ID: 905115049

View in Genome Browser
Species Human (GRCh38)
Location 1:35631435-35631457
Sequence TACTCTGAGTGTACAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905115049_905115050 -4 Left 905115049 1:35631435-35631457 CCATCTTTTGTACACTCAGAGTA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 905115050 1:35631454-35631476 AGTAAACAAAGCATAGACTGAGG 0: 1
1: 0
2: 1
3: 23
4: 324
905115049_905115052 -2 Left 905115049 1:35631435-35631457 CCATCTTTTGTACACTCAGAGTA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 905115052 1:35631456-35631478 TAAACAAAGCATAGACTGAGGGG 0: 1
1: 0
2: 3
3: 21
4: 280
905115049_905115051 -3 Left 905115049 1:35631435-35631457 CCATCTTTTGTACACTCAGAGTA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 905115051 1:35631455-35631477 GTAAACAAAGCATAGACTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905115049 Original CRISPR TACTCTGAGTGTACAAAAGA TGG (reversed) Intronic
900277978 1:1845198-1845220 TACTCTAACTGTACAAACGTGGG + Intronic
902274999 1:15333129-15333151 TCTGCTGAGTGGACAAAAGATGG - Intronic
902347916 1:15832545-15832567 TACTTTTATTGTACAAAAAATGG - Intergenic
905115049 1:35631435-35631457 TACTCTGAGTGTACAAAAGATGG - Intronic
906799634 1:48724968-48724990 GACTCTAAGTGTACAAGTGAGGG + Intronic
911796613 1:102084606-102084628 TACACAGAGTGTCTAAAAGATGG - Intergenic
916160445 1:161906705-161906727 AACTATTAGTGTACAACAGATGG - Intronic
916512165 1:165482071-165482093 TACTCCGAGTATATGAAAGAGGG + Intergenic
918111761 1:181460969-181460991 TACTATGAGTGGAGTAAAGAGGG - Intronic
919980390 1:202639317-202639339 TGCTCTGATTTTAGAAAAGATGG + Intronic
1063631903 10:7741871-7741893 TATTCTGAGTGTACAGAATGAGG - Intronic
1064084246 10:12333327-12333349 TTTTCTGAGTGTACAAAACTTGG + Intergenic
1065478043 10:26162239-26162261 TACTCTGAGAGCATAAAGGAAGG + Intronic
1075752909 10:124788294-124788316 TACACTGAATATAGAAAAGAGGG - Intronic
1080523624 11:33090649-33090671 TACTCAAAGTGGAGAAAAGACGG - Exonic
1082188955 11:49218489-49218511 TACTATGACAGCACAAAAGATGG - Intergenic
1084389719 11:68867175-68867197 TGCTCAGAGTGCATAAAAGAAGG - Intergenic
1085050397 11:73377173-73377195 TACTGTGAGTGTGAAATAGAGGG + Intronic
1088181114 11:107112747-107112769 TACACTCAGTGGAAAAAAGAAGG + Intergenic
1088500199 11:110475294-110475316 TACTCTGAGTTCACTGAAGATGG - Intergenic
1093506962 12:19878915-19878937 TATTCTGGATGCACAAAAGAAGG + Intergenic
1094261725 12:28508145-28508167 GGATCTGAGTGTACAAAACATGG - Intronic
1096552030 12:52379261-52379283 TTCTCTGAGTGGGCAAAACAGGG + Intronic
1097300318 12:58011327-58011349 CACACTGAGTATGCAAAAGAGGG - Intergenic
1097883215 12:64704811-64704833 TACTATGAGTGTATAACAGGAGG + Intergenic
1098334378 12:69387524-69387546 TACTCTGAGTGTACATCAATAGG + Intronic
1098700553 12:73619513-73619535 TACTGTAAGTTTACCAAAGATGG + Intergenic
1100793485 12:98155729-98155751 TACTCTGAGTGCACACAAAGGGG - Intergenic
1104311735 12:127659277-127659299 TACTCTGAATTTACAAAATTTGG + Intergenic
1108517119 13:51214032-51214054 TCCTCTGAATGCATAAAAGAGGG + Intergenic
1108574232 13:51777888-51777910 TACTCTGTGTTTACAAAAAAGGG + Intronic
1112377575 13:98857649-98857671 AAATCTGAGTGTTCAACAGAGGG - Intronic
1115079028 14:29428233-29428255 TACTCTGTGAGTACAGAGGAGGG + Intergenic
1115453830 14:33578501-33578523 ACCCCTGAGTGTGCAAAAGACGG - Intronic
1116057230 14:39878464-39878486 TACTCTTGGTGGACAAATGAAGG - Intergenic
1117083637 14:52177449-52177471 TGCTCTGATTGTAGAACAGAGGG - Intergenic
1118939530 14:70319797-70319819 TTCTCTAACTGTACAACAGAAGG - Intergenic
1120877199 14:89385846-89385868 TACTGTGAGTGTACATGAGAGGG + Intronic
1121038435 14:90725893-90725915 TACCCTTTGTTTACAAAAGATGG + Intronic
1125456635 15:39867115-39867137 TACTCTGAGAGTAGAGAGGAAGG + Intronic
1126193048 15:45899102-45899124 TACACTGACTGGACAAAGGAAGG - Intergenic
1129570161 15:76673845-76673867 GACTCTCACTGAACAAAAGATGG + Intronic
1129655462 15:77521690-77521712 TACTTTGTGTGTAAGAAAGAAGG + Intergenic
1133844549 16:9441772-9441794 TACTCTGAGAGTTCAAAGGAAGG - Intergenic
1135052715 16:19205391-19205413 TAACCTGAGTGAAGAAAAGAGGG - Intronic
1139072109 16:63395017-63395039 TACTCAGAGTCTACTAAAGTTGG + Intergenic
1140545232 16:75801474-75801496 TAATCAGATTGTCCAAAAGAGGG + Intergenic
1140598549 16:76446099-76446121 ACCTCTGAGTCTTCAAAAGATGG + Intronic
1140786589 16:78348234-78348256 TACTGTGACTGTAATAAAGAGGG + Intronic
1144062187 17:11592710-11592732 AATTCTGAGTGTCCAAGAGAAGG - Intergenic
1147006797 17:37409794-37409816 AGCTGTGAGTGTACAGAAGAAGG + Intronic
1151433908 17:74082407-74082429 CACTCTGAGTGTCTAAAAGGGGG + Intergenic
1153724280 18:7939638-7939660 TTCACTAAGTGGACAAAAGATGG + Intronic
1153821066 18:8832041-8832063 TATACTGTGTGTAAAAAAGATGG - Exonic
1155323683 18:24644580-24644602 TACCCGGAGTGTACAAATGAAGG + Intergenic
1156185627 18:34660031-34660053 TTATCTGAGTGTACCAAGGAGGG + Intronic
1157830084 18:50849690-50849712 TACTCTGGAAGTTCAAAAGAGGG - Intergenic
1164027498 19:21365995-21366017 TACTCTGTGTGTAGAAATGCAGG - Intronic
1164737430 19:30552187-30552209 TACTTTGAGTGAAGAAGAGAAGG - Intronic
1164879224 19:31716933-31716955 TTCTTTGAGTGTGCAAAAAATGG - Intergenic
1168547009 19:57261275-57261297 TATTGTGACTGTAGAAAAGACGG + Intergenic
930621095 2:53644407-53644429 TTCTCCAAGTGTCCAAAAGAGGG + Intronic
932979534 2:76647746-76647768 TCCTCTGAGTGAAAGAAAGACGG - Intergenic
933452499 2:82473485-82473507 TAGTATGGGTGTAGAAAAGAGGG - Intergenic
933592557 2:84248835-84248857 TATTCTGAGTGTTCACAGGATGG - Intergenic
934076976 2:88436821-88436843 TTCTGTGAGTGTATAAAAGGAGG - Intergenic
936666572 2:114603810-114603832 CCCTCTAAGTGTAAAAAAGAAGG + Intronic
937880733 2:126862688-126862710 TCATCTCAGTGTCCAAAAGAAGG - Intergenic
939375149 2:141355633-141355655 TATCTTGAGTGTACAAAAGAAGG - Intronic
940591120 2:155728986-155729008 GACTCTGATGGTTCAAAAGAAGG - Intergenic
941393081 2:164939838-164939860 TACTCTAAGAAGACAAAAGAAGG - Intronic
941799963 2:169648283-169648305 TACTCAGACTGGAGAAAAGAGGG + Intronic
942109051 2:172661927-172661949 GACTCAGAGTGTACAAACGCAGG - Intergenic
945622796 2:212163055-212163077 TATTCTGAGAGTCCAACAGAAGG - Intronic
945772349 2:214059952-214059974 TACTCAGGGTGAAAAAAAGAGGG - Intronic
946541226 2:220686695-220686717 TACTCTGAATTTATAAAAGCAGG - Intergenic
948934810 2:241156494-241156516 GACCCTGATTGTACAAAACATGG + Intronic
1169360695 20:4946315-4946337 TGCTCTGACTGTAGAAAAAAAGG + Intronic
1170990207 20:21294303-21294325 TACTATAAGAGTACAAAAGAGGG - Intergenic
1175803774 20:61815935-61815957 TTCTCTCAATTTACAAAAGAAGG + Intronic
1180003779 21:45009542-45009564 GACTCTCAGTGAAGAAAAGAGGG - Intergenic
1180026248 21:45163878-45163900 TACTCTGAGTCTACAGGAGCAGG - Intronic
1180396747 22:12354156-12354178 CACGCTGATTGTACAAACGAAGG + Intergenic
1180402967 22:12509973-12509995 CACGCTGATTGTACAAACGAAGG - Intergenic
1181757469 22:25034473-25034495 TACTCTGAGTGAACAAGCAAGGG - Intronic
1182041425 22:27241683-27241705 TACCCTGACTCTACAAGAGAAGG + Intergenic
1183760648 22:39813159-39813181 TTCTCTAAGTGTACAAACGGTGG - Intronic
949277244 3:2298598-2298620 TAATATGAATGTACCAAAGATGG - Intronic
951036427 3:17937873-17937895 TACTCTGAGGGAAAAAAAAATGG - Intronic
951302817 3:21018991-21019013 TATTTTGAGTGAACATAAGATGG - Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953369002 3:42371451-42371473 TACTCAGATTCTAGAAAAGATGG - Intergenic
954928957 3:54263426-54263448 TACTATGATTTTACAGAAGAGGG + Intronic
956588828 3:70891989-70892011 CAATCTTAGTGTACGAAAGATGG + Intergenic
957159960 3:76598143-76598165 TACACTGAGTGAAAAAAAAAAGG + Intronic
958447590 3:94234364-94234386 TTATCTGAGTGTCCAATAGATGG + Intergenic
959318388 3:104838856-104838878 GACTTTGGGAGTACAAAAGAAGG + Intergenic
959440084 3:106363125-106363147 TACTGAGAGTGGACAGAAGAGGG - Intergenic
961847055 3:129774575-129774597 TACTAAGAGAATACAAAAGAGGG + Intronic
966074069 3:175915319-175915341 TACTGTAAGTATTCAAAAGAAGG + Intergenic
967010320 3:185426857-185426879 TGCTCTGAGAGCACAGAAGAGGG - Intronic
967606249 3:191450316-191450338 TACTCTTGGTGTACAAATGCAGG - Intergenic
970095288 4:12457044-12457066 TGCTATGAGTGTAGAAAACAAGG - Intergenic
971536967 4:27765160-27765182 AACTTTGACTGTATAAAAGAGGG - Intergenic
972378925 4:38500695-38500717 TAGTCTGACTGTACCAAGGAAGG + Intergenic
972759149 4:42084777-42084799 TCCTGTGAGTGCACAAAGGAAGG - Intronic
974722255 4:65755717-65755739 TAATCTGAATGTACAAACTAAGG - Intergenic
975855222 4:78617454-78617476 AGCTCTGAGTGTACACAGGATGG - Intergenic
977437840 4:97022599-97022621 TTCTCTCAAAGTACAAAAGAGGG - Intergenic
978493552 4:109334490-109334512 TATTCTGAGTTTTCAGAAGATGG - Intergenic
980424506 4:132608796-132608818 AACTCTGAGTGAAGAAAAGTGGG + Intergenic
981619250 4:146675127-146675149 TATTCTGAGAAAACAAAAGAGGG - Intergenic
981681287 4:147401719-147401741 TACTCTGTATTTACAAAAGAAGG - Intergenic
984083550 4:175280382-175280404 TACTCAGACTGTACAAGTGAGGG - Intergenic
984348689 4:178564886-178564908 TTGTCTGAGAGTACAAGAGAAGG + Intergenic
987935589 5:24460421-24460443 TACTCTGAACCCACAAAAGAAGG + Intergenic
988666867 5:33338622-33338644 TCCTCAGAGTTTACAATAGATGG + Intergenic
989231749 5:39094956-39094978 GACTCTGAGTGTAGAAAGAAAGG + Intergenic
989755396 5:44946776-44946798 GACTCTGAGTTTAAAAAAGAAGG + Intergenic
992310513 5:75494201-75494223 TACTTTGAGTTTACCAAAAATGG + Intronic
992345630 5:75874448-75874470 TACACTGAATGGGCAAAAGATGG + Intergenic
993041026 5:82814945-82814967 TACTCTGTGTCTATGAAAGATGG - Intergenic
994699440 5:103114684-103114706 TACTGTGAATGTACCAATGAGGG - Intronic
994703992 5:103176618-103176640 TACTCTTAGTGTATACAAAAAGG + Intronic
998815445 5:146009436-146009458 TACTCTGAAAGTCCTAAAGAGGG - Intronic
1009660404 6:66604261-66604283 TACAGAGAGAGTACAAAAGAAGG + Intergenic
1009837375 6:69019798-69019820 TACTCTAATTGTCCATAAGAAGG - Intronic
1011203270 6:84862063-84862085 TACTCTGAATATACAAGTGATGG + Intergenic
1012123080 6:95391308-95391330 TACTCTGAGAGAAAATAAGAAGG - Intergenic
1016278975 6:142390872-142390894 TACTTTTCGTGTAAAAAAGAAGG - Intronic
1020501198 7:8923243-8923265 TACACAGAGTGTTTAAAAGATGG - Intergenic
1021121070 7:16796441-16796463 TACACTGAATGTACAAAGCAGGG - Intronic
1021550242 7:21863229-21863251 TATTCTGTGTGTGCCAAAGAAGG + Intronic
1021755961 7:23852986-23853008 TATTCTGAGATTAGAAAAGAAGG - Intergenic
1022218207 7:28286253-28286275 TGCTGTGAGTACACAAAAGAGGG - Intergenic
1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG + Intronic
1023475884 7:40577283-40577305 TACTCTGAGTGGAGGAGAGAGGG + Intronic
1027602765 7:80259865-80259887 TACTCTTAGACTACAAAATAAGG - Intergenic
1030580080 7:111344022-111344044 TACTGTGAGTATAGAAAAAATGG - Intronic
1030651280 7:112118828-112118850 GACTCTGTATGTACAACAGATGG - Intronic
1032750640 7:134836997-134837019 TTCTATGATAGTACAAAAGATGG - Intronic
1036627585 8:10484243-10484265 TACTCTGAAAGTGCAAATGAAGG + Intergenic
1040479385 8:47809766-47809788 AACTCTGAGTGAATAAAAGATGG + Intronic
1040484453 8:47856753-47856775 TACTCTGGGAGTAGAGAAGATGG + Intronic
1040703212 8:50092609-50092631 GACTCTGAGTGAAGAAGAGAGGG - Intronic
1041585359 8:59511284-59511306 TACGCTGAATGAACAAATGAGGG - Intergenic
1041818571 8:62002894-62002916 TACTATGAGTGAACAATACATGG + Intergenic
1044097320 8:88082953-88082975 TACTCTGATTGTACATTAGTGGG + Intronic
1044706060 8:95009811-95009833 TATTCTGTGTGTTCAATAGAGGG - Intronic
1045593833 8:103629895-103629917 TACTCTGGCAGTACAAAGGAAGG + Intronic
1046718087 8:117589102-117589124 TACTCTGAGAGTGTAAAATAGGG + Intergenic
1046816615 8:118591399-118591421 TAATGTGAGTGTAAAAAATAGGG - Intronic
1049915596 9:314954-314976 CATTCTGAGTCTACAAAAGGCGG + Intronic
1051947483 9:22588046-22588068 TACCCACAGTTTACAAAAGAAGG - Intergenic
1052767305 9:32654428-32654450 TACACTGAGTGGGCAAAAGCTGG + Intergenic
1053287919 9:36861797-36861819 TACTCTGAGTGTGCACAGGAGGG + Intronic
1055345370 9:75330465-75330487 TACACTGAGTGGGCAAAAGTTGG + Intergenic
1056048558 9:82744658-82744680 CACTCTGAGTGAAGAATAGAAGG - Intergenic
1058078931 9:100680807-100680829 TAATCTGAGTGTCCAAAACTGGG - Intergenic
1185681281 X:1890461-1890483 TACTTGGAGAGTCCAAAAGAAGG + Intergenic
1186316514 X:8376115-8376137 AACTCTGAAAGTAAAAAAGAAGG + Intergenic
1187853724 X:23616554-23616576 TACTCTGAGTGGCCACAAGAGGG - Intergenic
1190431153 X:50378944-50378966 TACTCTGAGTTTACCCAAGAAGG - Intronic
1191006978 X:55719821-55719843 TACTATGAGAGCACAAAGGAAGG - Intronic
1192830334 X:74744468-74744490 TCCTCTGAGTCTAGAAAAAAGGG + Exonic
1196657953 X:118239488-118239510 TTCACTGAGTAAACAAAAGAGGG + Intergenic
1197556882 X:127966661-127966683 TGCTATGAGTGTACAATAAAAGG - Intergenic
1198926745 X:141805354-141805376 ATCTCTGCATGTACAAAAGAGGG - Intergenic
1199882072 X:151981806-151981828 TACTCTGAATTTCCAAGAGAAGG - Intergenic