ID: 905126154

View in Genome Browser
Species Human (GRCh38)
Location 1:35717574-35717596
Sequence CAATATTACATAAACAAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 309}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905126148_905126154 13 Left 905126148 1:35717538-35717560 CCCATGTCTCTGAAGCCGTCTTG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309
905126147_905126154 14 Left 905126147 1:35717537-35717559 CCCCATGTCTCTGAAGCCGTCTT 0: 1
1: 0
2: 1
3: 11
4: 171
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309
905126150_905126154 -2 Left 905126150 1:35717553-35717575 CCGTCTTGATACTGCCCCAATCA 0: 1
1: 0
2: 0
3: 6
4: 119
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309
905126144_905126154 29 Left 905126144 1:35717522-35717544 CCCATGTTTCCATGTCCCCATGT 0: 1
1: 0
2: 4
3: 28
4: 236
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309
905126149_905126154 12 Left 905126149 1:35717539-35717561 CCATGTCTCTGAAGCCGTCTTGA 0: 1
1: 0
2: 0
3: 13
4: 115
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309
905126143_905126154 30 Left 905126143 1:35717521-35717543 CCCCATGTTTCCATGTCCCCATG 0: 1
1: 0
2: 4
3: 32
4: 241
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309
905126146_905126154 20 Left 905126146 1:35717531-35717553 CCATGTCCCCATGTCTCTGAAGC 0: 1
1: 0
2: 1
3: 27
4: 263
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309
905126145_905126154 28 Left 905126145 1:35717523-35717545 CCATGTTTCCATGTCCCCATGTC 0: 1
1: 0
2: 3
3: 35
4: 340
Right 905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG 0: 1
1: 0
2: 1
3: 19
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905126154 Original CRISPR CAATATTACATAAACAAGCA CGG Intronic
902952450 1:19896906-19896928 CAAAATTACATAAAGTAGTACGG - Intronic
905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG + Intronic
908097948 1:60759984-60760006 CAAAATTACATAAGTAATCAAGG + Intergenic
908523358 1:64966025-64966047 CAAGTTTTCATAAACAAGCCCGG - Intronic
908850498 1:68370957-68370979 CAATAATAAATAATCAAGTAGGG + Intergenic
909297297 1:73967143-73967165 AAATCTGACAAAAACAAGCAAGG + Intergenic
909316204 1:74222937-74222959 CAAAATTAAATAAACAAGTTTGG - Intronic
909418281 1:75432656-75432678 CAATATTACAAAATGAAGCTGGG - Intronic
911015954 1:93332701-93332723 CAATATTTTATACACAAGAATGG - Intergenic
911360270 1:96867368-96867390 TAATATTACATGAACATGCTTGG - Intergenic
911360402 1:96869051-96869073 TAATATTACATGAACATGCTTGG - Intergenic
916644847 1:166773606-166773628 TTATATCACATAAACAATCAAGG + Intergenic
918030021 1:180798772-180798794 CAAGATTACAAAAATTAGCAGGG - Intronic
918350443 1:183650200-183650222 CAATATTAAGTGAAAAAGCAGGG - Intronic
919598022 1:199588866-199588888 CAATTGTACATAAATAAGCCTGG - Intergenic
921331946 1:214048197-214048219 AAATCTGACAAAAACAAGCAAGG + Intergenic
921414871 1:214874108-214874130 CAATACTACAGAACCAATCAAGG - Intergenic
922920850 1:229301790-229301812 CAATAGTAAGTAAAAAAGCAAGG - Intronic
923936674 1:238768594-238768616 CAAAATTTCAGAAACCAGCATGG + Intergenic
924292151 1:242547641-242547663 CAATATTACATTGACAAGAATGG - Intergenic
1062926842 10:1322562-1322584 CAATATTAACAAAACAGGCAAGG + Intronic
1064676096 10:17761764-17761786 CAATATTTGATTTACAAGCAAGG - Intronic
1064692746 10:17934577-17934599 CAAAATTAAATAAATAAGCTGGG - Intergenic
1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG + Intronic
1065662523 10:28020685-28020707 CCACATTACAAAAACACGCAAGG + Intergenic
1067305971 10:45064438-45064460 CAATAGTACATAAGAAATCATGG + Intergenic
1074031695 10:109695394-109695416 CAATAATACGTACACAATCAGGG + Intergenic
1074154884 10:110789387-110789409 CAAAAATAAATAAACAAACAAGG - Intronic
1074725728 10:116306994-116307016 CAATTTTACAAAATCAAGTAAGG + Intergenic
1074990653 10:118703360-118703382 CAACATTAAATGAAAAAGCAGGG - Intronic
1075446517 10:122517236-122517258 CAAAATTACAAAAATCAGCAGGG - Intergenic
1075759103 10:124841736-124841758 CAATAATACAAAAATTAGCAGGG - Intergenic
1076369495 10:129942351-129942373 CAAAATCACAAAAACAAGAAGGG + Intronic
1078957805 11:16221832-16221854 CAATGTTACAAAATCATGCATGG + Intronic
1079037789 11:17036014-17036036 CGATATCACAGAAAGAAGCATGG + Intergenic
1079513637 11:21240614-21240636 CAATAGTACATTAACAAGATTGG + Intronic
1081246803 11:40777289-40777311 CAATATTAGACAAATAATCAAGG - Intronic
1082631330 11:55545480-55545502 CAATTTGACATAACCAAGAAAGG + Intergenic
1083002369 11:59305384-59305406 AAACATAACATAAACAAGTATGG - Intergenic
1083412377 11:62503215-62503237 CACGATTACATAACCAGGCATGG + Intronic
1085954918 11:81380299-81380321 CAAAACTACAAAAAGAAGCATGG + Intergenic
1086515992 11:87613910-87613932 CAATATAAAGAAAACAAGCAAGG - Intergenic
1086847641 11:91771771-91771793 TAATACTAAAGAAACAAGCAAGG - Intergenic
1087753910 11:102035243-102035265 CAAAATAACACAAAAAAGCAGGG - Intergenic
1087887779 11:103499892-103499914 CAATAAAACATAAAGAAGCCAGG + Intergenic
1088327054 11:108611575-108611597 CAATATTATATAGAAAAGTAGGG + Intergenic
1088946088 11:114514121-114514143 CATCATTACATAAAAAAGCAAGG - Intergenic
1090303060 11:125663964-125663986 CAAGTTGACAAAAACAAGCAAGG - Intronic
1094106929 12:26822986-26823008 CAAGAATACATAATCAATCATGG + Intronic
1094646304 12:32328015-32328037 CATTATTACATAGACACACATGG - Exonic
1095656742 12:44678974-44678996 CAATAATACAAAAACTAGAAGGG + Intronic
1097043241 12:56168988-56169010 CATAAATAAATAAACAAGCATGG + Intronic
1097363789 12:58688377-58688399 CTCTATAACATAAACAATCAAGG - Intronic
1098283841 12:68888277-68888299 CAATATTATTTAAAGAAGGAGGG + Intronic
1098475233 12:70893526-70893548 CCATATTACTTACACAAGTAAGG - Intronic
1099138275 12:78936673-78936695 CAATTTTGCATGAACAAGCAAGG + Intronic
1099288518 12:80746068-80746090 CAATACTACAAAAAGAAGCATGG + Intergenic
1099666572 12:85638054-85638076 AAATATTATATAAACAAGTATGG + Intergenic
1100065016 12:90633431-90633453 AAATGTGACAAAAACAAGCAAGG + Intergenic
1100668028 12:96776787-96776809 CAATGTTACAAAATCATGCATGG - Intronic
1100818566 12:98409270-98409292 CAATAATACAAAAATAAGCTGGG + Intergenic
1100874762 12:98950334-98950356 CAAAAATACAAAAACTAGCAGGG + Intronic
1100900537 12:99235836-99235858 CAACATAAGAGAAACAAGCAAGG + Intronic
1101817264 12:108154840-108154862 CAATAATACATATGCAATCAAGG + Intronic
1104077815 12:125406016-125406038 AAATATTCCAAAAAAAAGCAAGG - Intronic
1105873895 13:24537175-24537197 AAATATTACATAAACTAAAAGGG + Intergenic
1106527216 13:30551859-30551881 CAATATTAAATAGCCAGGCATGG - Intronic
1107366991 13:39691063-39691085 CATAATTACATAAGCAAGGAAGG - Intronic
1109189334 13:59306721-59306743 AAATTTTACAGAAACAAGCCAGG + Intergenic
1109577916 13:64285949-64285971 TAATAATACATATACATGCAAGG - Intergenic
1110218775 13:73051236-73051258 CACTATTACAAAAAACAGCACGG + Intergenic
1110816100 13:79861381-79861403 CAATTTTAAAAAAACAAGTAAGG + Intergenic
1112335199 13:98509393-98509415 CAATTTTAAAAAAACAAACAAGG + Intronic
1113027216 13:105954216-105954238 TAATATTAAATAAAAAAGTAAGG - Intergenic
1113310260 13:109124726-109124748 CATTATTACATAAACACCTAAGG - Intronic
1113475746 13:110579780-110579802 CAATTATACAGAAATAAGCAAGG - Intergenic
1114852095 14:26393695-26393717 CAATATTATAAAAACAAGCTGGG + Intergenic
1115001071 14:28420442-28420464 AATTAATACATAAACAAGAAGGG + Intergenic
1115339764 14:32280815-32280837 AAAGAGTACATAAACAGGCAGGG + Intergenic
1115481191 14:33862824-33862846 TAATATTACATATATAAGCTGGG + Intergenic
1115512128 14:34147874-34147896 CAAAATAACATCAAGAAGCAAGG - Intronic
1116411548 14:44630187-44630209 CACTATTACTTAAATATGCAAGG - Intergenic
1116468492 14:45260555-45260577 CACTATCACAAGAACAAGCATGG - Intergenic
1118030781 14:61815960-61815982 CAACATTACCTAAACATGCCTGG - Intergenic
1120026465 14:79590611-79590633 CAATATTTCATGGACAACCAGGG - Intronic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1128730569 15:70018107-70018129 CACATTTACATACACAAGCAGGG - Intergenic
1128905465 15:71464131-71464153 CAAAATGGGATAAACAAGCATGG - Intronic
1129378840 15:75152965-75152987 CAAAAATACATAAATTAGCAGGG + Intergenic
1134556459 16:15169878-15169900 AAAAATTACAAAAATAAGCAAGG - Intergenic
1134917039 16:18081591-18081613 AAAAATTACAAAAATAAGCAAGG - Intergenic
1135389570 16:22078934-22078956 TAATATTACATAAGCAAACTTGG - Intronic
1135593377 16:23721604-23721626 CAATATTACATGAACTATCTAGG + Intergenic
1143422977 17:6810553-6810575 CAATAATAAATGAATAAGCATGG - Intronic
1143690271 17:8556766-8556788 CAACATTTCAAAAACAATCAAGG + Intronic
1146419699 17:32671577-32671599 CAATTTTACATAAGCAAGAGTGG + Intronic
1148709405 17:49666665-49666687 CAAAAATACAAAAACAAGCCTGG + Intronic
1151565763 17:74897041-74897063 CAAAATTAAATAGACAAGGAAGG + Intergenic
1203182330 17_KI270729v1_random:72167-72189 AAATATTAGATAATCAAGAAGGG + Intergenic
1154516915 18:15180153-15180175 AAATATTACATGATCAAGAAGGG - Intergenic
1155128644 18:22906297-22906319 CAAGAATACATAAAGAAGCTGGG - Intronic
1156483804 18:37452174-37452196 CATTATTACATTACCAAGCGTGG - Intronic
1156700805 18:39822121-39822143 CAATATTATATTAACATTCAGGG + Intergenic
1156761061 18:40591165-40591187 CAATATGTCATATACAAACATGG + Intergenic
1156776326 18:40793165-40793187 CAATATTAAGAAATCAAGCAGGG - Intergenic
1157085002 18:44571037-44571059 CAGTATTACACAAACATGCCTGG - Intergenic
1157336404 18:46741663-46741685 TAATATACCATAAACAAGCTGGG + Intronic
1158452235 18:57577295-57577317 AGATATTACATAAACAATGAGGG - Intronic
1160016214 18:75142718-75142740 CAATATTTGAAAAACAAGCGAGG - Intergenic
1160258289 18:77265841-77265863 CAAGACTACACAAAGAAGCAAGG + Intronic
1160324075 18:77925327-77925349 CAATAATACATTAACTAGCCAGG + Intergenic
1161537471 19:4828993-4829015 TAAAATTACAAAAACTAGCAGGG - Intronic
1165508689 19:36252894-36252916 TAATATGACATAAACAAGTGTGG - Intergenic
1165532208 19:36413248-36413270 CAATAATACAAAAATAAGCTGGG + Intronic
1165631961 19:37308866-37308888 TAATATGACATAAACAAGTGTGG + Intergenic
1167555340 19:50191433-50191455 CAATACTAAACCAACAAGCATGG + Intronic
1168231683 19:55036536-55036558 AAAAATTACAAAAACAAGCCAGG + Intronic
924967065 2:87492-87514 CATTATTATATAAAAAAACAAGG - Intergenic
926828051 2:16928924-16928946 CAAAATTACATAAATAAAAAAGG + Intergenic
928616550 2:33045380-33045402 AAATCTGACAAAAACAAGCATGG - Intronic
928863197 2:35885240-35885262 CAATATTACATTATATAGCATGG - Intergenic
930522136 2:52480835-52480857 CACTTTTATATAAAAAAGCATGG - Intergenic
931638882 2:64364012-64364034 AAATATTTCATAGAAAAGCAAGG - Intergenic
933060044 2:77725617-77725639 CAAAATTACCTAAAAAGGCAGGG - Intergenic
933467842 2:82678112-82678134 CAATTTTACATAAAAATACAAGG - Intergenic
934480540 2:94637541-94637563 AAAAATTATATAAACAAGGATGG + Intergenic
937656237 2:124379986-124380008 TAATAAAACATAAACAAACATGG - Intronic
938824673 2:134993016-134993038 AAATTTTAAATAAATAAGCAAGG - Intronic
940295635 2:152121267-152121289 AAAAATTACATTAACAAGCTCGG - Intronic
941723401 2:168836287-168836309 CAATAATAAAGAAAAAAGCATGG + Intronic
945629666 2:212257634-212257656 CAATGTTGCATAAACAATCATGG + Intronic
946540597 2:220680378-220680400 AAATATTACATATATATGCATGG + Intergenic
946574612 2:221061175-221061197 CAATATGACATCAAAATGCAGGG + Intergenic
946599012 2:221338896-221338918 CAAAAATACAAAAACAAGCTGGG + Intergenic
946902477 2:224385414-224385436 CAACATTAAATAAACCAACAAGG - Intronic
947104258 2:226651827-226651849 AAATATTTCAAAAACATGCAAGG + Intergenic
947440020 2:230111473-230111495 CTATATTACACAAACCTGCAAGG + Intergenic
947660264 2:231861398-231861420 CAATTTTAAATAAAAAAGGAGGG + Intergenic
948070256 2:235115214-235115236 AAATATTATATAACAAAGCAAGG + Intergenic
948081752 2:235212167-235212189 CAATATTTCAGAAAGAAGGAAGG - Intergenic
1169742663 20:8912221-8912243 CACTATCACAAGAACAAGCAAGG - Intronic
1169830764 20:9822441-9822463 CAATTGTACATAATTAAGCAGGG - Intronic
1170253881 20:14318111-14318133 CAATGTTCCATTAAAAAGCATGG - Intronic
1170385684 20:15813876-15813898 CACTATTACATAAAACAGCATGG + Intronic
1171061363 20:21965432-21965454 CAATTTTACAGAAACAAAAAAGG - Intergenic
1172942287 20:38662614-38662636 TAAAATTACAAAAACAAGCATGG - Intergenic
1177271065 21:18850210-18850232 CAAGACTACATAAAGCAGCAAGG - Intergenic
1177510934 21:22087188-22087210 CAATATGAAAAACACAAGCAAGG + Intergenic
1178082940 21:29083888-29083910 ATATATTACATAAACAAGAGAGG - Intronic
1182453928 22:30437754-30437776 CATTTTTACATAAACAATAAGGG + Intergenic
949667761 3:6360865-6360887 AAATAAAACATAAACAAGTAGGG - Intergenic
949780968 3:7687724-7687746 TACTATTACACAAACAAGGATGG - Intronic
951096328 3:18635281-18635303 CAAAGTAACATAAAAAAGCATGG + Intergenic
952201414 3:31132211-31132233 CTATATTACACAAAAAAGAATGG + Intergenic
952336085 3:32404319-32404341 CAAAATTACAAAAATTAGCAGGG - Intronic
952794238 3:37224736-37224758 AAATAATAAATAAATAAGCATGG + Intergenic
953899092 3:46829012-46829034 CAATGTTTCATAAACAAAGAAGG + Intergenic
957128313 3:76191522-76191544 AAATATTATATAATCAAACAAGG - Intronic
958493137 3:94804109-94804131 CAATATCACAGAATCAAGAAAGG + Intergenic
958502361 3:94928695-94928717 CAAAATTTCCTAAACAAGCATGG - Intergenic
958588003 3:96116739-96116761 CAATACTAAATTAACAATCAAGG + Intergenic
959639275 3:108614014-108614036 AAATATTAGAAAAAGAAGCAAGG + Intronic
960359150 3:116689622-116689644 AAATATCACCTTAACAAGCATGG + Intronic
961574092 3:127821062-127821084 CCAAATAACACAAACAAGCAGGG + Intronic
961842752 3:129731118-129731140 TAATATACCATAACCAAGCAGGG + Intronic
961842757 3:129731167-129731189 CAATATTTGAAAACCAAGCAAGG + Intronic
961963623 3:130879599-130879621 CAAAATAACATGAAAAAGCAAGG - Intronic
962005742 3:131347776-131347798 CAATATTACAAAAATTAGCCAGG + Intronic
962258185 3:133886288-133886310 TAGTATTACATACACAAGCAAGG - Intronic
963618614 3:147575350-147575372 CAATATCTCATAAACAAAAATGG - Intergenic
964201663 3:154123826-154123848 AAATATGACATAAAGAAACAGGG + Intronic
964782583 3:160356971-160356993 CAATATTTAGTAAACCAGCAGGG + Intronic
965067263 3:163865951-163865973 CAACATTATATAAAGGAGCAGGG - Intergenic
965107644 3:164377875-164377897 CAATATTACAGACACATTCATGG - Intergenic
965332137 3:167388838-167388860 AATTATTAAATAAACAAACAAGG - Intergenic
965696107 3:171410003-171410025 CAATTTTGTACAAACAAGCAAGG + Intronic
966492245 3:180540980-180541002 AAATCTGACAAAAACAAGCAAGG + Intergenic
967208639 3:187147352-187147374 CAATACTACATGACCAAACATGG - Intronic
969165474 4:5306700-5306722 CAACAATACACAAAAAAGCAAGG - Intronic
970763042 4:19514761-19514783 CATTATTACATTAACAATCTAGG - Intergenic
971340362 4:25763135-25763157 CAATGTTACAAAAACAATAAAGG - Intronic
971511575 4:27433173-27433195 GAAAATGACATAAACAAGGAAGG + Intergenic
971916744 4:32880067-32880089 CATTATGACATAAAATAGCAGGG - Intergenic
972173296 4:36374591-36374613 CAGGTTTTCATAAACAAGCAAGG + Intergenic
974685036 4:65216424-65216446 CAAAATTACAAAAACAAAAAAGG + Intergenic
975037726 4:69705038-69705060 CAATATTACATAAAAAACAAGGG + Intergenic
976032046 4:80767786-80767808 CAATAATAAATAAATAAGTAAGG - Intronic
976243110 4:82979774-82979796 CAAAAATACAAAAATAAGCAGGG + Intronic
976370447 4:84282145-84282167 CATTAGTATATAAAAAAGCAGGG + Intergenic
976508860 4:85883589-85883611 CATCATTACATAAACAAAGAGGG + Intronic
976584916 4:86785941-86785963 CAATAATACCTAAACAACCTAGG + Intronic
976860986 4:89665906-89665928 GAATAAAACAGAAACAAGCAAGG + Intergenic
976906583 4:90243770-90243792 AAATGTGACATAAATAAGCAGGG + Intronic
977338162 4:95723907-95723929 CAATATCAGATAAACAGACATGG - Intergenic
977425980 4:96867732-96867754 AAATCTGACAAAAACAAGCAAGG + Intergenic
978055548 4:104260210-104260232 AAATATTATTTAAACCAGCAAGG + Intergenic
978376856 4:108083228-108083250 AAATTTCACATCAACAAGCAAGG - Intronic
978821956 4:112977276-112977298 CAATATTATTTAAAGAAGAAAGG - Intronic
979743254 4:124178226-124178248 CAATTCTATATAAACAAACAAGG + Intergenic
980454169 4:133017776-133017798 CAATATTACAAAAAAAATCATGG + Intergenic
980474309 4:133291798-133291820 CAATAGTACATAAATAAATAAGG + Intergenic
981657393 4:147127436-147127458 AAATATAACAAAGACAAGCAGGG + Intergenic
981846963 4:149180707-149180729 CAACCTGACAAAAACAAGCAAGG + Intergenic
981959229 4:150515197-150515219 CAATATAACATTACCAAGGAGGG + Intronic
982387756 4:154830699-154830721 CAACATTACACAAAGAACCATGG + Intergenic
984112084 4:175629227-175629249 CTATTTTCCTTAAACAAGCATGG - Intergenic
984874557 4:184355720-184355742 CAATTTTGCATAAACTAGGATGG + Intergenic
985556247 5:559479-559501 CATTATTTCAAAAACCAGCAAGG + Intergenic
985977142 5:3429069-3429091 CAATATTACACAGATAGGCAGGG + Intergenic
986507584 5:8468521-8468543 AACTATTACATGCACAAGCATGG - Intergenic
987235597 5:15938291-15938313 CAATTTTTAATTAACAAGCAAGG + Exonic
987613608 5:20242486-20242508 CAGTATTACAGAAATAAGCCAGG - Intronic
988075560 5:26349518-26349540 CAAATTTATAGAAACAAGCAAGG - Intergenic
989713422 5:44429439-44429461 GAATATTACACAAACAAAAATGG - Intergenic
991274785 5:64832163-64832185 CAATATTACAAAATCACACATGG - Intronic
992674304 5:79090486-79090508 CAACATTACAGAAACAGTCATGG - Intronic
993420278 5:87692966-87692988 AAATCTCACAAAAACAAGCATGG - Intergenic
993549037 5:89250543-89250565 GAAGATGACATAAACAAGGAAGG + Intergenic
994030323 5:95134343-95134365 CAAGATTACATATAAAAGAATGG + Intronic
994203991 5:97011768-97011790 CAATATAACAGAAATAAGTACGG + Intronic
994206965 5:97046121-97046143 CACTCTTCCATAAAAAAGCAAGG + Intergenic
994535553 5:101025520-101025542 CAATATTGCACAAAGCAGCAAGG + Intergenic
995101586 5:108314163-108314185 CAATATTTAATAAGCAATCATGG + Intronic
995244137 5:109918271-109918293 CAAGATTACACAAAGCAGCAAGG - Intergenic
996567825 5:124900007-124900029 CAAAATTACAAAAACTAGCGGGG + Intergenic
996911352 5:128660514-128660536 CAAGATTGCATAAAGCAGCAAGG - Intronic
998125659 5:139619233-139619255 CAATAATACAAAAATTAGCAGGG + Intronic
998595557 5:143526314-143526336 CAATATTTTATAAAATAGCAAGG + Intergenic
1000057143 5:157617217-157617239 CAATATTATACAAACATGGAAGG + Intergenic
1000216536 5:159162727-159162749 AAATATTACATAAACCGGCCGGG - Intronic
1000312443 5:160058060-160058082 GAATATTACATAAACTGGCCGGG - Intronic
1000701071 5:164451084-164451106 CAAAATTAAATAAGCATGCAAGG - Intergenic
1000987500 5:167876650-167876672 CAAAATCATCTAAACAAGCAAGG - Intronic
1001497142 5:172196819-172196841 AAATATGAAAAAAACAAGCATGG - Intronic
1003727181 6:8778085-8778107 TAATATTAAATAAACAAGGAAGG - Intergenic
1004174076 6:13323738-13323760 CCATATTACATAACCAGACAGGG + Intronic
1006269237 6:32951154-32951176 CAAAACAACAAAAACAAGCAAGG + Intronic
1006605376 6:35252522-35252544 CAATATTACAGCCACAAACAAGG + Exonic
1006709789 6:36058299-36058321 CAATATTACGGTAACAACCATGG + Intronic
1007491945 6:42229890-42229912 CAACATTGCATAAACAGACATGG - Intronic
1009310173 6:62140185-62140207 CAATATTTTTGAAACAAGCAAGG + Intronic
1010896302 6:81368656-81368678 TAAGATGACATAAGCAAGCAGGG + Intergenic
1012392651 6:98760502-98760524 CACTATAACATAAAAGAGCAAGG + Intergenic
1012507171 6:99960703-99960725 AAATCTGACAAAAACAAGCAAGG + Intronic
1012641206 6:101617625-101617647 CAATTTTATATACACCAGCATGG - Intronic
1013814620 6:114083211-114083233 GAAAATTACAAAAACAAGAAGGG + Intronic
1015077905 6:129184710-129184732 CAATACAACATGAACAAGTAGGG - Intronic
1015779993 6:136855275-136855297 CAAGATTACATAAAATAGAAAGG - Intronic
1016098192 6:140064118-140064140 CAACACTACATAAAAAATCATGG + Intergenic
1016111284 6:140228706-140228728 CAATATTGCATCACCAAACATGG + Intergenic
1016153795 6:140779107-140779129 CTATATTAAATAAAATAGCATGG + Intergenic
1016280534 6:142413085-142413107 TAATATTACAAAAACAGACAAGG - Intronic
1016316932 6:142800256-142800278 CAATATTCAATTAACAACCATGG + Intronic
1018247949 6:161840292-161840314 CAATAATGCACAAACACGCAGGG - Intronic
1018883674 6:167912590-167912612 CATTATTTTATAAACAAACATGG + Intronic
1019785570 7:2974990-2975012 CAAAAATACAAAAACAAGCCGGG + Intronic
1019859621 7:3645431-3645453 CAAGATTACATAAATCAGTATGG + Intronic
1021705808 7:23366514-23366536 GAATAATACTTCAACAAGCATGG + Intronic
1021969757 7:25953992-25954014 CATTATGACATAAACATACATGG - Intergenic
1022053244 7:26701121-26701143 TTATATTACCTAAACAAGCCTGG + Intronic
1022892059 7:34711491-34711513 CAAGATTACAAAAATAATCATGG - Intronic
1023973461 7:45009138-45009160 CAAAAATACAAAAATAAGCAGGG + Intronic
1024412709 7:49064386-49064408 CAATTTTAGATAAATAAGAAGGG - Intergenic
1025153457 7:56580512-56580534 CAATAGTAAACAAAGAAGCATGG - Intergenic
1027746672 7:82083166-82083188 CAATATTCCATATATAAGTAAGG - Intronic
1028239177 7:88398567-88398589 AAATATTCTATAAAAAAGCATGG + Intergenic
1028652703 7:93169145-93169167 CAATATTAGAGAAAAAAGAATGG - Intergenic
1028791483 7:94858223-94858245 CTATATTAAATAAACAATTAGGG + Intergenic
1030447802 7:109669323-109669345 AAATAATACATTAACAAGTAAGG - Intergenic
1030803167 7:113879463-113879485 CAATCTTACATGACCAAGAAAGG - Exonic
1031050703 7:116942087-116942109 CAAAAATAAATAAACAGGCAAGG + Intergenic
1031450980 7:121917863-121917885 CAATATTACAAAAAGAAACCAGG - Intronic
1032105261 7:129023509-129023531 CAATATTAAATACACAAGATGGG + Intronic
1032935819 7:136730054-136730076 CAATATTAAAAAAAAAACCAAGG + Intergenic
1033852127 7:145510203-145510225 GTATATTATAAAAACAAGCAAGG - Intergenic
1033897868 7:146096563-146096585 CAATATTATTTAAAGAAGAAAGG + Intergenic
1035902094 8:3467764-3467786 CAATCCTAAATCAACAAGCATGG - Intronic
1038781733 8:30574005-30574027 CAAGATGACATAAAGAAGTAAGG + Intergenic
1041115586 8:54532761-54532783 AAATATGTCATAAACAAGCATGG - Intergenic
1041342539 8:56861094-56861116 CAATATTACAGAAAGATGCCAGG + Intergenic
1044434331 8:92144526-92144548 TAAAATTAAATAAACAAGGATGG - Intergenic
1044703759 8:94988421-94988443 TAGAATTAGATAAACAAGCAGGG + Intronic
1044711101 8:95058888-95058910 CAAAAATACATAAACTAGCCAGG + Intronic
1044720634 8:95142413-95142435 CAAAATTACATAAATTAGCCAGG - Intronic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1046375481 8:113374338-113374360 TAATATTTCAAAAACATGCAAGG - Intronic
1046988738 8:120424336-120424358 AAATAAAACATAAACAAGCAGGG + Intronic
1047009778 8:120659257-120659279 GAATATTACATAAAATAGCCAGG - Intronic
1050078548 9:1890478-1890500 CAATAACACATTCACAAGCAAGG + Intergenic
1051435745 9:17029589-17029611 CGATGTTACAAAATCAAGCATGG - Intergenic
1052746152 9:32443146-32443168 CAATATAACAGAAGAAAGCACGG + Intronic
1053677294 9:40446401-40446423 TAAAATTATATAAACAAGGATGG - Intergenic
1053927051 9:43072557-43072579 AAAAATTATATAAACAAGGATGG - Intergenic
1054286425 9:63178517-63178539 AAAAATTATATAAACAAGGATGG + Intergenic
1054290367 9:63281928-63281950 TAAAATTATATAAACAAGGATGG - Intergenic
1054388389 9:64586466-64586488 AAAAATTATATAAACAAGGATGG - Intergenic
1054507328 9:65929894-65929916 TAAAATTATATAAACAAGGATGG + Intergenic
1055139007 9:72854261-72854283 CAATATTGCATAAATGACCATGG + Intergenic
1055190055 9:73508099-73508121 GAATATTACATAAATTAGCTCGG + Intergenic
1055390188 9:75812806-75812828 CAATATTACATTAAAAAGGTTGG - Intergenic
1055462678 9:76533455-76533477 CAGTTTCAGATAAACAAGCATGG + Intergenic
1056596531 9:88012369-88012391 CAATAATACATAATAAAACAGGG + Intergenic
1058709299 9:107665711-107665733 CAAAATTACAAAAACTAGCCAGG - Intergenic
1058848698 9:108988707-108988729 CAATAAAACAGAAACATGCATGG - Intronic
1059241973 9:112813895-112813917 CAATATTATTTAAATCAGCAAGG - Intronic
1060469270 9:123933811-123933833 CAAAATCACATAGCCAAGCATGG - Intergenic
1060606251 9:124917077-124917099 TTATATAACATTAACAAGCATGG + Intronic
1185523018 X:755887-755909 CAATAATCCATACACAAACAAGG - Intergenic
1186033745 X:5397752-5397774 CCATAAAACATACACAAGCAAGG + Intergenic
1186929116 X:14369118-14369140 AATTATTACATAATCAGGCAAGG - Intergenic
1187264994 X:17723581-17723603 CAATATAAAATAAACATACAAGG - Intronic
1187373142 X:18726960-18726982 CAATAACAAATAAACAAGCTTGG - Intronic
1188474179 X:30572871-30572893 AAAGTTTACAAAAACAAGCAGGG + Intronic
1190360978 X:49648064-49648086 CAAAAATACATAAATAAGCTGGG - Intergenic
1192217149 X:69167978-69168000 CAAAAATACATATACAAGCTGGG - Intergenic
1192443635 X:71193925-71193947 CAATATTACAAAAAGAGGGAAGG - Intergenic
1192600365 X:72457010-72457032 TAATATAACATGACCAAGCAGGG + Intronic
1193612611 X:83650835-83650857 CAACCTGACAAAAACAAGCAAGG - Intergenic
1193807359 X:86011223-86011245 TTATATTACAAAAACATGCATGG + Intronic
1194694042 X:97023040-97023062 CTATAGTACATAAAGAAACAGGG - Intronic
1196421661 X:115528476-115528498 GAATATTACATAATCAAGCATGG + Intergenic
1196486206 X:116211556-116211578 TAAAATTACAAAAACATGCATGG + Intergenic
1196492069 X:116279235-116279257 CAATATTTGATAAAAAAGGAGGG + Intergenic
1198897447 X:141471449-141471471 CAAGATTTCATACTCAAGCAAGG - Intergenic
1199411538 X:147529258-147529280 CCATATTACAGAAACTCGCAAGG + Intergenic
1200907076 Y:8494630-8494652 CAATATTACACAAAAACACATGG - Intergenic
1200956580 Y:8954351-8954373 TAAAATTACAAAAACAAGCCAGG + Intergenic
1200956635 Y:8955263-8955285 CAATTAAACATAAACAAGCAGGG - Intergenic
1201261398 Y:12162216-12162238 CAATGTCACATAAGTAAGCAGGG + Intergenic
1201565631 Y:15362702-15362724 CAATAGTACATAAAAAAGAAAGG + Intergenic