ID: 905110246

View in Genome Browser
Species Human (GRCh38)
Location 1:35589611-35589633
Sequence AGGGCCACACACACCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905110246_905110249 -9 Left 905110246 1:35589611-35589633 CCCTGGTAGGTGTGTGTGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 177
Right 905110249 1:35589625-35589647 TGTGGCCCTCTGGTGTGCTAAGG 0: 1
1: 0
2: 0
3: 11
4: 121
905110246_905110252 -1 Left 905110246 1:35589611-35589633 CCCTGGTAGGTGTGTGTGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 177
Right 905110252 1:35589633-35589655 TCTGGTGTGCTAAGGTCCCCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
905110246_905110253 13 Left 905110246 1:35589611-35589633 CCCTGGTAGGTGTGTGTGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 177
Right 905110253 1:35589647-35589669 GTCCCCAGGATGCCCCACCCTGG 0: 1
1: 0
2: 2
3: 29
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905110246 Original CRISPR AGGGCCACACACACCTACCA GGG (reversed) Intronic
900142316 1:1143808-1143830 AGGGTCACACACACGATCCAGGG - Intergenic
900998319 1:6134655-6134677 GCGGCCACAGGCACCTACCATGG + Intronic
901843352 1:11966899-11966921 AGGGCCACACACCCAAGCCAGGG - Intronic
902331471 1:15733033-15733055 AGTCCCACACCCACCTCCCAGGG - Intronic
902331995 1:15735280-15735302 AGTCCCACACCCACCTCCCAGGG - Intergenic
902439677 1:16421369-16421391 ACAGCCACACACACCTTCCTTGG + Intronic
902621628 1:17654221-17654243 AGGGCCACGCACAGAAACCAGGG - Intronic
904028294 1:27518677-27518699 AGGGCCCCAGTCTCCTACCAAGG - Intergenic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
905347253 1:37319451-37319473 AGGGGCACACACACCCCCCCAGG - Intergenic
906541874 1:46592984-46593006 AGGGTGACACACAGCCACCAGGG + Intronic
908059249 1:60329187-60329209 AGGGCCACACACACATATTGTGG + Intergenic
913100590 1:115560554-115560576 AGTGCCATACTCACCTTCCAGGG + Intergenic
915113268 1:153578400-153578422 GGGGCCCCACACACCCACCTGGG + Intergenic
915317375 1:155036748-155036770 AGGTCCACACACAGCCTCCAAGG - Intronic
916502810 1:165401204-165401226 GGGTCCACACACACCTGCCCAGG + Exonic
920948086 1:210548217-210548239 AGGGCCAGACCCAATTACCAAGG + Intronic
923862082 1:237901516-237901538 AGGGCCACAGTCAGCTTCCAGGG - Intergenic
923885283 1:238147620-238147642 AGGGCCAAACATAACTACTAGGG + Intergenic
1063121958 10:3111475-3111497 AGGGCAAGTGACACCTACCACGG - Intronic
1070843645 10:79505169-79505191 AGGGCCACACAGAGCTGCCATGG - Intergenic
1070930021 10:80254431-80254453 AGGGCCACACAGAGCTGCCATGG + Intergenic
1072197543 10:93129452-93129474 AGGGACACAGACACCAAGCAAGG + Intergenic
1072693232 10:97584940-97584962 AGGGCCACTCACATCTCCCCAGG - Intronic
1072856877 10:98956733-98956755 AGGGCCACACTCAGCTGCAAGGG + Intronic
1073986200 10:109212258-109212280 AGGGCCACACACACTTGTCATGG + Intergenic
1076492883 10:130875517-130875539 AGGGCCACACACACAAACCTGGG + Intergenic
1077312342 11:1894852-1894874 AGTTTCACACACACCTCCCACGG - Intergenic
1081617390 11:44598952-44598974 AGGGCCACCCCCACCTCCAAAGG + Intronic
1081931889 11:46877185-46877207 AGGGCCATACAGACCTTCCTGGG + Exonic
1085793743 11:79518328-79518350 TGAGTCACAAACACCTACCATGG - Intergenic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1090378568 11:126308964-126308986 AGGGCCACCCCCACCCACCTGGG + Intronic
1091330639 11:134728684-134728706 AGGGCCACACACACGTGTCATGG - Intergenic
1092853972 12:12655793-12655815 AGTGCCACCCACACTTGCCAGGG - Intergenic
1094600849 12:31907726-31907748 AGGGGCATAATCACCTACCAGGG - Intergenic
1095941330 12:47729068-47729090 AGGCCCAGACTCACCTCCCAAGG + Intergenic
1096588586 12:52642449-52642471 TGGGCCACACCCTCCCACCAGGG - Intergenic
1104065291 12:125300441-125300463 AGGGCCACACACAGGGGCCAAGG - Intronic
1105431214 13:20339456-20339478 AGGGGCTCACACAGGTACCATGG + Intergenic
1106647169 13:31649032-31649054 AAGGCCACAGACACCTTGCATGG - Intergenic
1110222546 13:73089021-73089043 TGGGCCACACACATCTACTCAGG - Intergenic
1114650029 14:24278804-24278826 TGGGCCACACACTCCTCACAGGG - Intergenic
1115731140 14:36271289-36271311 AGAGCCACACACCCTAACCAAGG - Intergenic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1119021101 14:71116196-71116218 AGGGGAAAACACACCTAACATGG - Intergenic
1122167878 14:99843793-99843815 GGGTCAACACACACCTACCTGGG - Intronic
1125509580 15:40285751-40285773 TGGGCCACACACAGGTTCCAGGG - Intronic
1127520481 15:59738797-59738819 AGGGTCACCCACACCTAGCTGGG - Intergenic
1127857893 15:62967538-62967560 AGGGCCTTGCACACCTAACAAGG - Intergenic
1129210605 15:74065842-74065864 AAGGCCACACACCCTTTCCAAGG + Intergenic
1129226043 15:74171024-74171046 AGGGCCGCACATACTCACCAAGG + Intergenic
1129403405 15:75299487-75299509 AAGGCCACACACCCTTTCCAAGG - Intergenic
1131442750 15:92471309-92471331 AGGGCCACTTCCACCTTCCAGGG - Intergenic
1131668409 15:94594761-94594783 ACGGCCACACACATCCAGCAAGG - Intergenic
1135058342 16:19249789-19249811 ATGGCCAGAAACACCAACCAGGG - Intronic
1135272396 16:21080718-21080740 GGTGCCACACTCACCTAACAGGG + Intronic
1138007964 16:53355205-53355227 CAGGCCACAGACACCCACCAGGG - Intergenic
1138194958 16:55045148-55045170 AGATCCACACACACTTATCACGG - Intergenic
1138415747 16:56870421-56870443 AAGGCCACACACACCCCCAAAGG - Intronic
1138660253 16:58512362-58512384 AGGGGCACACACACCACACATGG - Exonic
1139734395 16:68974699-68974721 AGGGCCCAACACAGCTCCCAGGG - Intronic
1140511582 16:75512588-75512610 AGGGGCACACCCACGAACCAGGG - Intergenic
1140577374 16:76186812-76186834 AGGGAAACCCACACCCACCATGG + Intergenic
1141424405 16:83935848-83935870 AGGGCCTCACCCACCCACCCAGG + Intronic
1142407015 16:89895935-89895957 ATGGCCACACACAGCAACCACGG - Intronic
1143363179 17:6387861-6387883 AGGGCCAGATACACCTTCCCGGG + Intergenic
1144626650 17:16847348-16847370 AGGGCCACACAGACTTTCCAAGG - Intergenic
1144835158 17:18153011-18153033 TGTGCCACCCACACCTGCCATGG + Intronic
1144879782 17:18425363-18425385 AGGGCCACACATACTTTCCAAGG + Intergenic
1145152452 17:20519021-20519043 AGGGCCACACAGACTTTCCAAGG - Intergenic
1147547412 17:41413174-41413196 AGGGCCTCACCCACCTTCCCAGG + Intergenic
1147580791 17:41626038-41626060 AGGGCCACACAGACTTTCCAAGG - Intergenic
1151349788 17:73525021-73525043 AGGGCCACACAGGCCTAGGAAGG - Intronic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1151724407 17:75876055-75876077 AGGGCCACACCCATCCTCCAGGG + Exonic
1152785195 17:82244134-82244156 ACGGGCACACACACACACCACGG + Exonic
1152934791 17:83129901-83129923 AGGGACTCACACACCCAGCACGG + Intergenic
1160658714 19:288226-288248 GGGGCCCCACACACCTGCCTTGG + Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1165441557 19:35831278-35831300 AGGGCCACCCCCACTTACCGTGG + Exonic
1166258887 19:41624605-41624627 AGGTCCACAGACACCTAGTAAGG + Intronic
1166277003 19:41761111-41761133 TGTGACACACACACCTGCCAGGG + Intronic
1166424184 19:42661511-42661533 TGTGACACACACACCTGCCATGG + Intronic
1166516469 19:43450913-43450935 AGTGCCACACACACATCTCAGGG - Intergenic
1167140515 19:47647612-47647634 TGGGCCACACACACGTGCCAAGG - Intronic
925276494 2:2652609-2652631 AGGGCCACACATACAAGCCAGGG + Intergenic
926153915 2:10440096-10440118 AGGGCCTCCCACACCTTCCCTGG + Exonic
927182477 2:20456418-20456440 AGGGCTACAAACACAGACCATGG + Intergenic
928356444 2:30620833-30620855 AGGTCCACAAACCCCTCCCATGG + Intronic
928391827 2:30916462-30916484 AGGGTCACCCACACCAACTAAGG - Intronic
933970821 2:87468611-87468633 AGGGCCCCACCCACCCAACAGGG - Intergenic
933996863 2:87676499-87676521 AAGGCCACACTCACCCCCCAAGG + Intergenic
935757098 2:106284758-106284780 AGGCTCACCCACACCTTCCAGGG + Intergenic
935839940 2:107098275-107098297 AGAGCCTCACACACCTTCTAAGG + Intergenic
936112458 2:109676229-109676251 AGGCTCACTCACACCTTCCAGGG - Intergenic
936296988 2:111274411-111274433 AAGGCCACACTCACCCCCCAAGG - Intergenic
936322909 2:111481585-111481607 AGGGCCCCACCCACCCAACAGGG + Intergenic
937296383 2:120812258-120812280 AGGGCCACACACACATGTCGCGG + Intronic
937726838 2:125176512-125176534 AGGGACACACATTCCTCCCATGG - Intergenic
938289101 2:130140150-130140172 AGGGCCACCCCCACCACCCAGGG + Intronic
938467427 2:131532788-131532810 AGGGCCACCCCCACCACCCAGGG - Intronic
941554469 2:166959302-166959324 AGGGCTACAGAGACCTTCCATGG + Intronic
942038139 2:172031360-172031382 AGGGAGACACTCCCCTACCAGGG + Intronic
948153067 2:235759651-235759673 AGACCCACACAAACCCACCAAGG - Intronic
948495365 2:238345369-238345391 TGGGCCACCCTCACCAACCAAGG - Intronic
949073224 2:242039226-242039248 AGGGACACACCCACCCACCCTGG - Intergenic
1170848480 20:19982234-19982256 AGGGCCACGCACAGCTTCCCGGG - Intronic
1172226246 20:33306983-33307005 AGGGCCACACCCACTCACCTTGG - Exonic
1172464180 20:35143310-35143332 AGGGACAAACACAGCTAACATGG + Intronic
1172845897 20:37929846-37929868 AGGGCCACCCCCTCCTTCCAGGG - Intronic
1173873914 20:46357890-46357912 AGGGCCCTACACACATAGCAAGG - Intronic
1175271521 20:57737397-57737419 AGGAGCACACACACCTAGCCTGG - Intergenic
1175806163 20:61830423-61830445 AGGGCAGCACACACCTCCCGGGG + Intronic
1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG + Intronic
1175945524 20:62556750-62556772 ATGGCCACACAAACCCACCTGGG - Intronic
1176077208 20:63254049-63254071 GGGGCCACACACGCCTCCCCAGG + Intronic
1176371640 21:6065939-6065961 TGGGCCCCACACACCTCTCATGG + Intergenic
1176388704 21:6152423-6152445 AGGGACACCCACACACACCACGG + Intergenic
1176388713 21:6152464-6152486 AGGGACACCCACACACACCAGGG + Intergenic
1176388740 21:6152591-6152613 AGGGACCCACACACACACCAGGG + Intergenic
1178425346 21:32474571-32474593 TGAACCACACACACATACCATGG - Intronic
1178810436 21:35876767-35876789 AGGGCCACACCCAGCTTCAAGGG - Intronic
1179585321 21:42370716-42370738 AGAGCCACACACACCCAGAAAGG + Intergenic
1179734732 21:43385657-43385679 AGGGACCCACACACACACCAGGG - Intergenic
1179734759 21:43385784-43385806 AGGGACACCCACACACACCAGGG - Intergenic
1179734768 21:43385825-43385847 AGGGACACCCACACACACCACGG - Intergenic
1179751879 21:43472600-43472622 TGGGCCCCACACACCTCTCATGG - Intergenic
1181425921 22:22838649-22838671 AGGGCCAGGATCACCTACCAGGG + Intronic
1181635933 22:24174886-24174908 TAGGCCACACACACCTCCCTGGG + Intronic
1182993927 22:34795479-34795501 AGACACACACACACCCACCATGG + Intergenic
1184259495 22:43306542-43306564 ACGAACACACACTCCTACCAAGG + Intronic
1184283019 22:43449653-43449675 AGGGCCACACACATGCATCAGGG + Intronic
1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG + Intergenic
1185167894 22:49272982-49273004 AGGTCCAAAAACACCTGCCATGG + Intergenic
949533241 3:4977751-4977773 AGGGCCCCACCCACCTCCCCCGG - Intergenic
950645599 3:14374785-14374807 ATGTCCACAGCCACCTACCAGGG + Intergenic
951980777 3:28564107-28564129 AGCCCCACACACCCCCACCACGG - Intergenic
953980201 3:47409826-47409848 AGGGCCACACAAACCTGTCCAGG - Exonic
954569347 3:51627559-51627581 AGTGCCACACATGCCTTCCAGGG - Exonic
956699090 3:71942910-71942932 AAGGCCACAGACTGCTACCAGGG - Intergenic
961865312 3:129949503-129949525 AGGGCCTCTCACACCCACCATGG - Intergenic
968059779 3:195718649-195718671 GGGGCCACTCACCCCTTCCAGGG + Intergenic
968462151 4:731511-731533 AGGGCCACGCCCACCCACGAGGG - Intronic
969603793 4:8191777-8191799 ATGGCCCCGCACACCTCCCAAGG - Intronic
976916572 4:90383593-90383615 AAGGCCACACACACACACGAAGG + Intronic
979808559 4:125005717-125005739 AGAGCCAAACAAACCTAACATGG - Intergenic
980931240 4:139185096-139185118 AAGGCCAAACACACCTGGCATGG - Intergenic
985425729 4:189828546-189828568 AGGGTCACACCCATTTACCACGG + Intergenic
985822776 5:2171315-2171337 AGGGACAGACACTCCAACCATGG - Intergenic
994145933 5:96394850-96394872 AGAGCCACACAGACCTCCCCTGG + Exonic
998281187 5:140808931-140808953 TGGCCCACACCCACCGACCATGG - Exonic
999192622 5:149759817-149759839 GGGGCCACCCACACCCACCCTGG + Intronic
1006131147 6:31870254-31870276 ACTGCCACACACACCTGCCAAGG - Intronic
1007073354 6:39051737-39051759 AGGGTCACTCACACATACCTGGG - Intronic
1007381253 6:41491687-41491709 AGGGCCCCACAGTCCTCCCAGGG + Intergenic
1010184159 6:73123492-73123514 AGGGACACTCAAACCTGCCAGGG + Intronic
1014899776 6:126948444-126948466 AGAGACACACACACCTCCCAAGG + Intergenic
1015728861 6:136327493-136327515 AGGGCCACACACATTTATTAAGG - Intergenic
1017036772 6:150274143-150274165 ATAGCCACACACATCTCCCAGGG + Intergenic
1018931497 6:168243001-168243023 AGAGCCACACACACACTCCAAGG - Intergenic
1019246690 6:170714094-170714116 AGGGCCACACACACTCACAGCGG - Intergenic
1019263051 7:93095-93117 AGGGCCACCCACACCAGGCACGG + Intergenic
1020022912 7:4879693-4879715 AGGGCCACAGAAAGCAACCAGGG + Intronic
1023924497 7:44656165-44656187 AGGGACACACACACACATCAAGG - Intronic
1023983271 7:45081698-45081720 AGGGCCCCACACCCCACCCATGG - Intronic
1026127286 7:67590029-67590051 AGGGCCATCCACACCCACAAGGG - Intergenic
1026374851 7:69740120-69740142 AGGGCCAGACACACTTCCCCAGG - Intronic
1029172216 7:98639271-98639293 GAGGCCACACAGCCCTACCAGGG + Intergenic
1030045740 7:105493694-105493716 GGGGACACACACAGATACCAGGG + Intronic
1032059114 7:128708946-128708968 AGGGCCACACCCAGATACAAGGG - Intergenic
1034085578 7:148319491-148319513 AGGGCCATGGACACCTACCGTGG + Intronic
1034710214 7:153184698-153184720 AGAGCCTAACACAACTACCAAGG - Intergenic
1035384227 7:158459577-158459599 AGGGCCACACACACATGACTCGG + Intronic
1036808440 8:11851057-11851079 TGGGCCACACTCCCCTAACAAGG + Intronic
1039896787 8:41722412-41722434 AGGCCCACTCACAGCTACCCAGG - Intronic
1042484711 8:69337084-69337106 AGGGCCACACCCACCCACCCTGG - Intergenic
1044883786 8:96752812-96752834 AGGGGCACAAACTCATACCAAGG - Intronic
1045238638 8:100378306-100378328 AGGGCCACACCTAGCTAGCAAGG + Intronic
1048037869 8:130694032-130694054 AGGGCACCACACTCCTGCCATGG - Intergenic
1048829292 8:138460410-138460432 AGGGTGAAACACACCTACCCTGG + Intronic
1049015354 8:139916018-139916040 AGGCCCACACAAATCTTCCAAGG + Intronic
1051058423 9:13016285-13016307 AAGGCCACACACAACTGCAAGGG + Intergenic
1051595571 9:18821507-18821529 ATGGCCACGCACAACTACAAAGG + Intronic
1056589257 9:87952204-87952226 TGGGCAACACACTCCTGCCATGG - Intergenic
1056779042 9:89535723-89535745 ATGGACACCCACACCTGCCAGGG + Intergenic
1058766038 9:108183588-108183610 AGAGACACACAGACCTACAAAGG - Intergenic
1060927078 9:127462470-127462492 AGGGCCACACAGAGATCCCAAGG + Intronic
1062321192 9:135991183-135991205 AGGGCCACTGGCACCTCCCAGGG + Intergenic
1062429127 9:136519210-136519232 CGGCCCACACAGACCAACCAGGG + Intronic
1186247390 X:7628738-7628760 AGGGCCACAAACATTTTCCAGGG + Intergenic
1189462076 X:41250947-41250969 AGGGCCAGACACAGCTGCAAAGG + Intergenic
1190797533 X:53759216-53759238 AGGGCCACACACACCCAGATGGG + Intergenic
1193767222 X:85544394-85544416 AGGGCAACACAAAACTGCCAAGG + Intergenic