ID: 905121873

View in Genome Browser
Species Human (GRCh38)
Location 1:35688703-35688725
Sequence GAATAGATAGAGGCTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905121870_905121873 3 Left 905121870 1:35688677-35688699 CCTGGTTGAAGGGATGAGGAAGA No data
Right 905121873 1:35688703-35688725 GAATAGATAGAGGCTTGAGGAGG No data
905121866_905121873 15 Left 905121866 1:35688665-35688687 CCAGGGAATAGACCTGGTTGAAG No data
Right 905121873 1:35688703-35688725 GAATAGATAGAGGCTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905121873 Original CRISPR GAATAGATAGAGGCTTGAGG AGG Intergenic
No off target data available for this crispr