295546-26295568 AACCCATGGTTTCCACAGACAGG - Intergenic
1005521224 6:26602239-26602261 AGCCCAGGTCAGCCACAGACTGG - Intergenic
1006219774 6:32478786-32478808 AACCCATGGTTCCCACAGACAGG - Intergenic
1006229050 6:32566533-32566555 AACCCATGGTTCCCACAGACAGG - Intronic
1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG + Intergenic
1008722285 6:54370654-54370676 CACTCAAGGAAGCCACTGAGAGG + Intronic
1009411646 6:63372016-63372038 AACTCAAGGAAGACCCAGATTGG - Intergenic
1009792376 6:68420027-68420049 ACCACAAGGAAGCCACACAAAGG - Intergenic
1017573369 6:155773123-155773145 AAGAAAAGAAAGCCACAGACTGG - Intergenic
1019910164 7:4095479-4095501 TAGCCAAGGAAGCCAGAGTCAGG - Intronic
1019955689 7:4412571-4412593 AGCCCAAGCAGCCCACAGACTGG - Intergenic
1021653261 7:22852007-22852029 GACCCAAGGAAGCTACCGCCTGG + Intergenic
1021881101 7:25096343-25096365 AACCCAAGAAAGGCAATGACAGG - Intergenic
1023713561 7:43020267-43020289 TAGCCAAGGAAGCTACAGTCAGG - Intergenic
1023779581 7:43643421-43643443 AAGGCAAGGAAGCAACAGACAGG + Intronic
1029153999 7:98502091-98502113 CATACAAGGAAGACACAGACAGG - Intergenic
1029460132 7:100689537-100689559 AACTCCAGGACGCCACAGTCTGG + Intergenic
1029588975 7:101494706-101494728 AAGTCAAGGAAGCCACAGCAGGG + Intronic
1029935149 7:104416756-104416778 TACAACAGGAAGCCACAGACTGG + Intronic
1032238733 7:130145066-130145088 TAACCAAGCAAGCCACTGACAGG + Intergenic
1032266773 7:130375039-130375061 AACTTAAGGAGGCCACTGACTGG + Intergenic
1032434666 7:131890128-131890150 CATCCAGGGAGGCCACAGACAGG - Intergenic
1032467338 7:132154237-132154259 AACCCAAGGAAACACCTGACAGG + Intronic
1032761125 7:134943268-134943290 CACCTAAGGAAGCCAAGGACGGG + Intronic
1033476966 7:141701536-141701558 AACCCAACGTGGCCACAAACCGG + Intronic
1033725975 7:144118942-144118964 ACACCCAGGAAGCCACAGCCAGG + Intergenic
1033726984 7:144129538-144129560 ACACCCAGGAAGCCACAGCCAGG - Exonic
1035114043 7:156507714-156507736 AACTCATGAAAGCCAGAGACAGG - Intergenic
1035568564 8:658132-658154 AAGCCCTGGAAGCCAAAGACTGG - Intronic
1035634360 8:1132769-1132791 AACCCATGGAGGCCACACATTGG + Intergenic
1037728977 8:21507466-21507488 AACTCAAGGAAGGCATAGAGTGG + Intergenic
1037859618 8:22395781-22395803 AGGCAAAGCAAGCCACAGACAGG - Intronic
1037929507 8:22869608-22869630 AACTGAAGGAGGCCACAGACTGG + Intronic
1037969677 8:23163452-23163474 AACCTCAGGAAGCCACAGAGCGG - Intronic
1038151367 8:24944087-24944109 AAGGCAGGAAAGCCACAGACAGG + Intergenic
1038732327 8:30138704-30138726 AACCCATGGCAGCCACGGCCAGG + Exonic
1039424347 8:37473594-37473616 AAACCAAAGAACCCCCAGACTGG + Intergenic
1040275989 8:46013898-46013920 AAGCCAGGGAAGCCACTCACCGG + Intergenic
1041839729 8:62255389-62255411 AACCCATGGAAGCCAGGGAGAGG + Intronic
1045710306 8:104975444-104975466 AAGCCAAGGAAACCACAGGGAGG + Intronic
1048987771 8:139744421-139744443 AGCCCAAGGAAAGCTCAGACAGG + Intronic
1049296315 8:141841767-141841789 AAGCTAAAGAAGCCACAGAGGGG - Intergenic
1050434094 9:5591022-5591044 AACTCAAGCAACCCACAGGCCGG + Intergenic
1050470439 9:5983062-5983084 AACTCTAGGAAGTCACAGCCAGG - Intronic
1051314618 9:15815244-15815266 AACCCAAAGCAGCTACAGAAAGG - Intronic
1053564409 9:39233270-39233292 AAACCAGGGAAGACACAGGCTGG + Intronic
1053830190 9:42071171-42071193 AAACCAGGGAAGACACAGGCTGG + Intronic
1054132741 9:61385766-61385788 AAACCAGGGAAGACACAGGCTGG - Intergenic
1054600369 9:67116281-67116303 AAACCAGGGAAGACACAGGCTGG - Intergenic
1055480886 9:76708266-76708288 AAGCCCAGGGAGCCACTGACAGG - Exonic
1059901238 9:118928518-118928540 AACCCATGGAAGACAGAGCCAGG - Intergenic
1062198507 9:135287955-135287977 AACCCCTGGGAGCCGCAGACTGG + Intergenic
1062327876 9:136021085-136021107 AAAACAAGCTAGCCACAGACTGG + Intronic
1062466923 9:136685693-136685715 ACCCCAAGGAACCCACAGACTGG + Intronic
1062571753 9:137188974-137188996 CACCCGAGGAAGCCAGAGTCAGG - Intronic
1062652250 9:137583970-137583992 ACCACAGGGAGGCCACAGACTGG + Intronic
1185672372 X:1823367-1823389 AACCCAAGCAAATAACAGACAGG + Intergenic
1187494454 X:19782485-19782507 ATCCCAAGACAGCCAGAGACTGG + Intronic
1188101581 X:26094602-26094624 AACCCAAGGATGGGACAGAAAGG - Intergenic
1189456346 X:41194084-41194106 AACCCAAGTAAACCAAAGTCAGG - Intronic
1189510431 X:41656328-41656350 AACCCTGGGAGGCCACAGATGGG + Intronic
1194375764 X:93132150-93132172 AACCCCACAAAACCACAGACTGG - Intergenic
1194897856 X:99468360-99468382 AACCGAATGAAGCCTCAGAATGG + Intergenic
1195366614 X:104132664-104132686 AACCCAAGGCAGGCAGAAACTGG + Intronic
1199429793 X:147746043-147746065 TAGCCAAGGAAGCCACAAAAGGG - Intergenic
1199627074 X:149750628-149750650 AACCCAGGGAAGCCCCAGGTTGG + Intergenic
1200052480 X:153442342-153442364 AACCCCAGGATGGGACAGACAGG - Intergenic
1201349834 Y:13027618-13027640 AACCAAGGGAAGGCACAGACAGG + Intergenic
1201901757 Y:19050667-19050689 AAACAAAGGAAGCCACAGAGGGG - Intergenic