ID: 905118200

View in Genome Browser
Species Human (GRCh38)
Location 1:35660588-35660610
Sequence CTGTAAGTCCAGATGGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905118200_905118204 1 Left 905118200 1:35660588-35660610 CCAAGGTCCATCTGGACTTACAG No data
Right 905118204 1:35660612-35660634 TTCTTTCTAAGCTTGGCACATGG No data
905118200_905118207 10 Left 905118200 1:35660588-35660610 CCAAGGTCCATCTGGACTTACAG No data
Right 905118207 1:35660621-35660643 AGCTTGGCACATGGTATCTGGGG No data
905118200_905118205 8 Left 905118200 1:35660588-35660610 CCAAGGTCCATCTGGACTTACAG No data
Right 905118205 1:35660619-35660641 TAAGCTTGGCACATGGTATCTGG No data
905118200_905118203 -6 Left 905118200 1:35660588-35660610 CCAAGGTCCATCTGGACTTACAG No data
Right 905118203 1:35660605-35660627 TTACAGGTTCTTTCTAAGCTTGG No data
905118200_905118206 9 Left 905118200 1:35660588-35660610 CCAAGGTCCATCTGGACTTACAG No data
Right 905118206 1:35660620-35660642 AAGCTTGGCACATGGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905118200 Original CRISPR CTGTAAGTCCAGATGGACCT TGG (reversed) Intergenic
No off target data available for this crispr