ID: 905110396

View in Genome Browser
Species Human (GRCh38)
Location 1:35590447-35590469
Sequence CAACCCTAATGGCCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905110389_905110396 4 Left 905110389 1:35590420-35590442 CCAGCTCCCATCTCTGAGCTCAG 0: 1
1: 0
2: 1
3: 61
4: 487
Right 905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
905110387_905110396 25 Left 905110387 1:35590399-35590421 CCTCTGGAATACATGGTGGGCCC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
905110390_905110396 -2 Left 905110390 1:35590426-35590448 CCCATCTCTGAGCTCAGAGCCCA 0: 1
1: 0
2: 5
3: 44
4: 355
Right 905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
905110388_905110396 5 Left 905110388 1:35590419-35590441 CCCAGCTCCCATCTCTGAGCTCA 0: 1
1: 0
2: 3
3: 33
4: 434
Right 905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
905110391_905110396 -3 Left 905110391 1:35590427-35590449 CCATCTCTGAGCTCAGAGCCCAA 0: 1
1: 0
2: 2
3: 29
4: 390
Right 905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905110396 Original CRISPR CAACCCTAATGGCCCCAAGG TGG Intronic
901036090 1:6337131-6337153 CAGCCCTGATGTCCCCAGGGAGG + Intronic
901142468 1:7044029-7044051 CAGCCCTAATGGCCCTCTGGAGG - Intronic
905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG + Intronic
905483622 1:38279775-38279797 CAAGTGTAAAGGCCCCAAGGTGG - Intergenic
908625402 1:66035026-66035048 CATCCCTAAGGGACCCAAGTAGG - Intronic
911730608 1:101288604-101288626 CAGCCCTAATGACCACTAGGTGG - Intergenic
917777812 1:178356422-178356444 CATCCATAATGGCCCCAAAATGG + Intronic
1065662950 10:28025125-28025147 CAACCCTAATGTCCTTAAGTGGG - Intergenic
1068805171 10:61187103-61187125 TAACCCCACTGGCCCCAACGAGG + Intergenic
1070225603 10:74501605-74501627 CAACCCAAATGTCCACAAGCAGG + Intronic
1073127662 10:101161908-101161930 CACCCTGAATGGCCACAAGGGGG + Intergenic
1075984663 10:126774245-126774267 TAACCCTGATGGCCCCACAGAGG - Intergenic
1077532276 11:3102987-3103009 CATCCCTCAAGGCCCCAAGCTGG - Intronic
1082009633 11:47441544-47441566 CTAACCTACTGGCCCCAAGTGGG + Intronic
1084469246 11:69346005-69346027 TATTCCTAATGGCCCCAAGCTGG - Intronic
1096676811 12:53230626-53230648 CCACCCTACTAGCCCCAGGGAGG + Intronic
1098085971 12:66844392-66844414 CCATCCTAATGGGTCCAAGGTGG - Intergenic
1101432621 12:104639331-104639353 CAATCCTAAAGGCCCCAAACTGG + Intronic
1102194214 12:111012991-111013013 TTCCCCTAATGGCCCCAAAGTGG + Intergenic
1102549571 12:113681918-113681940 GAATCCCAATGGCCCCCAGGGGG - Intergenic
1103601939 12:122059895-122059917 CAGTCCTAAACGCCCCAAGGAGG - Exonic
1104935128 12:132360384-132360406 CAACCCAAATGGACCCTCGGAGG + Intergenic
1106100026 13:26686585-26686607 CATCCCCAATGGCCCCAGGAAGG - Exonic
1113323036 13:109255506-109255528 AAACCCTAATTGCTTCAAGGTGG + Intergenic
1114370941 14:22087409-22087431 TAACCATAATAGCCCCAAGCTGG + Intergenic
1117061056 14:51964403-51964425 CAACCCTAATTGACACAAAGAGG - Intronic
1119336414 14:73837245-73837267 AAAGCCAAAGGGCCCCAAGGAGG - Intergenic
1122406459 14:101503933-101503955 CAACCTTGTTGGCCCCATGGAGG + Intergenic
1122634796 14:103124807-103124829 CAACCCAAATGGCACTAGGGAGG + Intronic
1123046586 14:105520404-105520426 CATCCATAATGGCCAAAAGGTGG + Intergenic
1123943001 15:25225634-25225656 AAACCCTCATGGCCAGAAGGGGG - Intergenic
1124702406 15:31927502-31927524 CAATCCTAATGGCAGCAAGGTGG - Intergenic
1124856415 15:33393573-33393595 CAACCATAATGGGCTCAAGTGGG - Intronic
1138457337 16:57128989-57129011 GAAGCCTGATGGCCCCAAGCTGG - Intronic
1141496542 16:84414348-84414370 CAACCCCAGTGGGCACAAGGTGG - Intronic
1143623384 17:8094009-8094031 CACCCCTGGTGGCCACAAGGGGG + Intergenic
1143746477 17:8998157-8998179 CAACAAAAATGGCCCCCAGGTGG - Intergenic
1146302415 17:31699861-31699883 CAAGTCTAATGACCCCAAAGGGG - Intergenic
1146472303 17:33134369-33134391 CAACATTGATTGCCCCAAGGAGG + Intronic
1149881958 17:60301089-60301111 CAACCCTAATGTCCACCAGCTGG - Intronic
1155721640 18:29020718-29020740 CAACCCTGACTCCCCCAAGGGGG + Intergenic
1161383293 19:3977716-3977738 AGACCCTAATGGGGCCAAGGCGG - Intronic
927093252 2:19728416-19728438 CTGCCCCAGTGGCCCCAAGGCGG - Intergenic
929568954 2:43007726-43007748 CAACCCTCATGGTCCCCAGATGG + Intergenic
932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG + Intergenic
932777000 2:74534367-74534389 CACCCCAAATGGCACCAAGGTGG - Exonic
932977750 2:76624961-76624983 CAACCCCAATGGTCCAGAGGAGG - Intergenic
933973882 2:87492340-87492362 CAACCCTCATGATCCCGAGGTGG + Intergenic
934661931 2:96147718-96147740 CAAGACAAATGGCCTCAAGGGGG - Intergenic
940029642 2:149247953-149247975 CGTTCCTAATGGCCCCAAGGTGG - Intergenic
945750029 2:213770174-213770196 CATTCCTAATAGCCCCAAGCTGG - Intronic
946502238 2:220261806-220261828 CAACTCAAATAGCCCAAAGGTGG - Intergenic
1173145729 20:40522488-40522510 CTACTCTAATGGGCCCATGGGGG + Intergenic
1182113230 22:27739276-27739298 CAATCATAGTGGCCCCATGGTGG + Intergenic
952041267 3:29264604-29264626 CCACCCTGATGGTCCCAAGATGG - Intergenic
953556938 3:43953321-43953343 CAGCCCTAATTTCACCAAGGGGG - Intergenic
956558119 3:70543560-70543582 CAACCCTAAAGCCCCAGAGGAGG + Intergenic
956845140 3:73175602-73175624 CAACTCAAATGGCTCCAAGCAGG - Intergenic
961512560 3:127412033-127412055 CAGCCCTAACAGCCCTAAGGCGG + Intergenic
972917639 4:43901124-43901146 CATCCCTAATGGCCTCAAATCGG - Intergenic
981256969 4:142673453-142673475 CAGTCCTAATTGCCACAAGGAGG + Intronic
983850190 4:172570615-172570637 CAACCTTTATGGCACCAGGGAGG + Intronic
985124806 4:186682810-186682832 CACCACTGAGGGCCCCAAGGGGG + Intronic
986875463 5:12102385-12102407 CCAACCTAATGTCCCCAAGTTGG - Intergenic
998584511 5:143412800-143412822 CAACCCTAATGACCAGAAGAAGG + Intronic
1003367553 6:5490030-5490052 CAACCGAAAGGGCCACAAGGAGG - Intronic
1005243030 6:23853904-23853926 CACCCCTAATAGCCCCACAGGGG + Intergenic
1006946946 6:37791053-37791075 CAACCCCATTGTCCCCAAGCTGG - Intergenic
1017009115 6:150050906-150050928 CAGCCCTAAGGGCCCCAACCTGG + Intergenic
1019705101 7:2493828-2493850 CACCTCTAGTGGCCCCAAGAAGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022565066 7:31391437-31391459 CCACCCCAAAGGCCTCAAGGAGG + Intergenic
1023565014 7:41515549-41515571 CTTCCCTCATGGCCCCAAGTTGG - Intergenic
1034341783 7:150361903-150361925 CAACTCCAAAGGCCCTAAGGTGG + Intergenic
1035689281 8:1549209-1549231 CAACGCCAACGGCACCAAGGCGG + Exonic
1037988326 8:23303333-23303355 GAACCTCAATGGCACCAAGGTGG - Exonic
1044684470 8:94813642-94813664 TATCCCTAATGGCCACAAGATGG + Intronic
1045216153 8:100150532-100150554 CAACCCGGATGGCGCAAAGGCGG - Intergenic
1048028948 8:130613017-130613039 CTACCCTCCTGGCCCCAAAGAGG - Intergenic
1049750764 8:144282580-144282602 CAAACCCACTGGCCCCAAGGAGG + Intronic
1056661305 9:88545631-88545653 CAACCCACAGGGCCCCCAGGAGG - Intronic
1056728602 9:89143946-89143968 CCACCCTAAGGCCCCCAAGAAGG - Intronic
1059294910 9:113261717-113261739 CAACCCAAAAGCCCCCAAAGTGG + Exonic
1059307527 9:113366554-113366576 CAAAACTCATGGCCCCAAAGGGG - Intronic
1060281610 9:122219239-122219261 CAACCCTACTGTCTCCAACGAGG + Intronic
1062285460 9:135770725-135770747 GACCCCAAATGGCCCCCAGGAGG + Intronic
1203371317 Un_KI270442v1:308359-308381 CAACACTACTGGCCCATAGGGGG + Intergenic